| Literature DB >> 31244100 |
I-Te Chu1, Ting-Yuan Tseng1, Ta-Chau Chang1.
Abstract
Previously, we found the structural diversity of a mitochondrial sequence mt10251 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 could cause significant changes in terms of structural populations and polymorphism. In this work, we investigate the diverse G4 topologies of mt10251 and structural variation of its mutants. Using circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE), we first illustrate an unusual tetrameric G4 structure together with hairpin bulges formed by four strands of mt10251-d30 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGG). Of interest is that the structural conversion from a hairpin structure to diverse G4 structures in mt10251 is negligible in mt10251-d30 after the addition of 20 mM K+. Further kinetic and thermal studies of mt10251, mt10251-d30, and their mutants reveal the major factors in determining the transition from a hairpin structure to diverse G4 structures of mt10251 and the structural variation of their mutants after the addition of 20 mM K+.Entities:
Year: 2019 PMID: 31244100 DOI: 10.1021/acs.jpcb.9b02956
Source DB: PubMed Journal: J Phys Chem B ISSN: 1520-5207 Impact factor: 2.991