Literature DB >> 31223615

Different Methylation of CpG-SNPs in Behcet's Disease.

Yang Huang1, Handan Tan1, Qingfeng Cao1, Gangxiang Yuan1, Guannan Su1, Peizeng Yang1.   

Abstract

PURPOSE: We recently performed an Epigenome-Wide Association Studies (EWAS) study in Behcet's disease (BD) and identified various cytosine-phosphate-guanine (CpG) loci that were aberrantly methylated. In the current study, we wanted to investigate whether these sites contained genetic polymorphisms and whether the frequency of these polymorphisms was altered in BD.
METHODS: A two-stage study was performed. The first stage involved 358 BD patients and 704 healthy controls to investigate genetic variants of 10 CpG-SNPs (rs10454134, rs176249, rs3808620, rs10176517, rs11247118, rs78016579, rs9461624, rs10492166, rs34929465, and rs6507921) using an iPLEX Gold genotyping assay and a Sequenom MassARRAY. In the second stage, an additional 172 independent BD patients and 330 healthy individuals are to confirm trends found in the first stage.
RESULTS: A higher frequency of both the rs10454134 AG genotypes (p = 0.008, OR = 1.413, 95% CI = 1.094-1.826) and a lower GG genotype frequency (p = 0.003, OR = 0.630, 95% CI = 0.465-0.854) were found in BD patients compared to the controls in the first stage. However, after correcting for multiple comparisons, all associations identified in the first stage lost statistical significance. The frequencies of the other CpG-SNPs investigated were not different between BD patients and controls. The second stage was designed using an additional cohort to confirm the association with CpG-SNP, rs10454134. The data failed to confirm the association between this CpG-SNP and BD.
CONCLUSIONS: This study did not show an association between BD and CpG-SNPs in gene sites that were earlier shown to be aberrantly methylated.

Entities:  

Mesh:

Year:  2019        PMID: 31223615      PMCID: PMC6541967          DOI: 10.1155/2019/3489305

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Behcet's disease (BD) is a chronic, relapsing, and multisystemic inflammatory disorder. Its classical clinical characteristics include oral aphthae, genital ulcers, multiform skin lesions, and recurrent uveitis with hypopyon [1]. Its etiology and pathogenesis are not yet fully understood. Generally, it is thought that BD is caused by the interaction of genetic variation and environmental factors. To date, there are numerous genes shown to be associated with BD [2-4]. DNA methylation is a pivotal part of the epigenome and provides highly complementary data on the regulation of genomic regions [5, 6]. Previous study proved that epigenetic modification of some genes dynamics is involved in the pathogenesis of BD, such as cytoskeletal [7]. Furthermore, aberrant changes in DNA methylation have been shown to lead to abnormal gene expression in the pathogenesis of BD, including IL6, IL10, SOCS1, IRF8, GATA3, and TGF-β [8-12]. Sequence variations can change the CpG, which may result in indifferences in DNA methylation between individuals. Cytosine–phosphate–guanine single nucleotide polymorphisms (CpG-SNPs) are point mutated CpG sites [13] and may play a role in the methylation status of this gene region. DNA methylation is an important gene silencing mechanism and may play a role in controlling pathways of inflammation [14]. CpG-SNPs in the promoter regions have been found to be associated with various disorders, including type 2 diabetes [15], breast cancer [16], coronary heart disease [17], and psychosis [18]. However, SNPs located in CpG sites in patients with autoimmune diseases such as BD have not been reported and were therefore the subject of the study described here. Functional CpG-SNPs with an aberrant methylation status were selected from the Epigenome-Wide Association Study (EWAS) we performed earlier [19], and genotype frequency was compared between BD patients and healthy controls.

2. Materials and Methods

2.1. Study Population

The study recruited a total of 530 BD patients and 1034 healthy individuals (Table 1), visiting the uveitis center of the First Affiliated Hospital of Chongqing Medical University from January 2009 to September 2017. All individuals were Chinese Han and all BD patients had uveitis. BD patients and controls were matched according to race which all from Chinese Han and geography. Healthy individuals who had systemic immune diseases or other chronic diseases were excluded. Diagnosis of BD was made according to the standard International Study Group for BD, requiring the presence of oral ulceration as well as any two of the following symptoms: genital ulceration, uveitis, multiform lesions, or a positive pathergy test [20]. The local research ethics committee of the First Affiliated Hospital of Chongqing Medical University (permit no. 2009-201008) approved the study. A written informed consent was obtained from all participants which abided by the tenets of the Declaration of Helsinki.
Table 1

Clinical features, age, and sex distribution of BD patients and healthy controls.

Clinical FeaturesTotal%
Patients with BD a 530
Mean age ± SDb34.3 ± 9.6
Male43582.1
Female9517.9
Uveitis52098.1
Oral ulcer530100.0
Genital ulcer28654.0
Skin lesion39574.5
Arthritis10820.4
Pathergy reaction6512.3
Controls 1034
Mean age ± SD39.3 ± 10.5
Male50648.9
Female52851.1

a: BD = Behcet's disease,

b: SD = standard deviation;

2.2. CpG-SNPs Screening

Target CpG-SNPs were selected according to our previous EWAS results [19] that included 60 BD patients and 60 matched healthy controls using the Illumina Human Methylation450K platform (Illumina, San Diego, CA, USA). A series of screening criteria was used to find target sites including a CpG-SNP methylation p value less than 0.05 and a Beta.Difference either less than -0.14 or more than 0.14 or p value<10−5. Beta values used to score the methylation level ranging from 0 (unmethylated) to totally methylated [21, 22]. In addition, the minor allele frequency (MAF) in the Chinese Han population needed to be greater than 0.05, excluding the sites not included in the Han Chinese Hap Map database (https://www.ncbi.nlm.nih.gov/snp/). Furthermore, according to the UCSC (GRCh37/hg19) and HaploReg v4.1 (http://pubs.broadinstitute.org/mammals/haploreg/haploreg.php) databases [23, 24], the CpG-SNP sites located in potential functional regions (promoter region, enhancer region, CCCTC-binding factor (CTCF) binding region, first exon region, 5′UTR, TSS1500) [25] were selected. Finally, linkage disequilibrium (LD) data from the Han Chinese Hap Map database were also used to exclude SNPs in LD with each other. In total, 10 CpG-SNPs were selected based on these criteria and included rs10454134, rs176249, rs3808620, rs10176517, rs11247118, rs78016579, rs9461624, rs10492166, rs34929465, and rs6507921 (Table 3).
Table 3

SNPs located in differential methylation CpG sites from EWAS in BD.

Target_IDP.ValueBeta.DifferenceADDRESSA_IDCHRaUCSC_REFGENE_NAMEbFunctional regionCpG-SNPMAFc
cg101811803.65E-13-0.033524043397414152Promoterrs104541340.230
cg158355003.61E-12-0.035509286516944016CTCF-bindingrs1762490.276
cg124808431.8E-11-0.037228341236594458UBE2WTSS200;TSS200drs38086200.184
cg083384781.3E-10-0.042262334106173082HECW2Enhancerrs101765170.162
cg000627363.55E-10-0.0869364186372739215MEF2AEnhancerrs112471180.392
cg232967920.000000856-0.175644181726823705FBXO38Enhancerrs780165790.135
cg031576050.000000902-0.028707179536754276MDC11stExon;5′UTRers94616240.059
cg167449610.000103889-0.0612695196075741112CLECL1TSS200rs104921660.424
cg268246780.002223998-0.155996614497864171CAPZBPromoterrs349294650.258
cg002540950.004197255-0.1411903156978048718RPL17;SNORD58C;U58TSS1500rs65079210.478

a: CHR = Chromosome containing the CpG;

b: UCSC_REFGENE_NAME = Target gene name(s), from the UCSC database;

c: MAF = Minor allele frequency of SNP(s);

d: TSS = transcription start site;

e: UTR = untranslated region

2.3. DNA Extraction and Genotyping

The two experimental groups including both BD individuals and healthy controls donated peripheral blood, which was applied to extract genomic DNA extraction with a QIAmp DNA Blood Mini Kit (Qiagen Inc., Valencia, CA, USA) and stored in 3.2% sodium citrate-treated tubes at -80°C. The iPLEX Gold genotyping assay and Sequenom MassARRAY (Sequenom, CA, USA) were performed to identify genotype of the 10 CpG-SNPs. iPLEX reactions primers were designed by SNP Assay Design software (version 3.0) (Table 2). All procedures were performed according to manufacturer's instructions.
Table 2

Primers used in the analysis of restriction fragment length polymorphism (RFLP) in CpG-SNPs.

1st-PCRP2nd-PCRPUEP_SEQ
rs10454134ACGTTGGATGAACCAGTTACTCAGACTGCGACGTTGGATGGTAGAACCTCGTATCACCACATCACTGAATTTGCTCCG
rs176249ACGTTGGATGTACCTTCAGTGGCAGTCTACACGTTGGATGCAGATTTGAATGGAGCTCCCGAGCGCCCTCCAGCATGGCTTGCC
rs3808620ACGTTGGATGCAGTAACGAGAGTAAATGGGACGTTGGATGATGGCGCTCTGAGTACTTTCACTTTCTGTCTCAGTCC
rs10176517ACGTTGGATGGAGAACAGAAGCCTAGTTCAACGTTGGATGGTAAAGCCTTACTTTTTCCCCCTTTAAGAGAAAGAGAGGTC
rs11247118ACGTTGGATGGTACATGTTGTTCTCCCTGCACGTTGGATGCCTGAGGATGTGTCTCATACTGTGTCTCATACTCAAACT
rs78016579ACGTTGGATGACCTTTACCTACTGAACCTGACGTTGGATGACAGGAACCAGCTAGTTACCGTGAAACAATGAGTAGAATGTGA
rs9461624ACGTTGGATGCATTTCTCATGAGTCAGCGGACGTTGGATGATAGAGGGGCTGTGTCATAGTGTGTCATAGACGTCCGAC
rs10492166ACGTTGGATGGCTATCCTACTTTGGAGAAGACGTTGGATGCTTCCTCTTTTAGTTCAGGCAGGCATATATTCTCTGGC
rs34929465ACGTTGGATGTGGACAATCCCGAAATTGGCACGTTGGATGTACCCATTACCGTCCTTTCCCATCCTTCTACCACATGC
rs6507921ACGTTGGATGTCCCAAAGATCCTTAGACGGACGTTGGATGCCAAACCTTCTAAGCCATGCAGAAATTTTATCATCAAGACTTC

2.4. Statistical Analysis

The healthy controls should satisfy Hardy–Weinberg equilibrium (HWE) (p value<0.05). Hardy-Weinberg equilibrium analysis was using chi-square (χ2) test, while the genotype frequency was evaluated by direct counting. Fisher's exact test or χ2 test was applied to estimate the differences in the allele and genotype frequencies of all CpG-SNPs between BD patients and healthy controls. P value was carried out by SPSS (version 17.0; SPSS Inc., Chicago, IL). Multiple comparisons were performed to correct P-value by using the Bonferroni method, whereby the p value was multiplied with the number of comparisons (P corrected (Pc)). When Pc< 0.05, it was considered to be significant.

3. Results

3.1. Clinical Features of the Subjects

The demographics and clinical symptoms of the BD patients and the healthy controls are displayed in Table 1. The healthy cohort consisted of 506 men and 528 women, who were on average 39.3 ± 10.5 years old. The BD patients comprised of 435 men and 95 women, with an average age of 34.3 ± 9.6.

3.2. CpG-SNPs Selected

SNPs located in the CpG loci with a CpG-SNP methylation level with a p value of < 0.05 and a Beta.Difference either less than -0.14 or more than 0.14 and MAF>0.05 were identified and eleven CpG-SNPs were included, according to the following criteria: (1) the MAF in the Chinese Han population was greater than 0.05 (https://www.ncbi.nlm.nih.gov/snp/); (2) CpG-SNP sites are located in potential functional regions according to UCSC (GRCh37/hg19) and HaploReg v4.1 (http://pubs.broadinstitute.org/mammals/haploreg/haploreg.php) databases [23, 24]; (3) linkage disequilibrium (LD) data from the Han Chinese Hap Map database was considered. Three CpG-SNPs were chosen: rs78016579, rs34929465, and rs6507921. The methylation levels of CpG-SNPs were considered with any sites with a p value<10−5 and the MAF of SNP in the CpG site should be greater than 0.05. According to these criteria, 87 CpG-SNPs were included. However, after these CpG-SNPs were subjected to the aforementioned criteria, only 7 CpG-SNPs (rs10454134, rs176249, rs3808620, rs10176517, rs11247118, rs9461624, and rs10492166) were included in the study. Therefore, a total of 10 CpG-SNPs were included in this study (Table 3).

3.3. Genotyping of the CpG-SNPs in BD

Nine CpG-SNPs (rs10454134, rs176249, rs3808620, rs10176517, rs11247118, rs78016579, rs9461624, rs10492166, and rs6507921) were genotyped successfully in 370 BD patients and 704 controls. One CpG-SNP, rs34929465, was excluded, since it could not be analyzed successfully. Seven SNPs found in the healthy controls met the Hardy-Weinberg equilibrium and two SNPs (rs11247118, rs78016579), that deviated from the Hardy–Weinberg equilibrium (p-value<0.05), were excluded. Uncorrected p values only showed a significant association of rs10454134 with BD (Table 4). A higher frequency of both the rs10454134 AG genotypes (p = 0.008, OR = 1.413, 95% CI = 1.094-1.826) and a lower GG genotype frequency (p = 0.003, OR = 0.630, 95% CI = 0.465-0.854) were found in BD patients compared to the controls. After correcting for multiple comparisons, these associations lost statistical significance. To further confirm the trend observed for the CpG-SNP, rs10454134, 172 additional independent BD patients and 330 healthy individuals were recruited. This second stage study also failed to demonstrate an association between this CpG-SNP and BD, even after combining both cohorts (Table 5). Stratified analyses were performed to investigate whether these CpG-SNPs might show an association with the primary clinical features. We chose genital ulcers since this feature has a frequency of approximately 50% in our BD cohort. After Bonferroni correction, no association was observed after stratification by genital ulcers.
Table 4

Genotype and allele frequencies of CpG-SNP polymorphisms in BD and healthy controls (first stage study).

Target_IDCpG-SNPGenotypeBD n (%)Controls n (%)P valuePc valueOR95% CI
cg10181180rs10454134total sample 355 704
AA87 (0.245)173 (0.246)0.981NS0.9960.741-1.340
AG195 (0.549)326 (0.463)0.008NS1.4131.094-1.826
GG73 (0.206)205 (0.291)0.003NS0.6300.465-0.854
A369 (0.520)672 (0.477)0.065NS1.1850.989-1.420
G341 (0.480)736 (0.523)0.8440.704-1.011
cg15835500rs176249total sample 357 702
AA13 (0.036)25 (0.036)0.947NS1.0230.517-2.025
AG119 (0.333)207 (0.295)0.200NS1.1960.910-1.572
GG225 (0.630)470 (0.670)0.203NS0.8410.645-1.098
A145 (0.203)257 (0.183)0.266NS1.1370.906-1.427
G569 (0.797)1147 (0.817)0.8790.701-1.103
cg12480843rs3808620total sample 355 704
GG339 (0.955)670 (0.952)0.815NS1.0750.585-1.976
CG16 (0.045)33 (0.047)0.895NS0.9600.521-1.768
CC0 (0.000)1 (0.001)0.477NS//
G694 (0.977)1373 (0.975)0.742NS1.1060.608-2.012
C16 (0.023)35 (0.025)0.9040.497-1.645
cg08338478rs10176517total sample 354 703
CC190 (0.537)415 (0.590)0.096NS1.2440.962-1.609
CT145 (0.410)253 (0.360)0.115NS0.8100.624-1.053
TT19 (0.054)35 (0.050)0.787NS0.9240.520-1.640
C525 (0.742)1083 (0.770)0.144NS1.1690.948-1.441
T183 (0.258)323 (0.230)0.8560.694-1.055
cg03157605rs9461624total sample 357 704
GG325 (0.910)619 (0.879)0.162NS0.7390.484-1.130
TG32 (0.090)84 (0.119)0.182NS1.3340.873-2.040
TT0 (0.000)1 (0.001)0.476NS//
G682 (0.955)1322 (0.939)0.122NS0.7210.476-1.094
T32 (0.045)86 (0.061)1.3860.914-2.102
cg16744961rs10492166total sample 358 696
GG123 (0.344)251 (0.361)0.584NS0.9280.710-1.212
GA169 (0.472)344 (0.494)0.495NS0.9150.709-1.181
AA66 (0.184)101 (0.145)0.098NS1.3320.947-1.871
G415 (0.580)846 (0.608)0.212NS0.8900.741-1.069
A301 (0.420)546 (0.392)1.1240.936-1.350
cg00254095rs6507921total sample 358 677
CC103 (0.288)232 (0.343)0.072NS1.2910.977-1.705
CT181 (0.506)308 (0.455)0.121NS0.8160.632-1.055
TT74 (0.207)137 (0.202)0.869NS0.9740.709-1.337
C387 (0.541)772 (0.570)0.196NS1.1280.940-1.353
T329 (0.459)582 (0.430)0.8870.739-1.064
Table 5

Genotype and allele frequencies of rs10454134 in BD and healthy controls (first and second stage cohorts combined).

Target_IDCpG-SNPGenotypeBD n (%)Controls n (%)P valuePc valueOR95%CI
cg10181180rs10454134total sample 530 1034
AA126 (0.238)254 (0.246)0.730NS0.9580.750-1.224
AG279 (0.528)485 (0.469)0.032NS1.2581.020-1.552
GG125 (0.234)295 (0.285)0.037NS0.7730.607-0.985
A532 (0.502)993 (0.480)0.250NS1.0910.941-1.265
G528 (0.498)1075 (0.520)0.2500.9170.791-1.063

4. Discussion

In this study, we failed to find an association between functional CpG-SNPs and BD. Functional CpG-SNPs were selected from data obtained in a previous study, whereby we identified various CpG sites with a different methylation status in BD patients [19]. The study presented here expanded these findings and investigated whether genetic polymorphisms in these sites might affect predisposition to BD. The fact that no association could be detected suggests that methylation of these sites may not be dependent on genetic variation of these sites themselves but may be regulated by other mechanisms. Further studies are needed to elucidate the exact mechanisms involved. BD is considered an autoimmune or autoinflammatory disorder, characterized by chronic and recurrent episodes of posterior or panuveitis. It is generally thought that BD is caused by the combination of genetic variants and environmental factors. Accumulated evidences in previous studied have unfolded epigenetic control of IL6, IL10, SOCS1, IRF8, GATA3 and TGF-β expression participates in the pathogenesis of BD [8-12]. The introduction or removal of CpG dinucleotides (possible sites of DNA methylation associated with the environment [6]) has been suggested as a potential mechanism through which SNPs can influence gene transcription and expression via epigenetics [26-29]. Many studies have reported that CpG-SNPs are associated with different diseases, such as type 2 diabetes, breast cancer, coronary heart disease, and psychosis which show a clear interaction between genetic (SNPs) and epigenetic (DNA methylation) regulation [15-18]. The role of SNPs located in CpG sites in autoimmune disease has not been widely addressed and we therefore expanded our earlier studies in this area. We chose BD, since this is a uveitis entity that is commonly observed in China allowing sufficiently large sample sizes to achieve adequate statistical power and allow meaningful conclusions. Identification of genetic variants may lead to novel therapies even in the absence of direct knowledge of the pathogenetic mechanisms involved. A previous study, where a CpG-SNP MWAS (methylome-wide association studies) was performed, showed that CpG-SNP rs3796293 reached methylome wide significance in psychosis [18]. Rs3796293 is located in the gene encoding for interleukin 1 receptor accessory protein and supports the role of local inflammation in the pathogenesis of psychosis. In a genome wide association study (GWAS), rs3796293 was not found to be associated with the disease, suggesting that methylation of rs3796293 may not be the directly related to genetic variation of this site [18]. This result is consistent with our study in that genetic variation of significant methylation loci in BD did not show an effect on disease risk. This study has several limitations. As SNPs were only selected if they satisfied the defined criteria, other unknown functional SNPs in CpG loci with a potential association with BD may have been missed and need to be investigated in future studies. Despite the fact that we had a large cohort of patients, it is possible that a weak but significant association might have been missed. The gene frequency of the SNPs analyzed in our study has only been tested in normal populations and no reference is available in clinical disease. It should also be noted that methylation changes at certain loci may be the result of the disease rather than its cause.

5. Conclusion

In conclusion, this study did not show an association between BD and CpG-SNPs in sites that have an aberrant methylation status.
  29 in total

Review 1.  Preventing transcriptional gene silencing by active DNA demethylation.

Authors:  Avnish Kapoor; Fernanda Agius; Jian-Kang Zhu
Journal:  FEBS Lett       Date:  2005-08-31       Impact factor: 4.124

Review 2.  Criteria for diagnosis of Behçet's disease. International Study Group for Behçet's Disease.

Authors: 
Journal:  Lancet       Date:  1990-05-05       Impact factor: 79.321

3.  The dinucleotide CG as a genomic signalling module.

Authors:  Adrian Bird
Journal:  J Mol Biol       Date:  2011-02-03       Impact factor: 5.469

Review 4.  CpG islands and the regulation of transcription.

Authors:  Aimée M Deaton; Adrian Bird
Journal:  Genes Dev       Date:  2011-05-15       Impact factor: 11.361

5.  A candidate CpG SNP approach identifies a breast cancer associated ESR1-SNP.

Authors:  Sophia Harlid; Malin I L Ivarsson; Salma Butt; Shehnaz Hussain; Ewa Grzybowska; Jorunn Erla Eyfjörd; Per Lenner; Asta Försti; Kari Hemminki; Jonas Manjer; Joakim Dillner; Joyce Carlson
Journal:  Int J Cancer       Date:  2011-03-11       Impact factor: 7.396

6.  Allele-specific methylation is prevalent and is contributed by CpG-SNPs in the human genome.

Authors:  Robert Shoemaker; Jie Deng; Wei Wang; Kun Zhang
Journal:  Genome Res       Date:  2010-04-23       Impact factor: 9.043

7.  Immune response genes in uveitis.

Authors:  Liping Du; Aize Kijlstra; Peizeng Yang
Journal:  Ocul Immunol Inflamm       Date:  2009 Jul-Aug       Impact factor: 3.070

8.  Methylation-sensitive sequence-specific DNA binding by the c-Myc basic region.

Authors:  G C Prendergast; E B Ziff
Journal:  Science       Date:  1991-01-11       Impact factor: 47.728

9.  Clinical features of chinese patients with Behçet's disease.

Authors:  Peizeng Yang; Wang Fang; Qianli Meng; Yalin Ren; Lin Xing; Aize Kijlstra
Journal:  Ophthalmology       Date:  2007-08-10       Impact factor: 12.079

10.  HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants.

Authors:  Lucas D Ward; Manolis Kellis
Journal:  Nucleic Acids Res       Date:  2011-11-07       Impact factor: 16.971

View more
  1 in total

1.  Ethanol extract of Ligustrum lucidum Ait. leaves suppressed hepatocellular carcinoma in vitro and in vivo.

Authors:  Yan Luo; Jin Yang; Guoyan Tian; Jin Chen; Tao Gao; Junping Shi
Journal:  Cancer Cell Int       Date:  2019-09-26       Impact factor: 5.722

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.