Yanjun Kou1, Yunlong He2, Jiehua Qiu1, Yazhou Shu1, Fan Yang2, YiZhen Deng3, Naweed I Naqvi2. 1. State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou, 311400, China. 2. Temasek Life Sciences Laboratory, and Department of Biological Sciences, 1 Research Link, National University of Singapore, 117604, Singapore. 3. Guangdong Province Key Laboratory of Microbial Signals and Disease Control, Integrative Microbiology Research Centre, South China Agricultural University, Guangzhou, 510642, China.
Abstract
Magnaporthe oryzae causes blast disease, which is one of the most devastating infections in rice and several important cereal crops. Magnaporthe oryzae needs to coordinate gene regulation, morphological changes, nutrient acquisition and host evasion in order to invade and proliferate within the plant tissues. Thus far, the molecular mechanisms underlying the regulation of invasive growth in planta have remained largely unknown. We identified a precise filamentous-punctate-filamentous cycle in mitochondrial morphology during Magnaporthe-rice interaction. Interestingly, disruption of such mitochondrial dynamics by deletion of genes regulating either the mitochondrial fusion (MoFzo1) or fission (MoDnm1) machinery, or inhibition of mitochondrial fission using Mdivi-1 caused significant reduction in M. oryzae pathogenicity. Furthermore, exogenous carbon source(s) but not antioxidant treatment delayed such mitochondrial dynamics/transition during invasive growth. In contrast, carbon starvation induced the breakdown of the mitochondrial network and led to more punctate mitochondria in vitro. Such nutrient-based regulation of organellar dynamics preceded MoAtg24-mediated mitophagy, which was found to be essential for proper biotrophic development and invasive growth in planta. We propose that precise mitochondrial dynamics and mitophagy occur during the transition from biotrophy to necrotrophy and are required for proper induction and establishment of the blast disease in rice.
Magnaporthe oryzae causes blast disease, which is one of the most devastating infections in rice and several important cereal crops. Magnaporthe oryzae needs to coordinate gene regulation, morphological changes, nutrient acquisition and host evasion in order to invade and proliferate within the plant tissues. Thus far, the molecular mechanisms underlying the regulation of invasive growth in planta have remained largely unknown. We identified a precise filamentous-punctate-filamentous cycle in mitochondrial morphology during Magnaporthe-rice interaction. Interestingly, disruption of such mitochondrial dynamics by deletion of genes regulating either the mitochondrial fusion (MoFzo1) or fission (MoDnm1) machinery, or inhibition of mitochondrial fission using Mdivi-1 caused significant reduction in M. oryzae pathogenicity. Furthermore, exogenous carbon source(s) but not antioxidant treatment delayed such mitochondrial dynamics/transition during invasive growth. In contrast, carbon starvation induced the breakdown of the mitochondrial network and led to more punctate mitochondria in vitro. Such nutrient-based regulation of organellar dynamics preceded MoAtg24-mediated mitophagy, which was found to be essential for proper biotrophic development and invasive growth in planta. We propose that precise mitochondrial dynamics and mitophagy occur during the transition from biotrophy to necrotrophy and are required for proper induction and establishment of the blast disease in rice.
Mitochondria, the semi‐autonomous double‐membrane bound organelles, generate most of the adenosine triphosphate (ATP) for diverse cellular functions and are involved in various physiological processes, including lipid metabolism, redox signalling, calcium and iron homeostasis, and programmed cell death (Nunnari and Suomalainen, 2012; Zemirli and Morel, 2018). Depending on the cellular physiology and environment, mitochondria exhibit a variety of morphologies, ranging from elongated and interconnected networks to small spherical organelles. The mitochondrial shape is dynamic and depends on the balance between two opposing processes, fusion and fission, which occur continuously during the growth cycle (Westermann, 2010). Maintaining the mitochondrial morphology in steady state by the balance of fusion and fission activities is critical for living cells. When this equilibrium is broken, mitochondrial shape and dynamics are disturbed, leading to important physiological consequences, including increased cellular stress and various diseases (Chang and Doering, 2018; Delettre et al., 2000; Guan et al., 1993; Kijima et al., 2005; Ma et al., 2009; Mozdy et al., 2000; Rapaport et al., 1998; Sesaki and Jensen, 2001; Zemirli and Morel, 2018).The fusion and fission machineries of mitochondria are well conserved from yeast to mammals. In yeast, mitochondrial fusion mainly depends on the transmembrane GTPase Fzo1, membrane‐anchored dynamin GTPase Mgm1, and Ugo1, which links the outer and inner membrane fusion machineries (Guan et al., 1993; Rapaport et al., 1998; Sesaki and Jensen, 2001). In yeast, the loss of Fzo1, Mgm1 or Ugo1 leads to numerous small fragmented mitochondria due to a block in fusion and amidst ongoing fission of mitochondria (Guan et al., 1993; Rapaport et al., 1998; Sesaki and Jensen, 2001). The Fis1‐Mdv1/Caf4‐Dnm1 complex constitutes the major mitochondrial fission pathway in yeast (Griffin et al., 2005; Mozdy et al., 2000). Fis1, a tail‐anchored outer membrane protein, functions as a membrane receptor, and Mdv1/Caf4 serves as an adaptor to recruit dynamin‐related protein Dnm1 to the fission sites in mitochondria (Griffin et al., 2005; Mozdy et al., 2000). Dnm1 is the key mediator of membrane scission during mitochondrial division (Mozdy et al., 2000). Loss of either Fis1 or Dnm1 blocks fission, resulting in highly interconnected fishnet‐like mitochondria (Mozdy et al., 2000).In addition to fusion and fission machineries, mitochondrial homeostasis requires proper mitophagy, which is the selective sequestration of mitochondria by autophagosomes followed by their degradation in vacuoles/lysosomes (Liu et al., 2014). Mitophagy is a key mechanism in organellar quality control and is responsible for the removal of damaged or unwanted mitochondria (Liu et al., 2014). In yeast, the mitochondrial outer membrane receptor Atg32 is essential for mitophagy (Kanki et al., 2009; Okamoto et al., 2009). In response to nitrogen starvation or inhibition of mTOR following growth in a non‐fermentable carbon source, Atg32 directs mitochondria to the autophagosome through its interaction with the core autophagic machinery, including Atg8 and Atg11, to induce mitophagy (Kanki et al., 2009; Okamoto et al., 2009). Such receptors sense stimuli that induce mitophagy and couple mitochondrial dynamics to the quality control machinery (Mao and Klionsky, 2013).Although the fusion and fission machineries are highly conserved, diverse mechanisms ensure proper organellar dynamics and distribution to optimize mitochondrial function in response to changing environments and cellular needs. The entire mitochondrial network is fused during G1‐S phase transition and fragmented/punctate in the late S and M phase depending on the cellular environment in rat kidney cells (Mitra et al., 2009). In addition, the mitochondrial dynamics are modulated in response to certain types and/or severity of stresses and adapt their form by promoting fusion or fission (Shutt and McBride, 2013). When cells are subjected to mild stresses, such as moderate nutrient starvation, protein synthesis inhibition or mTOR inhibition induced autophagy, mitochondria tend to become more fused to increase ATP production and escape from mitophagy (Gomes et al., 2011; Li et al., 2015; Tondera et al., 2009). Conversely, the mitochondrial fission machinery is activated upon prolonged nutrient stress, leading to degradation via mitophagy or apoptosis (Frank et al., 2001; Toyama et al., 2016). It is clear that mitochondrial dynamics and mitophagy are directly associated with metabolic status and stress conditions (Mao and Klionsky, 2013; Toyama et al., 2016; Twig et al., 2008).Magnaporthe oryzae is a hemibiotroph that initially establishes a close biotrophic association to acquire nutrients from the live host cells, but later switches to the necrotrophic killing phase to obtain nutrients from dead plant tissues (Fernandez and Orth, 2018). During the infection cycle in M. oryzae, the three‐celled conidia are deposited by rain splashes and stick to the rice leaf surface. Under proper conditions, such conidia germinate and form appressoria to assist in the breach of the rigid rice cuticle. Once inside the host cell, M. oryzae differentiates into invasive hyphae and spreads to neighbouring cells, resulting in typical lesion formation. During invasive growth, M. oryzae needs to coordinate the nutrient sensing, gene expression regulation and morphological changes, acquiring nutrients from rice cells and eluding the plant immunity to adapt to the host milieu (Marroquin‐Guzman et al., 2017). The molecular mechanisms involved in regulating mitochondrial homeostasis during invasive growth have not been explored in depth. Recent studies have shown that the complex composed of MoDnm1, MoFis1 and MoMdv1 regulates the mitochondrial fission in M. oryzae (Zhong et al., 2016). Disruption of MoDNM1 or MoFIS1 results in defects in mitochondria fission and pathogenicity (Khan et al., 2015; Zhong et al., 2016). However, the regulation and function of mitochondrial dynamics during in planta development in M. oryzae remains to be investigated further. Our recent analyses showed that the sorting nexin MoAtg24 regulates mitophagy in the foot cells and is necessary for proper asexual differentiation (He et al., 2013). Whether mitophagy occurs during invasive growth and whether MoAtg24 functions during in planta development in M. oryzae needs to be explored further.In this study, a unique filamentous‐punctate‐filamentous cycle in mitochondrial morphology and dynamics was observed during the early infectious growth of M. oryzae. To uncover the role of this specific cycle and mitophagy, mutants defective in mitochondrial fusion, fission and mitophagy were generated via deletion of MoFZO1, MoDNM1 or MoATG24, respectively. Characterization of Modnm1∆, Mofzo1∆ and Moatg24Δ strains, and Mdivi‐1‐based chemical inhibition of mitochondrial division revealed that mitochondrial fusion and fission machineries and mitophagy are required for maintaining mitochondrial dynamics and are necessary for proper infection and pathogenesis in M. oryzae. We provide evidence that carbon starvation triggers such specific mitochondrial dynamics during the early stages of rice blast. Overall, our study demonstrates that tightly controlled mitochondrial dynamics and mitophagy are required for proper invasive growth during establishment of the blast disease in rice.
Results
Mitochondrial dynamics during M. oryzae–rice interaction
We first examined mitochondrial morphology during in planta growth of wild‐type (WT) M. oryzae using the Mito‐GFP [as the mitochondrial marker (He et al., 2013; Patkar et al., 2012)] strain. The conidia of the Mito‐GFP strain were inoculated on sheaths from 21‐day‐old susceptible rice seedlings (Oryza sativa cultivar CO39) and incubated in a humid chamber at room temperature. Mitochondrial morphology was examined at the following three time points post‐inoculation: 30 h post‐inoculation (hpi), when the fungus successfully penetrated the rice epidermis, 48 hpi, when most of the invasive hyphae spread into the neighbouring rice cells and necrotrophy starts to occur, and 72 hpi, when necrotrophy/lesion formation could be observed. At 30 hpi, the majority of mitochondria (81.2 ± 1.9%) were in a tubular or filamentous network (Fig. 1). In contrast, most mitochondria (83.9 ± 9.9%) were fragmented or punctate at 48 hpi (Fig. 1). Interestingly, about half of the mitochondria (50.5 ± 5.9%) appeared to be filamentous or tubular again at 72 hpi (Fig. 1). However, such specific and dynamic changes in the mitochondrial network were not evident during appressorium formation (Fig. S1). Such temporal and dramatic changes in mitochondrial morphology indicated that M. oryzae likely faces dynamic environmental or cellular changes that significantly impact mitochondrial form/function during the first 72 h of in planta growth.
Figure 1
Specific changes in mitochondrial morphology during in planta growth of Magnaporthe oryzae. (a) Mitochondrial morphology in M. oryzae during infection. The conidial suspension of the Mito‐GFP strain was inoculated on rice sheath (Oryza sativa cultivar CO39). Confocal microscopy was carried at 30, 48 and 72 h post‐inoculation (hpi). The 3D reconstruction of the mitochondrial morphology was performed in Bitplan Imaris. Red spots and green filaments represent punctate and filamentous mitochondria, respectively. Scale bar: 8 μm. (b) Quantification of the different morphologies of mitochondria in the wild‐type Mito‐GFP strain during infection. Error bars represent mean ± SD from three independent replicates. Sample size is more than 200 appressoria penetration sites/host tissue per analysis.
Specific changes in mitochondrial morphology during in planta growth of Magnaporthe oryzae. (a) Mitochondrial morphology in M. oryzae during infection. The conidial suspension of the Mito‐GFP strain was inoculated on rice sheath (Oryza sativa cultivar CO39). Confocal microscopy was carried at 30, 48 and 72 h post‐inoculation (hpi). The 3D reconstruction of the mitochondrial morphology was performed in Bitplan Imaris. Red spots and green filaments represent punctate and filamentous mitochondria, respectively. Scale bar: 8 μm. (b) Quantification of the different morphologies of mitochondria in the wild‐type Mito‐GFP strain during infection. Error bars represent mean ± SD from three independent replicates. Sample size is more than 200 appressoria penetration sites/host tissue per analysis.
The role of mitochondrial dynamics in invasive growth in M. oryzae
Mitochondrial dynamics through fusion and fission during invasive growth occurred prior to lesion development, raising the possibility that such organellar dynamics might play an important role in the establishment and spread of the blast disease. To determine the role of such changes in the morphology and dynamics of mitochondria during M. oryzae infection, we generated mutants defective in mitochondrial fission (Modnm1∆, Fig. S2) or inhibited mitochondrial fission using Mdivi‐1, or disrupted the mitochondrial fusion (Mofzo1∆, Fig. S3) to alter the overall mitochondrial network dynamics, and examined their invasive growth and the pathogenicity.MoDNM1 is known as an important mitochondria fission gene in M. oryzae (Zhong et al., 2016). In our study, MoDNM1 was simply used as a marker gene for analysing the loss of mitochondrial fission in M. oryzae. A gene‐deletion mutant of MoDNM1 was generated in the Mito‐GFP strain. As previously reported (Zhong et al., 2016), the Modnm1∆ strain exhibited the characteristic tubular or fishnet‐like mitochondrial structures (Fig. 2a), suggesting that the Modnm1∆ is indeed incapable of mitochondrial fission. To verify the role of mitochondrial fission in fungal pathogenicity, the conidial suspension from WT, Modnm1∆ or Modnm1∆ complemented strain was used for blast infection assays on rice seedlings. The Modnm1∆ strain showed highly reduced pathogenicity and formed small and highly restricted lesions at 7 days post‐inoculation (dpi) (Fig. 2b,c). Furthermore, mitochondria in Modnm1∆ were tubular or filamentous at 30, 48 and 72 hpi, while a majority of mitochondria were fragmented/punctate in the WT at 48 hpi (Fig. 3). Since the Modnm1∆ strain has pleiotropic defects in M. oryzae, we also performed the mitochondrial fission inhibitor treatment to confirm the role of mitochondrial fission during blast infection. Treatment with Mdivi‐1, which inhibits mitochondrial fission in M. oryzae (Zhong et al., 2016), resulted in extensive tubular mitochondrial structures in M. oryzae and significantly reduced the invasive growth in rice cells (Fig. 4). Based on these results, we conclude that mitochondrial fission plays an important role in invasive growth and lesion formation by M. oryzae.
Figure 2
Mitochondrial fusion and fission are required for proper pathogenesis of Magnaporthe oryzae. (a) The function of MoDNM1 and MoFZO1 in mitochondrial fission and fusion. Two‐day‐old liquid CM‐grown mycelia of the indicated strains were used for imaging with confocal microscopy. Most of the mitochondria in Modnm1Δ formed elongated or interconnected fishnet‐like structures, while the mitochondria were punctate or fragmented in Mofzo1Δ in vegetative mycelia. (b) The rice seedling (Oryza sativa cultivar CO39) infection assay of wild‐type (WT), Modnm1Δ, Modnm1Δ complementation strain (Modnm1Δ‐C), Mofzo1Δ and Mofzo1Δ complemented strain (Mofzo1Δ‐C). (c) Detailed observation and statistical analysis of invasive growth in rice sheath cells at 40 h post‐inoculation. Four types (illustrated in the right panel with corresponding colour labels: no penetration, penetration with primary hyphae, with differentiated secondary invasive hyphae, and invasive hyphae spreading into neighbouring cells) were quantified. Data represent mean ± SD of three independent experiments, with n = 200 appressoria per analysis. Scale bar represents 5 μm.
Figure 3
The mitochondrial morphology in Magnaporthe oryzae wild‐type (WT), Modnm1Δ and Mofzo1Δ during the infection process. Invasive hyphal growth of Modnm1Δ or Mofzo1Δ was significantly slower than WT. hpi, h post‐inoculation. Scale bar = 10 μm.
Figure 4
Chemical inhibition of mitochondrial fission reduces invasive hyphal growth of Magnaporthe oryzae. (a) The mitochondria were predominantly tubular or filamentous upon Midvi‐1 treatment. Scale bar represents 2 μm. (b) The mitochondrial morphology of the Mito‐GFP strain with/without Midvi‐1 at 48 h post‐inoculation. Scale bar = 8 μm. (c) Detailed observation and statistical analysis of invasive growth in rice sheath cells at 40 hpi. The different types of invasive hyphae that were analysed/quantified are described in Fig. 2c.
Mitochondrial fusion and fission are required for proper pathogenesis of Magnaporthe oryzae. (a) The function of MoDNM1 and MoFZO1 in mitochondrial fission and fusion. Two‐day‐old liquid CM‐grown mycelia of the indicated strains were used for imaging with confocal microscopy. Most of the mitochondria in Modnm1Δ formed elongated or interconnected fishnet‐like structures, while the mitochondria were punctate or fragmented in Mofzo1Δ in vegetative mycelia. (b) The rice seedling (Oryza sativa cultivar CO39) infection assay of wild‐type (WT), Modnm1Δ, Modnm1Δ complementation strain (Modnm1Δ‐C), Mofzo1Δ and Mofzo1Δ complemented strain (Mofzo1Δ‐C). (c) Detailed observation and statistical analysis of invasive growth in rice sheath cells at 40 h post‐inoculation. Four types (illustrated in the right panel with corresponding colour labels: no penetration, penetration with primary hyphae, with differentiated secondary invasive hyphae, and invasive hyphae spreading into neighbouring cells) were quantified. Data represent mean ± SD of three independent experiments, with n = 200 appressoria per analysis. Scale bar represents 5 μm.The mitochondrial morphology in Magnaporthe oryzae wild‐type (WT), Modnm1Δ and Mofzo1Δ during the infection process. Invasive hyphal growth of Modnm1Δ or Mofzo1Δ was significantly slower than WT. hpi, h post‐inoculation. Scale bar = 10 μm.Chemical inhibition of mitochondrial fission reduces invasive hyphal growth of Magnaporthe oryzae. (a) The mitochondria were predominantly tubular or filamentous upon Midvi‐1 treatment. Scale bar represents 2 μm. (b) The mitochondrial morphology of the Mito‐GFP strain with/without Midvi‐1 at 48 h post‐inoculation. Scale bar = 8 μm. (c) Detailed observation and statistical analysis of invasive growth in rice sheath cells at 40 hpi. The different types of invasive hyphae that were analysed/quantified are described in Fig. 2c.In Saccharomyces cerevisiae, Fzo1 is the first known mediator of mitochondrial fusion (Fritz et al., 2001; Rapaport et al., 1998). Deletion mutant of the orthologous MoFZO1 harboured punctate mitochondria (Fig. 2a), thus indicating a mitochondrial fusion defect in this M. oryzae mutant. Similar to Modnm1∆, the Mofzo1∆ strain formed small and restricted blast lesions on rice plants (Fig. 2b). Further microscopic observations showed that more than 90% of appressoria penetrated successfully and about 80% infectious hyphae extended to neighbouring cells in the WT and the complemented strain at 40 dpi, while only 67.5% of appressoria penetrated successfully and 21.6% of invasive hyphae spread to surrounding cells in the Mofzo1∆ strain (Fig. 2c; P < 0.005). We further analysed the mitochondrial dynamics during invasive growth in M. oryzae. As shown in Fig. 3, the mitochondria in Mofzo1∆ were punctate at all the time points tested. These results indicate that mitochondrial fusion within the blast pathogen is required for proper invasive growth and lesion formation.Taken together, we conclude that the mitochondrial fission and fusion machineries are involved in invasive growth in M. oryzae, and that mitochondrial dynamics plays a crucial role during in planta growth and development in M. oryzae.
Mitochondrial fragmentation can be triggered by multiple environmental factors such as oxidative stress and carbon source depletion (Zemirli and Morel, 2018). During host invasion, the fungal pathogen generally encounters the plant defence response, oxidative stress and metabolic stress. We therefore hypothesized that such host response, oxidative and/or metabolic stress triggers the specific mitochondrial fragmentation during invasive growth in planta.To test whether the live host factors trigger such changes in mitochondrial fragmentation, we first examined the mitochondrial morphology in the blast fungus in live host tissue and compared it to that in heat‐killed rice sheath. The heat treatment was used to first kill the rice sheath cells before inoculating with the blast fungal strain of interest. Mitochondrial fragmentation was evident in invasive hyphae in heat‐killed rice sheath at 48 hpi. However, the percentage of filamentous mitochondria was significantly higher than the control samples at 48 hpi and did not show any difference at 72 hpi (Fig. 5). These results indicate that the mitochondrial fragmentation observed during M. oryzae invasive growth is dependent in part on the active defence response in addition to other factors in live host plants.
Figure 5
The mitochondrial morphology and dynamics in the Magnaporthe oryzae
Mito‐GFP strain in heat‐killed rice sheath. (a) Confocal microscopy images of the Mito‐GFP strain in dead rice sheath cells at 30, 48 and 72 h post‐inoculation (hpi). Scale bar = 12 μm. In the 3D image, red spots and green filaments highlight punctate and filamentous mitochondria, respectively. (b) Quantitative analysis of mitochondria of different morphologies in the Mito‐GFP strain in heat‐killed rice cells. Values represent the mean ± SD from three independent experiments. Sample size is more than 200 appressoria penetration sites per analysis. **P < 0.005 compared with wild‐type at indicated time point.
The mitochondrial morphology and dynamics in the Magnaporthe oryzaeMito‐GFP strain in heat‐killed rice sheath. (a) Confocal microscopy images of the Mito‐GFP strain in dead rice sheath cells at 30, 48 and 72 h post‐inoculation (hpi). Scale bar = 12 μm. In the 3D image, red spots and green filaments highlight punctate and filamentous mitochondria, respectively. (b) Quantitative analysis of mitochondria of different morphologies in the Mito‐GFP strain in heat‐killed rice cells. Values represent the mean ± SD from three independent experiments. Sample size is more than 200 appressoria penetration sites per analysis. **P < 0.005 compared with wild‐type at indicated time point.Oxidative stress could trigger the mitochondrial fragmentation in M. oryzae (Fig. S4). We further tested whether oxidative stress triggers the mitochondrial fragmentation during invasive growth by imaging the mitochondrial morphology at 30, 48 and 72 hpi in the presence of the exogenous antioxidant. The antioxidant treatment was initiated at 24 hpi. In the presence of 2.5 mM glutathione (GSH) as an exogenous antioxidant, around 81% mitochondria still became punctate or fragmented at 48 hpi (Fig. S5). At 72 hpi, filamentous or tubular mitochondria were apparent in GSH‐treated invasive hyphae. Likewise, N‐acetyl cysteine (NAC) treatment did not alter the mitochondrial fragmentation regime at 48 hpi (Fig. S5). Therefore, we inferred that reactive oxygen species/oxidative stress is unlikely to be the trigger for mitochondrial fragmentation during M. oryzae invasive growth.Next, we examined the role of carbon source depletion on mitochondrial fragmentation as exogenous carbon sources have been reported to alter metabolic stresses (Toyama et al., 2016). The carbon source, glucose or sucrose, was individually added into inoculated conidia droplets on the rice sheath surface at 24 hpi. Mitochondrial morphology was assessed using a confocal microscope at 30, 48 and 72 hpi. We found that excess glucose or sucrose significantly delayed the mitochondrial fragmentation (Figs 6 and 7), which indicates that carbon source depletion might be the major factor triggering mitochondrial fragmentation during in planta growth in M. oryzae. In the control experiments (no additional carbon source), around 84% mitochondria appeared fragmented at 48 hpi (Figs 6 and 7), whereas mitochondrial fragmentation occurred at 72 hpi in the presence of the indicated exogenous carbon source. At 72 hpi, 69% and 67% of mitochondria were punctate upon additional supply of glucose or sucrose, respectively (Figs 6 and 7), while more than 50% of mitochondria in the WT appeared filamentous again. Lastly, carbon starvation could also induce fragmentation of the mitochondrial network and led to an increase in punctate mitochondria in WT M. oryzae grown in liquid culture (Fig. S6). Based on these data, we conclude that the depletion of carbon source as well as the presence of excess sugar impacts mitochondrial dynamics (and/or function) in the invasive hyphae of M. oryzae. Since the aforementioned changes in carbon homeostasis delayed mitochondrial fragmentation to some extent, it is possible that downstream molecules in the carbon metabolic pathway(s) regulate mitochondrial dynamics during blast infection. Accordingly, the important carbon metabolic intermediate glucose‐6‐phosphate (G6P) was added to the inoculated conidial suspension at 24 hpi, and the mitochondrial morphology was assessed at 48 and 72 hpi. Nearly 85% and 64% of total mitochondria remained tubular or filamentous in the presence of G6P at 48 hpi (P < 0.001) and 72 hpi (Figs 6 and 7; P < 0.01). Taken together, these results indicate that carbon source depletion and the live host factors, but not oxidative stress per se, trigger mitochondrial fragmentation during the invasive growth phase in M. oryzae.
Figure 6
Carbon‐replete condition delays mitochondrial fragmentation in planta. Conidia of the Magnaporthe oryzae
Mito‐GFP strain were inoculated onto the rice sheaths. At 24 h post‐inoculation (hpi) the fluid in the conidial suspension was replaced with sterile H2O (control), 8 mg/mL sucrose, 50 mg/mL glucose or 1.5 mg/mL glucose‐6‐phosphate (G6P). Confocal microscopy was carried out at 30, 48 and 72 hpi. The right‐hand panels show an enlarged view of the boxed region in the left‐hand panel. Scale bar equals 5 μm.
Figure 7
Mitochondrial morphology with or without exogenous sucrose, glucose or glucose‐6‐phosphate (G6P). Values represent the mean ± SD from three independent experiments. ***P < 0.001; **P < 0.005; *P < 0.01 in comparison to control (H2O) at the same time points. Sample size is more than 200 appressoria penetration sites per analysis.
Carbon‐replete condition delays mitochondrial fragmentation in planta. Conidia of the Magnaporthe oryzaeMito‐GFP strain were inoculated onto the rice sheaths. At 24 h post‐inoculation (hpi) the fluid in the conidial suspension was replaced with sterile H2O (control), 8 mg/mL sucrose, 50 mg/mL glucose or 1.5 mg/mL glucose‐6‐phosphate (G6P). Confocal microscopy was carried out at 30, 48 and 72 hpi. The right‐hand panels show an enlarged view of the boxed region in the left‐hand panel. Scale bar equals 5 μm.Mitochondrial morphology with or without exogenous sucrose, glucose or glucose‐6‐phosphate (G6P). Values represent the mean ± SD from three independent experiments. ***P < 0.001; **P < 0.005; *P < 0.01 in comparison to control (H2O) at the same time points. Sample size is more than 200 appressoria penetration sites per analysis.
Mitophagy is necessary for blast infection
As shown in Figs 1, 3, 6 and 8d, the vacuolar localization of Mito‐GFP (mitochondrial marker) was observed at 48 and 72 hpi (Fig. S7), indicating that mitophagy is likely induced to degrade mitochondria during the initial stages of establishment of the blast disease. Our previous study showed that MoAtg24 is specifically required for mitophagy and is necessary for proper asexual differentiation (He et al., 2013). To determine whether mitophagy plays any role during infection, the pathogenicity of Moatg24Δ was tested using rice seedling infection assays. Compared to the WT, which caused the characteristic spindle‐shaped blast lesions with grey centres, the Moatg24Δ showed highly reduced pathogenicity in rice (Fig. 8a). Typical blast disease lesions were not elaborated in the susceptible rice cultivar inoculated with Moatg24Δ conidia, while only small lesions were occasionally evident (Fig. 8a).
Figure 8
MoAtg24‐mediated mitophagy is necessary for Magnaporthe oryzae infection. (a) Loss of MoATG24 gene leads to reduction in pathogenicity. Blast infection assays of wild‐type (WT), Moatg24Δ or Moatg24Δ complementation strain (Moatg24Δ‐C) were performed using rice seedlings (Oryza sativa cultivar CO39). Images were taken at 7 days post‐inoculation. (b) Developmental defects in the invasive hyphae of Moatg24Δ strain. The invasive hyphae in rice sheath cells were quantified as described in Fig. 2c. Data represents the mean ± SD from three independent experiments. More than 200 appressoria from each indicated strain were assessed each time. (c) Invasive hyphal growth in WT and Moatg24Δ strains at 30, 48 and 72 h post‐inoculation (hpi). Scale bar = 12 μm. (d) MoAtg24 is required for mitophagy during M. oryzae infection. WT or Moatg24Δ strain expressing Mito‐GFP was inoculated into rice sheaths for 60 h. The vacuoles in invasive hyphae were visualized by staining with CMAC. Scale bar = 2.5 μm.
MoAtg24‐mediated mitophagy is necessary for Magnaporthe oryzae infection. (a) Loss of MoATG24 gene leads to reduction in pathogenicity. Blast infection assays of wild‐type (WT), Moatg24Δ or Moatg24Δ complementation strain (Moatg24Δ‐C) were performed using rice seedlings (Oryza sativa cultivar CO39). Images were taken at 7 days post‐inoculation. (b) Developmental defects in the invasive hyphae of Moatg24Δ strain. The invasive hyphae in rice sheath cells were quantified as described in Fig. 2c. Data represents the mean ± SD from three independent experiments. More than 200 appressoria from each indicated strain were assessed each time. (c) Invasive hyphal growth in WT and Moatg24Δ strains at 30, 48 and 72 h post‐inoculation (hpi). Scale bar = 12 μm. (d) MoAtg24 is required for mitophagy during M. oryzae infection. WT or Moatg24Δ strain expressing Mito‐GFP was inoculated into rice sheaths for 60 h. The vacuoles in invasive hyphae were visualized by staining with CMAC. Scale bar = 2.5 μm.To understand the differences between infection by Moatg24Δ and WT conidia, invasive hyphae were observed under the microscope at 30, 48 and 72 hpi. At 40 hpi, nearly 90% of WT appressoria successfully penetrated the rice sheath. By contrast, less than 20% of Moatg24Δ appressoria were capable of invading the rice sheath (Fig. 8b; P < 0.001). At 48 hpi, although the penetration rates of appressoria in WT and Moatg24Δ were comparable, the secondary invasive hyphae were highly reduced in the Moatg24Δ (<2%) compared to WT (around 80%) (Fig. 8b; P < 0.001). At 72 hpi, the difference in invasive hyphae in Moatg24Δ and WT was more pronounced. The invasive hyphae of WT had successfully spread into five to seven rice cells, whereas the invasive hyphae of Moatg24Δ were mainly restricted to the first invaded cells in the rice epidermis (Fig. 8c). In rare cases, the invasive hyphae of Moatg24Δ could be found within the neighbouring cells surrounding the primary infected rice epidermal cell. Based on these results, we inferred that the highly reduced pathogenicity of Moatg24Δ is a result of lack of spread of invasive hyphae from the site of host entry/invasion.Since MoAtg24 is essential for mitophagy, and the Moatg24∆ showed highly reduced invasive growth in this study, it became important to assess and confirm whether MoAtg24‐based mitophagy occurs naturally during blast infection. Therefore, mitophagy was assessed using confocal microscopy in the secondary invasive hyphae, which formed in rare instances in the Moatg24Δ mutant. As shown in Fig. 8d, Mito‐GFP signal could be detected in vacuoles (CMAC, 7‐amino‐4‐chloromethylcoumarin, staining) at 60 hpi in invasive hyphae (Fig. 8d, upper panel). In contrast, such a Mito‐GFP signal did not colocalize with the vacuoles in the rare invasive hyphae in Moatg24Δ (Fig. 8d, lower panel), indicating that mitophagy is blocked during the infection‐related growth in the Moatg24Δ mutant. Considering that the Moatg24Δ mutant is defective in invasive growth and failed to form blast lesions, these results show that MoATG24‐mediated mitophagy plays a critical role in the infection process of M. oryzae.Taken together, our data support that mitochondrial dynamics and mitophagy are important intermediate events between nutrient sensing and homeostasis in M. oryzae leading to the establishment and extent of the devastating blast disease in rice.
Discussion
The adaptation of mitochondrial fusion and fission to cellular demands is critical for a number of important physiological processes (Zemirli and Morel, 2018). In M. oryzae, the complex composed of MoDnm1, MoFis1 and MoMdv1 regulates mitochondrial fission and plays important roles in pathogenesis (Khan et al., 2015; Zhong et al., 2016). In this study, the regulation and function of mitochondrial dynamics during M. oryzae growth and development in planta was determined. Mitochondrial dynamics were first observed during the early stages of the infection cycle of M. oryzae. Interestingly, we uncovered a unique filamentous‐punctate‐filamentous transition cycle in mitochondrial morphology during in planta growth. We demonstrated that the key regulators of mitochondrial fusion and fission are essential for proper mitochondrial dynamics and invasive growth in M. oryzae. These results suggest that mitochondrial fusion and fission are tightly controlled during blast infection and that such sequential change in organellar morphology is important for pathogenesis in M. oryzae.Mitochondrial fragmentation could be triggered by multiple environmental factors or stressors. The blast pathogen generally encounters host defence, oxidative stress and metabolic stress that may trigger such mitochondrial fragmentation. We propose that carbon source depletion is one of the important factors triggering mitochondrial fragmentation during in planta growth of M. oryzae. First, mitochondrial fragmentation was observed in the invasive hyphae in heat‐killed rice sheath, which is incapable of mounting the defence response. Second, exogenous antioxidants did not inhibit or delay such fragmentation processes during infection. Carbon sources (such as glucose or sucrose) or the important metabolic intermediate G6P delayed mitochondrial fragmentation, whereas prolonged nutrient starvation induced the breakdown of mitochondrial network in M. oryzae (Fig. S8). In addition, we found that NH4NO3 treatment did not change the mitochondrial morphology (Fig. S9), indicating that nitrogen starvation is likely not an important factor that leads to mitochondrial fragmentation during blast infection. Strigolactone is a plant hormone which is associated with mitochondrial biogenesis, fission, fusion, spore germination and hyphal branching in some fungal genera (Besserer et al., 2006). Strigolactone (GR24) treatment did not inhibit the mitochondrial fragmentation processes during Magnaporthe infection (Fig. S9).Magnaporthe oryzae initially acquires nutrients from living host cells, but switches to the necrotrophic killing phase to acquire nutrients from dead tissues between 48 and 72 hpi (Fig. S9c). During the transition to necrotrophy, the filamentous invasive hyphae of M. oryzae maintain viability as the fungal lifestyle changes and lesion development when host cell death is occurring (Fernandez and Orth, 2018; Jones et al., 2016; Kankanala et al., 2007). Magnaporthe oryzae thus needs to adapt to and overcome nutrient stress prior to switching to the necrotrophic phase. Our results show that glucose or sucrose supplementation promotes proliferation of invasive hyphae and decreases the cell death in rice during early infection of M. oryzae (Fig. S10). These results suggest that carbon source depletion occurs during infection and is likely a major factor which triggers the biotrophy–necrotrophy transition. However, carbon starvation and then carbon source acquisition from dead plant tissues may not be the only factors that trigger mitochondria fragmentation and rebuilding of the network, since addition of glucose every 6 h after 24 hpi simply delayed the fragmentation of mitochondria (Figs 6 and 7). It is possible that other signals cooperate with carbon homeostasis machinery to regulate and control the mitochondrial morphology/function during the blast infection in rice. In conclusion, our study suggests that carbon source depletion with other factor(s) trigger(s) mitochondrial fragmentation and biotrophic–necrotrophic phase switch during infection of M. oryzae.Our previous study showed that M. oryzae mitophagy requires MoAtg24 and is important for proper asexual differentiation (He et al., 2013). In this study, we found that mitophagy is induced along with precise mitochondrial fragmentation during invasive growth in M. oryzae. Furthermore, mitophagy plays a critical role in the invasive growth of M. oryzae in response to energy demands and nutrient homeostasis. It has been suggested that mitophagy requires efficient fission to separate out damaged or unwanted mitochondria to fit into the autophagosomes (Mao and Klionsky, 2013). Thus, it is possible that mitochondrial fragmentation together with ensuing mitophagy is the strategy employed by M. oryzae to separate and degrade the damaged/excess mitochondria in order to protect itself in the hostile environment in planta.In conclusion, our study revealed that a unique filamentous‐punctate‐filamentous cycle in mitochondrial morphology controlled by fission and fusion machinery is important for pathogenesis of M. oryzae. Such morphological transitions are likely coupled with nutrient homeostasis (particularly carbon source) and biotrophy‐to‐necrotrophy switch during M. oryzae infection. Lastly, mitophagy regulates the precise turnover of mitochondria and plays a critical role during the initiation of the devastating blast disease in rice.
Experimental Procedures
Fungal strains and culture media
The M. oryzae WT strain B157 (field isolate, mat1‐2) was a kind gift from the Indian Institute of Rice Research (Hyderabad, India). The M. oryzae strains Mito‐GFP, Moatg24Δ and Moatg24Δ‐C have been described in our previous reports (He et al., 2013; Patkar et al., 2012; Ramos‐Pamplona and Naqvi, 2006).Magnaporthe oryzae strains were grown on prune agar (yeast extract 1 g/L, lactose 2.5 g/L, sucrose 2.5 g/L, prune juice 40 mL/L, agar 20 g/L, pH 6.5) medium at 28 °C in the dark for 2 days, followed by growth under continuous light for 5 days to collect conidia for infection assay. Mutants generated by Agrobacterium tumefaciens‐mediated transformation (ATMT) were selected on either complete medium (CM: casein hydrolysate 6 g/L, sucrose 10 g/L, yeast extract 6 g/L, agar 20 g/L) containing hygromycin (250 μg/mL) or basal medium (BM: asparagine 2.0 g/L, yeastnitrogen base 1.6 g/L, NH4NO3 1.0 g/L, glucose 10 g/L, agar 20 g/L, pH 6.0) with chlorimuron‐ethyl (50 μg/mL) or with ammonium glufosinate (50 μg/mL).
Construction of Modnm1Δ and Mofzo1Δ strains, and complementation analyses
The MoDNM1 gene (MGG_06361) deletion mutant was generated using the standard one‐step gene replacement strategy. Briefly, about 1 kilobase (kb) of 5' UTR (untranslated region) and 3' UTR regions were PCR amplified and ligated sequentially to flank the ILV2 sulfonylurea‐resistance cassette in pFGL820 (Addgene, 58221) (Fig. S2a). The following primers were used to amplify the 5' and 3' UTR of the MoDNM1 gene: Dnm1‐5F (5ʹ‐GAGAGTGTT GAATTC CTCACGGGATGGGCTTCTG‐3ʹ) Dnm1‐5R (5ʹ‐GAGAGTGTT GGTACC GGCGAAAATCGGTTCCGTGGTC‐3ʹ), Dnm13‐F (5ʹ‐GAGAGTGTT GTCGAC TGAAGCTGTTTGCGCCATG‐3ʹ), and Dnm13‐R (5ʹ‐GAGAGTGTT GCATGC TACCTATGATCAGCCCGC‐3ʹ). Underlined sequences are restriction sites introduced for cloning purpose. The final plasmid construct was confirmed by sequencing and subsequently introduced into the Mito‐GFP strain by ATMT to replace the MoDNM1 gene (Yang and Naqvi, 2014). All the correct transformants in this study were ascertained by locus‐specific PCR and/or Southern blot analysis (Figs S2b, S3b). For complementation analysis, the full‐length genomic copy with promoter of MoDNM1 was amplified with MoDnm1‐F (5ʹ‐AATT GAATTC GTTGAGCAGGCCGAGCGAC‐3ʹ) and MoDnm1‐R (5ʹ‐AATT GAATTC CACTGGCATTTGATTACGCAAGG‐3ʹ) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.For generating the plasmid vector for MoFZO1 (MGG_05209) deletion, about 1 kb of 5' UTR and 3' UTR regions were PCR amplified and ligated sequentially to flank the phosphinothricin acetyl transferase gene cassette in pFGL822 (Fig. S3). The following primers were used to amplify the 5' and 3' UTR of the MoFzo1 gene: Fzo1‐5F (5ʹ‐GAGAGTGTT GAATTC ACTCGGCCGCGATACGCTGC‐3ʹ), Fzo1‐5r (5ʹ‐GAGAGTGTT GGATCC GTGATCGATTTCGTCCAGTC‐3ʹ), Fzo1‐3F (5ʹ‐GAGAGTGTT CTGCAG GCAGAACCATCCTCGTCGTC‐3ʹ), and Fzo1‐3r (5ʹ‐GAGAGTGTT AAGCTT CCTGGCGGCGGCGACATCAAC‐3ʹ). The final plasmid was introduced into the Mito‐GFP strain by ATMT to replace the MoFZO1 gene. The complementation fragment, which contains the full‐length genomic copy with promoter of MoFZO1 gene, was amplified with MoFzo1‐F (5ʹ‐AATT GGATCC GGCTGTCTGCGTGATCCCTG‐3ʹ) and MoFzo1‐R (5ʹ‐AATT TCTAGA GCTGTGGAGCGAGGAGCAGG‐3ʹ) and inserted into pFGL899 to complement the Mofzo1Δ strain (Yang and Naqvi, 2014).
Infection assays
For blast infection assay, conidial suspension (106/mL) with 0.01% gelatine was sprayed on 21‐day‐old rice seedlings (Oryza sativa cultivar CO39) and incubated in a growth chamber (16 h light/d, 22 °C and 90% humidity). Blast disease in infection assays was assessed and recorded by scanning the leaves at 7 dpi. The blast infection assays were repeated at least three times.For the host penetration and in planta invasive hyphal development assay, healthy rice seedlings (CO39) at the age of 4 weeks were selected for sheath preparation. Conidial suspension (5 × 104/mL) were inoculated onto rice sheath and incubated on sterile wet tissue paper in 90 mm Petri dishes. The Petri dishes with inoculated rice sheaths were transferred into the growth chamber with a photoperiod of 16 h:8 h light:dark cycle at 25 °C. The inoculated sheath was trimmed manually and observed by using an Olympus BX51 wide field microscope or with a laser scanning confocal microscope at selected time points.To prepare heat‐killed rice sheaths, the fresh rice sheaths were immersed into sterile water at 70 °C for 25 min (Shipman et al., 2017). The heat‐killed rice sheath has the physical structures of cells, while the abilities of host response to fungal infection are lost.
Carbon sources, antioxidant and Mdivi‐1 treatments
For treatments with excess carbon sources, the conidia from the tested strains were inoculated on to rice sheath and incubated in growth chamber. At 24 hpi, the water on the rice sheath was removed and the following solutions were applied to the sheath: 8 mg/mL sucrose, 50 mg/mL glucose, 1.5 mg/mL G6P (Sigma‐Aldrich, Switzerland), 2.5 mM GSH (L‐glutathione reduced, Sigma‐Aldrich, USA), 40 mM NAC (Sigma‐Aldrich, USA), or 10 µM Mdivi‐1 (Selleck, USA). The rice sheaths were incubated in the growth chamber until observation. These experiments were repeated thrice.
Vacuolar staining
The infected rice sheaths were incubated with CellTracker™ Blue CMAC Dye (7‐amino‐4‐chloromethylcoumarin, Molecular Probes, C2110) at a final working concentration of 10 μM for 2 h at 37 °C. The sample was washed with water prior to microscopic observation.
Live cell imaging and image processing
Live cell epifluorescence microscopy was performed with a Zeiss LSM 700 inverted confocal microscope (Carl Zeiss, Inc.) using a Plan‐Apochromat 63 (Numerical Aperture = 1.40) oil immersion lens. Enhanced GFP (EGFP) and CMAC excitation were performed at 488 nm (Em. 505–530 nm) and 405 nm (Em. 430–470 nm) respectively. For in planta invasive hyphal development observation, a z‐stack that consisted of 0.5 μm‐space sections was captured for each appressorium penetration site. Image processing was processed in Image J, which was downloaded from National Institutes of Health (http://rsb.info.nih.gov/). The maximum projection of z‐stack was obtained by Z projection with maximum intensity in Image J. Three‐dimensional reconstruction, visualization and analysis were performed in Bitplan Imaris with filament and spots program (Zurich, Switzerland). For figure preparation, the images were arranged in Illustrator CS6 (Adobe Systems Incorporated, USA).
Accession numbers
MoDnm1: XP_003717217.1; MoFzo1: XP_003712754.1; MoAtg24: XP_003716251.1Fig. S1 Mitochondrial morphology during appressorium formation in M. oryzae.Click here for additional data file.Fig. S2 Generation and verification of Modnm1Δ mutant.Click here for additional data file.Fig. S3 Generation and verification of Mofzo1Δ mutant.Click here for additional data file.Fig. S4 Oxidant treatment induces mitochondrial fragmentation.Click here for additional data file.Fig. S5 Antioxidant treatment does not delay mitochondrial dynamics during invasive growth.Click here for additional data file.Fig. S6 Carbon source depletion induces mitochondrial fragmentation in M. oryzae.Click here for additional data file.Fig. S7 The vacuolar localization of Mito‐GFP (mitochondrial marker) during invasive growth.Click here for additional data file.Fig. S8 Prolonged nutrient starvation induces mitochondrial fragmentation and mitophagy.Click here for additional data file.Fig. S9 NH4NO3 or strigolactone treatment did not change the mitochondrial fragmentation during infection by M. oryzae.Click here for additional data file.Fig. S10 Addition of glucose or sucrose promotes spread of invasive hyphae and decreases the cell death in rice during early infection by M. oryzae.Click here for additional data file.
Authors: C Delettre; G Lenaers; J M Griffoin; N Gigarel; C Lorenzo; P Belenguer; L Pelloquin; J Grosgeorge; C Turc-Carel; E Perret; C Astarie-Dequeker; L Lasquellec; B Arnaud; B Ducommun; J Kaplan; C P Hamel Journal: Nat Genet Date: 2000-10 Impact factor: 38.330
Authors: S Frank; B Gaume; E S Bergmann-Leitner; W W Leitner; E G Robert; F Catez; C L Smith; R J Youle Journal: Dev Cell Date: 2001-10 Impact factor: 12.270
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Michael L Kamradt; Ji-Ung Jung; Kathryn M Pflug; Dong W Lee; Victor Fanniel; Raquel Sitcheran Journal: Cell Death Dis Date: 2021-03-15 Impact factor: 8.469