Juan Ji1,2, Juan Wang1,2, Jin Yang1,2, Xi-Peng Wang1,2, Jing-Jing Huang1,2, Teng-Fei Xue1,2, Xiu-Lan Sun1,2,3. 1. Department of Pharmacology, Neuroprotective Drug Discovery Key Laboratory of Nanjing Medical University, Nanjing, China. 2. Jiangsu Key Laboratory of Neurodegeneration, Department of Pharmacology, Nanjing Medical University, Nanjing, China. 3. Center for Global Health, Nanjing Medical University, Nanjing, China.
Abstract
Sphingosine 1-phosphate (S1P) is involved in a variety of cellular responses including microglial activation and polarization. However, the impacts of S1P on ischemia-induced microglial activation and polarization remain unclear. In the present study, Sprague-Dawley rats were selected for middle cerebral artery occlusion (MCAO) establishment and treated with S1P analog FTY720 (0.5, 1, 2 mg/kg) for 24 h. The impacts of FTY720 on oxygen-glucose deprivation (OGD)-induced microglial polarization were examined in the primary cultured microglia. FTY720 treatment could prevent ischemia-induced brain injury and neurological dysfunction, also decrease the levels of IL-1β and TNF-α and promote M2 microglial polarization in rats. Further, we found that FTY720 inhibited the expressions of M1 markers, but increased the expressions of M2 markers in the OGD-insulted microglia. And FTY720 could enhance the phagocytic function of microglia. The sphingosine kinase 1/2 (SphK1/2) or the Sphk2 inhibitor could prevent the M1 to M2 phenotype shift improved by FTY720, but the Sphk1 inhibitor failed to affect the roles of FTY720. Furthermore, the Sphk1/2 or Sphk2 inhibitor promoted the activities of histone deacetylase (HDAC1) and inhibited the histone acetylation of the Krüppel-like factor 4 (KLF4) promoter regions, indicating that intra-nuclear pFTY720 inhibited HDAC1 activations and prevented KLF4 to interact with HDAC1, and thereby suppresses KLF4 deacetylation. Therefore, our data reveals that intra-nuclear SphK2-S1P axis might facilitate the transformation of microglial polarization from M1 to M2 phenotype, which might be intra-nuclear regulatory mechanisms of FTY720-prevented neuroinflammation.
Sphingosine 1-phosphate (S1P) is involved in a variety of cellular responses including microglial activation and polarization. However, the impacts of S1P on ischemia-induced microglial activation and polarization remain unclear. In the present study, Sprague-Dawley rats were selected for middle cerebral artery occlusion (MCAO) establishment and treated with S1P analog FTY720 (0.5, 1, 2 mg/kg) for 24 h. The impacts of FTY720 on oxygen-glucose deprivation (OGD)-induced microglial polarization were examined in the primary cultured microglia. FTY720 treatment could prevent ischemia-induced brain injury and neurological dysfunction, also decrease the levels of IL-1β and TNF-α and promote M2 microglial polarization in rats. Further, we found that FTY720 inhibited the expressions of M1 markers, but increased the expressions of M2 markers in the OGD-insulted microglia. And FTY720 could enhance the phagocytic function of microglia. The sphingosine kinase 1/2 (SphK1/2) or the Sphk2 inhibitor could prevent the M1 to M2 phenotype shift improved by FTY720, but the Sphk1 inhibitor failed to affect the roles of FTY720. Furthermore, the Sphk1/2 or Sphk2 inhibitor promoted the activities of histone deacetylase (HDAC1) and inhibited the histone acetylation of the Krüppel-like factor 4 (KLF4) promoter regions, indicating that intra-nuclear pFTY720 inhibited HDAC1 activations and prevented KLF4 to interact with HDAC1, and thereby suppresses KLF4 deacetylation. Therefore, our data reveals that intra-nuclear SphK2-S1P axis might facilitate the transformation of microglial polarization from M1 to M2 phenotype, which might be intra-nuclear regulatory mechanisms of FTY720-prevented neuroinflammation.
Ischemia stroke is recognized as a leading cause of morbidity, mortality, and disability among adults around the world (1), which occurs as a result of interrupted blood supply to the brain parenchyma. However, the clinical available therapeutic options for the ischemia stroke remain restricted, and the mechanism underlying pathophysiology of the ischemia stroke remains unknown. It is now appreciated that ischemic stroke rapidly activates the immune inflammatory response in the brain (2, 3), which subsequently aggravates the ischemic cascade mediated neuronal cell death and ischemia/reperfusion (I/R) injury. Therefore, neuroinflammation plays an important role in the complicated pathologies that lead to ischemic brain damage and the subsequent I/R injury. And, recent researches indicate that anti-inflammation is an important therapeutic strategy for stroke.It is well-known that microglia is the prime resident innate-immune cell, which is rapidly activated and causes secondary injury by releasing inflammatory cytokines when cerebral ischemia occurred (4, 5). However, alternatively activated microglia can protect neighboring cells and promote tissue repair by removing cell debris and releasing anti-inflammatory cytokines and neurotrophic factors, which is called M2 microglial cells (6, 7). Increasing evidence has indicated that the inhibition of microglial over-activation and inflammatory responses can efficiently decrease brain injury and ameliorate neurological outcome. Therefore, microglial polarization depends on the activation status, and maintaining the balance of microglial polarization is a foreground therapeutic option for stroke treatment (5, 8–12).Sphingosine 1-phosphate (S1P) can be considered as a pleiotropic sphingolipid molecule that is involved in a variety of cellular responses, including proliferation, migration, differentiation, and adhesion. Sphingosine kinase 1 (SphK1) and Sphingosine kinase 2 (SphK2), as well-known the rate-limiting enzymes of S1P formation, are the key regulators of the sphingolipid signaling pathway (13, 14). Intracytoplasmic S1P is generated by SphK1 and transferred to the plasma membrane, which acts on five specific S1P receptors (S1PRs) on the membrane. This process called S1P “inside-out signaling,” regulates many processes that are important for immunity and inflammation, has received the widespread attention and the research. In contrast to SphK1, the subcellular localization of SphK2 presents much more complex. When present in the nuclei, SphK2 directs binding of S1P to nuclear histone deacetylase 1 (HDAC1) and/or HDAC2 to inhibit DNA synthesis. In the mitochondria, SphK2 cooperates with Bak and Bax to promote apoptosis (13, 14). However, the involved mechanisms remain unclear. Lots of clinical and basic studies have proved that a S1P analog FTY720 might be a potential therapeutic drug targeting neuroinflammation for several brain diseases including stroke (15–17). FTY720 also requires SphKs to be phosphorylated to its active form (pFTY720). It has been revealed that the neuroprotective effects of FTY720 was preserved in SphK1−/− but lost in SphK2−/− mice (18), indicated that SphK2-medicated phosphorylation is required for FTY720.Krüppel-like factor 4 (KLF4) is a zinc finger transcription factor expressed in a wide variety of tissues. KLF4 is important for many different physiological processes, including cell development, stem cell self-renewal, and maintenance of normal tissue homeostasis (19). Recently, KLF4 has been identified directly bind to promoter region of Agr1, then accelerate its transcription and microglial M2 polarization. Moreover, Huang et al. found that the expression level of HDAC1 was negatively correlated with Klf4 expression and that patients with lower HDAC1 levels showed a better prognosis (20). Therefore, our results revealed that intra-nuclear SphK2 promoted FTY720 phosphorylation to form pFTY720, and subsequently facilitated the transformation of microglial polarization from M1 to M2 phenotype, by inhibiting KLF4 to interact with HDAC1 and suppressing KLF4 deacetylation.
Materials and Methods
Animal Model and Experimental Protocol
All animal experiments were conducted in conformity to the provision and the protocol was provided by the Institutional Animal Care and Use Committee (IACUC) of Jiangsu province association of experimental animals. Adult male Sprague-Dawley rats (220–250 g) were supplied by the laboratory animal center of Nanjing Medical University. Rats were housed 3–4 per cage and kept in pathogen-free conditions with ad libitum access to water and food. The environmental enrichment remained unchanged after surgical procedure and treatment. All rats were randomly allocated to the each experimental group and performed in double-blinded manner. In the process of MCAO model, the silicon sutures was used to block the origin of the left middle cerebral artery, and was withdrawn after 90 min of transient ischemia, which was called reperfusion (8). Throughout surgery, the animal body temperature was maintained at 37 ± 0.5°C with a thermostatically controlled heating pad. For the sham-operated animals, the left common carotid artery was isolated and the external carotid artery was permanently ligated. FTY720 [0.5, 1, and 2 mg/kg body weight dissolved in 0.9% normal saline (NS)] was applied immediately at 1 h after ischemia/reperfusion by an intraperitoneal injection. The corresponding volume of 0.9% NS was injected intraperitonelly in control animals. At the end of a 24 h treatment period, the neurological scoring method was used to evaluate the extent of ischemic damage in all animals. Finally, brain tissues were collected after anesthesia to await further procedure.
Neurobehavioral Testing
The neurological deficits of experimental animals were assessed by a 28-point focal scoring system for neurological severity score (NSS), which was proposed by Clark et al. (21). Neurological function was graded as 0–4 by which gait, body symmetry, climbing, turning behavior, front leg extension, compulsory circling, and sensory response were evaluated (22). Grading criteria were as follows (23): grade 0, no observable neurological deficits; grade 1, mild circling movements when picked up by a mouse tail and attempts to rotate to the contralateral side; grade 2, consistent strong and immediate circling or an animal only turned to the surgery contralateral side while the animal was suspended by holding the tail; grade 3, severe rotation progressing into loss of walking or righting reflex; grade 4, an animal did not walk spontaneously and had some degree of consciousness.
Infarct Volume Assessment
After the neuroscore assessment, the rats were euthanized and the brain tissues were extracted out and removed to a refrigerator for 10 min. Then, the tissues were coronally sectioned into 2 mm thick slices. The brain slices were immersed in 2% solution of 2,3,5-triphenyltetrazolium chloride (TTC) at 37°C for 30 min and were fixed in 4% solution of paraformaldehyde. The unstained area of the fixed brain sections were defined as the infarction areas, and the sections around the infarction were defined as the penumbra areas. The infarction volume was digitalized and analyzed by using image tool 3.0 (8–10 animals were analyzed in each group). The infarct ratio (%) = infarct volume (mm3)/total coronal section (mm3) × 100%.
Primary Microglial Cells Culture
Primary microglial cell were isolated from postnatal 1- to 3-day-old SD rats, which were obtained from the laboratory animal center of Nanjing Medical University, following as previously described. The brains were extracted out and removed the meninges. The cerebral cortices tissues were minced by scissors and digested in PBS containing 0.25% trypsin/EDTA (Gibco, Grand Island, NY, USA) and 30 U/ml DNase (Sigma Chemical, St. Louis, MO, USA) at 37°C for 20 min. Next, the digestion was stopped by 10% FBS-DMEM and the lysates were filtered through a 40 μm nylon mesh and centrifuged at 1,500 rpm for 5 min. The resuspended single cells suspension were seeded into poly-D-lysine-coated culture flasks, and cultured in 10% FBS-DMEM (Gibco, Grand Island, NY, USA) at 37°C in a humidified 5% CO2-95% air atmosphere. On day 10 of primary mixed glial cells culture, microglial cells were collected and then plated in culture vessels. To quantify the microglial purity, iba1 and hochest double-positive cells were over 97% before the experiments.
Primary Microglial Cells Treatment
The experimental groups were divided as follows: (1) control; (2) FTY720; (3) OGD; (4) OGD+FTY720 (0.01 μM, Sigma-Aldrich); (5) OGD+FTY720+ SKI II (0.1 μM, Selleck Chemica); (6) OGD+FTY720+ABC294640 (0.1 μM, Selleck Chemica); (7) OGD+FTY720+PF-543 (0.1 μM, Selleck Chemica). The primary microglial cells were detached from the other glia by shaking and plated in six-well plates at a density of 25 × 105 cells/ml. The culture medium was removed and the cells were added with serum- and glucose- free DMEM medium and were placed into oxygen-deficient air for 3 h. Following OGD, the OGD medium was replaced by normal medium with 0.01 μM non-phosphorylated FTY720 (Sigma-Aldrich) or vehicle persisted to reoxygenation 24 h. To investigate where FTY720-facilitated the microglial polarization, the SphKs inhibitors SKI II (0.1 μM, Selleck Chemica), ABC294640 (0.1 μM, Selleck Chemica) and PF-543 (0.1 μM, Selleck Chemica) were co-incubated with 0.01 μM FTY720 for 24 h after 3 h OGD, respectively.
Oxygen-Glucose Deprivation and Reoxygenation Model
A hypoxia chamber was used to perform the procedure of OGD as previously described. Before the experiment, microglial cells were washed twice by PBS and immersed in serum- and glucose- free DMEM medium (Gibco, Grand Island, NY, USA). Then, they were placed in the hypoxia chamber (Thermo scientific, Waltham, MA, USA) with a premixed gas (1% O2, 94% N2, 5% CO2) at 37°C for 3 h. After OGD, the cells were perfused by 10% FBS-DMEM medium and transferred to a 5% CO2-95% air incubator for 24 h. Control cells were incubated under normal conditions throughout the procedure.
Western Blotting
Cells were lysed by using RIPA lysis buffer containing mixed protease inhibitors on ice for 10 min. The cell lysates were collected by using cell scraperon ice and were centrifuged at 12,000 rpm for 15 min at 4°C. The protein concentrations were detected by using the enhanced BCA Protein Assay kit (Beyotime Biotechnology, Shanghai, China), and the extracted protein solution was denaturalized with 5 × loading buffer at 100°C. Total proteins (20–30 μg) were separated by electrophoresis on 8–12% SDS-PAGE gel and transferred to polyvinylidene fluoride (PVDF) membranes (Roche, Mannheim, Germany). Then, the membranes were blocked with 5% skimmilk at room temperature for 2 h and probed with the primary antibodies at 4°C overnight. After recycling the primary antibody, the membranes were washed four times in TBST for 10 min each time. IgG (H+L) secondary antibody or HRP secondary antibodies were used to incubate the membranes for 1 h at room temperature. Finally, the protein bands were exposured by an ECL method. The relative proteins levels were analyzed by Image J software.
Enzyme-Linked Immuno Sorbent Assay
After 24 h treatment, the nuclear protein and the cytoplasmic protein were extracted out from microglia, respectively. Quantifications of S1P and the HDAC1 in the nuclear protein and cytoplasmic protein were performed using specific enzyme-linked immune sorbent assays (ELISAs) (R&D Systems, UK) according to manufacturers' guidelines.
Tissue Processing and Immunohistochemistry
The rats were perfused transcardially with PBS and 4% paraformaldehyde solution. The brain of each rat was carefully removed and fixed in 4% paraformaldehyde solution for 2 h, and dehydrated in 20–30% sucrose. The cryo-tissues were sliced at 16 μm per section; 6 sections were collected on a slide, 6 slides were prepared from a single rat brain, 8–10 animals in each group. The 16 μm thickness were blocked in PBS containing 10% goat serum for 1 h at room temperature and incubated a series of primary antibodies overnight. The following antibodies were used: anti-Iba1Rabbit Polyclonal Antibody (1:500, #019-19741, Wako Chemicals GmbH) (23), anti-iNOSMouse monoclonal antibody (1:200, #sc-7271, Santa Cruz Biotechnology Inc.,) (24, 25), anti-TREM2Goat monoclonal antibody (1:500, ab95470, abcam) (24, 26). Then, the alexa Fluor-conjugated secondary antibodies were used to incubate the samples for 1 h at room temperature, including goat anti rabbit IgG ALEXA flour 488 and donkey anti goat IgG ALEXA flour 555 (1:1,000, #a11008, #a21432, Invitrogen), and donkey anti mouse IgM ALEXA flour 594 (1:1,000, #715-585-020, jacksonslab). After three more washed, stained nuclei were stained with Hoechst 33,342 for 20 min. Quantification of immunohistochemistry results was performed blindly by two experimenters as described in reference (9). Images were captured from each section contained three pre-assigned fields that were the penumbra field of the ischemic cortex under confocal microscopy (Nikon A1RSi, Tokyo, Japan). The data are expressed as the number of double positive cells per unit area of analyzed zones.
Immunofluorescent Staining
Primary microglial cells were placed in in 24-well plate at the density of 20 × 104 cells/well. After treatment with OGD and FTY720 incubation period, the cells were fixed in 4% paraformaldehyde solution at room temperature for 30 min and were blocked in 3% BSA containing 0.1% Triton X-100 for 1 h at room temperature. Then, the primary antibodies were used to incubate the samples overnight at 4°C in a humid chamber, and the Alexa Fluor secondary antibody were used to incubate the samples for 1 h at room temperature. The following antibodies were used: anti-CD86Rabbit Polyclonal Antibody (1:100, #BS9900M, Bioworld), anti-CD206 Rabbit Polyclonal Antibody (1:500, #ab64693, abcam), anti-iNOSMouse monoclonal antibody (1:200, #sc-7271, Santa Cruz Biotechnology Inc.,), anti-TREM2Goat monoclonal antibody (1:500, #ab95470, abcam), goat anti mouse IgG ALEXA flour 488, donkey anti rabbit IgG ALEXA flour 546, donkey anti rabbit IgG ALEXA flour 488, and donkey anti goat IgG ALEXA flour 555 (1:1,000, #a11001, #a10040, #a21206, and #a21432, Invitrogen). After three more washed, stained nuclei were stained with Hoechst 33,342 for 20 min. Images were taken using a confocal microscope (Nikon A1RSi, Tokyo, Japan) and analyzed using Software ImageJ.
Reverse Transcription and Real-Time Quantitative PCR
Total RNA was isolated from treated-microglial cells by using Trizol reagent (Invitrogen Life Technologies, California, USA). The quality and quantity of total RNA were measured by NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Thermo Scientific, USA). According to the manufacturer's instructions, 1 μg total RNA was reverse-transcribed and synthesized the complementary DNA by using PrimeScriptTM RT Master Mix (TaKaRa, Japan). Real-time qPCR was carried out using SYBR® Premix Ex Taq I (TaKaRa, Japan) following the instructions of reagent kit on a Quant Studio 5 Real-Time PCR System (Applied Biosystems, USA). The primer sequences of target genes were shown in Table 1. GAPDH was regarded as the internal standard to normalize other target genes, and the 2(–ΔΔct) method was used to analyzed the relative expression of the target genes. Each sample was run in triplicate, and each experiment was repeated at least thrice.
Table 1
Primer sequences of target using qPCR.
Target gene
Forward primer sequence (5′-3′)
Reverse primer sequence (5′-3′)
CD86
TAGGGATAACCAGGCTCTAC
CGTGGGTGTCTTTTGCTGTA
COX-2
GCAAATCCTTGCTGTTCCAACC
GGAGAAGGCTTCCCAGCTTTTG
iNOS
GCAGAATGTGACCATCATGG
ACAACCTTGGTGTTGAAGGC
IL-1β
TGATGTTCCCATTAGACAGC
GAGGTGCTGATGTACCAGTT
TNF-α
GTAGCCCACGTCGTAGCAAA
CCCTTCTCCAGCTGGGAGAC
IFN-γ
GAGGTGAACAACCCACAGA
TATTGGCACACTCTCTACCC
IL-6
TCTTGGGAC-TGATGCTGGTG
CAGAATTGCCATTGCACAACTC
TGF-β1
TGAGTGGCTGTCTTTTGACG
GGTTCATGTCATGGATGGTG
TGF-β2
CTCCACATATGCCAGTGGTG
CTAAAGCAATAGGCGGCATC
TGF-β3
CCCAACCCCAGCTCCAAGCG
AGCCACTCGCGCACAGTGTC
IGF-1
CAGTTCGTGTGTGGACCAAG
GTCTTGGGCATGTCAGTGTG
CCL2
TTCACTGGCAAGATGATCCC
TGCTTGAGGTGGTTGTGGAA
CCR2
ATGCTGTCCACATCTCGTTCTCG
TTATAAACCAGCCGAGACTTCCTGC
G-CSF
CCATTGTCCATCTTGGGGATC
CCTGGAAGCTGTTGTTCCATG
GM-CSF
TACCACACCCAGCATTCCTCC
GACCCCTCGCCCAGGTACAGT
GAPDH
GTTTGTGATGGGTGTGAACC
TCTTCTGAGTGGCAGTGATG
Primer sequences of target using qPCR.
Flow Cytometry
The microglial cells were collected and washed twice with PBS. The single cell suspensions were blocked by 0.1% Triton X-100 and 3% BSA in PBS, and then stained with CD86-FITC (rat) and CD206-PE (rat) antibodies (BD Biosciences, La Jolla, CA, USA) by the manufacturer's protocols, respectively. The microglial cells were examined with a BD FACSVerse flow cytometer (BD Biosciences), and all of the tests were controlled by the homologous isotype control antibodies.
Phagocytosis
Primary microglial cells were seed at 1 × 105 cells in a poly-(L-lysine)-coated confocal plate and incubated overnight, then processed according to the pHrodo™ Red zymosan bioparticle procedure of Invitrogen (Carlsbad, CA, USA). The microglial cells were incubated in 1 μM Cell Tracker™ Green/PBS solution for 20 min at 37°C and were washed twice with PBS, which as described previously (24). After two washes with PBS, the opti-MEM medium containing 10 μL/mL of pHrodo Red zymosan bioparticles were incubated the cells, which were treated with or without OGD (for 3 h) and/or FTY720 (0.01 μM) and/or the SphKs inhibitors (0.1 μM) for 15 min. The phagocytosis rate was examined every 30 min by confocal microscopy (Nikon A1RSi, Tokyo, Japan).
Chromatin Immunoprecipitation Analysis
Primary microglial cells were treated with OGD and FTY720, and Chromatin immunoprecipitation (ChIP) assay was performed to evaluate the acetylation levels of histone H3 and H4 binding to the Sp1 in the ratKlf4 promoter region as described previously. Briefly, cells were cross-linked in 37% formaldehyde for 10 min and the reaction was stopped by adding a final concentration of 0.125 mM of glycine and incubated for 5 min. After homogenizing the sample in cell lysis buffer the nucleus phase was pelleted and then suspended in nucleus lysis buffer. Samples were then sheared by sonication (Bioruptor UCD-300, Diagenode) and the chromatin concentration and chromatin fragments were checked using Nanodrop and 2% agarose gel. Then, samples were immunoprecipitated using histone H3- and H4-antibody linked to protein A beads (Santa Cruz) and the DNA purified with Phenol/chloroform extraction. The relative abundance of the histone H3- and H4-antibody precipitated chromatin containing the Sp1 binding site in the ratKlf4 promoter region was detected by qPCR. Site of KLF4 promoter located between −859 and −868 from the transcription starting site (Figure 5B), and the following primer set for promoter quantification: Sense: CGTGTGACCTTGCGATAG, Antisense: CTCTATGAGTGCGTAGGATG.
Figure 5
The intra-nuclear SphK2-S1P axis inhibits the HDAC1 expression and deacetylation of KLF4 promoter regions in intra-nuclear. (A) The expression of HDAC1 was analyzed by ELISA. n ≥ 4 per group, ***p < 0.001, compared to the Con group; ###p < 0.001, compared to the OGD group; †††p < 0.001, compared to the OGD+FTY720 group. (B) Site of KLF4 promoter located between −859 and −868 from the transcription starting site. (C,G) ChIP-qPCR assay was used to detect the acetylation levels of histone H3 and H4 at the KLF4 promoter regions. n ≥ 4 per group, **p < 0.01, ***p < 0.001, compared to the Con group; ##p < 0.01, ###p < 0.001, compared to the OGD group; †p < 0.05, ††p < 0.01, †††p < 0.001, compared to the OGD+FTY720 group, by one-way ANOVA and Tukey's test. (D) Labeled (FAM) with green to primary microglia was used to observe the efficiency of transfection. Scale bar = 100 μm. Quantitation of western blot data showing siRNA-FAM transfection efficiency. Statistical analysis was performed using One-way ANOVA followed by Bonferroni's post-hoc test. Data are presented as means ± SEMs, n = 3, **p < 0.01, ***p < 0.001, compared with 100 μM group. Quantitation of western blot data showed the declines in KLF4 (E) and in HDAC1 (F). Statistical analysis was performed using One-way ANOVA followed by Bonferroni's post-hoc test. Data are presented as means ± SEMs, n = 4, *p < 0.05, ***p < 0.001, compared with Con group.
Primary Microglial Cells Was Transfected With siRNA
Primary microglia was seed at the density of 120 × 104 cells per well in 6 well-plates and transfected with siRNAs (100, 200, and 500 nM) targeting KLF4 and HDAC1 using Lipofectamine® Messenger MAX mRNA Transfection Reagent (Invitroogen, New York, USA) according to the manufacturer's instructions (sequences listed in Table 2). More than 75% knockdown of the targeted proteins was observed after 500 nm siRNA treatment. Scramble siRNA and target gene-specific siRNAs were purchased from GenenPharma (Shanghai, China).
Table 2
Primer sequences of siRNAs.
Target gene
Forward primer sequence (5′-3′)
Reverse primer sequence (5′-3′)
FAM
UUCUCCGAACGUGUGCACGUTT
ACGUGACACGUUCGGAGAATT
KLF4-311
GCAGCUUGCAGCAGUAACATT
UGUUACUGCUGCAAGCUGCTT
KLF4-796
CCCUUCGGUCAUCAGUGUUTT
AACACUGAUGACCGAAGGGTT
KLF4-1266
CCACCCACACUUGUGACUATT
UAGUCACAAGUGUGGGUGGTT
HDAC1-226
GACGACUACAUCAAGUUCUTT
AGAACUUGAUGUAGUCGUCTT
HDAC1-600
CUGUGUCCUUUCAUAAAUATT
UAUUUAUGAAAGGACACAGTT
HDAC1-848
CCAUCAAAGGACAUGCCAATT
UUGGCAUGUCCUUUGAUGGTT
Primer sequences of siRNAs.
Statistical Analysis
All experiments were independently repeated in triplicate at least, and all measurement data were presented as the mean ± SEM. GraphPad Prism 6.0 software was applied to analyze statistical significance. Statistical analysis was carried out using Two-way ANOVA with post-hoc Bonferroni's multiple comparisons test and one-way ANOVA with post-hoc Tukey's multiple comparisons test. Differences were regarded statistically significant when value of P < 0.05.
Results
FTY720 Treatment Prevents MCAO-Induced Brain Injury and Neurological Dysfunction in Rats
To evaluate the effect of FTY720 (Figure 1A shows the schematic structure of FTY720) in stroke-induced brain injury, the neurological deficit score and the infarct volume were analyzed at 24 h after ischemic/reperfusion. The detailed experimental protocol is shown in Figure 1B. NSS, proposed by Clark et al. (21) was performed to evaluate motor at 24 h after ischemia/reperfusion with and without FTY720 treatment. The neurological grading scores of the MCAO group were decreased after FTY720 treatment at the dosages of 2 mg/kg, but were not affected by 0.5 and 1 mg/kg FTY720 treatment (Figure 1C). Moreover, infarct volume was detected by Triphenyl tetrazolium chloride (TTC) stain at 24 h after ischemia/reperfusion with FTY720 treatment at the dosages of 0.5, 1, and 2 mg/kg. Strikingly, rats treated with 2 mg/kg FTY720 showed a significant reduction in cerebral infarct volume by ≈40% compared with MCAO group (Figures 1D,E). Collectively, these data indicate that the outcome of ischemic stroke could be improved by 2 mg/kg FTY720 treatment. The dosage of 2 mg/kg was used in all subsequent experiments.
Figure 1
FTY720 treatment prevents MCAO-induced brain injury and neurological dysfunction in rats. (A) The chemical structure of FTY720. (B) Experimental procedure for in vivo experiments. Stroke was induced in rats with transient occlusion of the MCAO. FTY720 was intraperitoneally injected at 0.5, 1, and 2 mg/kg/day after ischemia/reperfusion. One day after ischemia/reperfusion, the all experiments were carried out. (C) Quantification of neurological function scores at 1 day after focal ischemia. FTY720 treatment improved neurological functions. n ≥ 8 per group. *p < 0.05, compared to the MCAO group, by one-way ANOVA and Tukey's test. (D) FTY720 (2 mg/kg) treatment significantly reduced infarct volume. Representative brain slices with infarcts stained by triphenyl tetrazolium chloride from each group at 1 day after MCAO. (E) Quantification of infarct volume at 1 day in MCAO rats with or without FTY720. n ≥ 8 per group. **p < 0.01, compared to the MCAO group, by one-way ANOVA and Tukey's test. All data are presented as means ± SEM.
FTY720 treatment prevents MCAO-induced brain injury and neurological dysfunction in rats. (A) The chemical structure of FTY720. (B) Experimental procedure for in vivo experiments. Stroke was induced in rats with transient occlusion of the MCAO. FTY720 was intraperitoneally injected at 0.5, 1, and 2 mg/kg/day after ischemia/reperfusion. One day after ischemia/reperfusion, the all experiments were carried out. (C) Quantification of neurological function scores at 1 day after focal ischemia. FTY720 treatment improved neurological functions. n ≥ 8 per group. *p < 0.05, compared to the MCAO group, by one-way ANOVA and Tukey's test. (D) FTY720 (2 mg/kg) treatment significantly reduced infarct volume. Representative brain slices with infarcts stained by triphenyl tetrazolium chloride from each group at 1 day after MCAO. (E) Quantification of infarct volume at 1 day in MCAOrats with or without FTY720. n ≥ 8 per group. **p < 0.01, compared to the MCAO group, by one-way ANOVA and Tukey's test. All data are presented as means ± SEM.
FTY720 Treatment Reduces the Levels of Pro-inflammatory Factor in the Serum and Promotes M2 Microglial Polarization in the Brain of Rats
The ELISA results revealed that the inflammatory cytokines IL-1β and TNF-α levels were significantly higher in treated with MCAO than in sham group. FTY720 treatment significantly suppressed MCAO-induced the up-regulations of serum IL-1β and TNF-α (Figures 2A,B). To confirm whether FTY720 affected microglial polarization, brain sections were double-stained for Iba-1 (microglia marker)/iNOS (M1 marker) or Iba-1/TREM2 (M2 marker) after ischemia. FTY720 treatment significantly decreased the numbers of Iba1+/iNOS+ M1 microglia in the ischemic penumbra of cerebral cortex (Figures 2C,E) and significantly increased the number of Iba1+/TREM2+ M2 microglia in the cortex (Figures 2D,F). Consistently, western blot analysis showed that FTY720 prevented MCAO-induced the increase of Iba1, iNOS, and NLRP3 and the reduction of TREM2 (Figures 2G–J). These results show that FTY720 treatment could inhibit the peripheral and central inflammation levels, and markedly promote M2 microglial polarization in cortex after ischemia.
Figure 2
FTY720 treatment reduces the levels of pro-inflammatory factor in the serum and promotes M2 microglial polarization. FTY720 prevented MCAO-induced increases of L-1β and TNF-α in serum levels (A,B). n ≥ 8 per group,**p < 0.01, compared to the sham group; #p < 0.05, ##p < 0.01, compared to the MCAO group, by one-way ANOVA and Tukey's test. (C) Immunofluorescent staining with of Iba1 (green), iNOS (red), and nuclei (blue) in the sham, MCAO, and MCAO+FTY720 groups in the ischemic penumbra of cerebral cortex. (D) Immunofluorescent staining with of Iba1 (green), TREM2 (red), and nuclei (blue) in the sham, MCAO, and MCAO+FTY720 groups in the ischemic penumbra of cerebral cortex. The 800 and 200 microns were, respectively, used to describe the size of panoramic image and details image. iNOS+/Iba1+ M1 microglia (E), and TREM2+/Iba1+ M2 microglia (F) were quantified. n ≥ 6 per group, ***p < 0.001, compared to the MCAO group, by Student's t-test with unpaired. (G–J) Western blots were used to quantify the expression of Iba1, iNOS, TREM2, and NLRP3 in each group. Densitometric analysis of all Western blot bands was normalized to GAPDH. Statistical analysis was performed using Two-way ANOVA. Data are presented as means ± SEMs, n = 4, *p < 0.05, **p < 0.01 compared with Sham group, #p < 0.05, ##p < 0.01 compared with MCAO group. All data are presented as means ± SEM.
FTY720 treatment reduces the levels of pro-inflammatory factor in the serum and promotes M2 microglial polarization. FTY720 prevented MCAO-induced increases of L-1β and TNF-α in serum levels (A,B). n ≥ 8 per group,**p < 0.01, compared to the sham group; #p < 0.05, ##p < 0.01, compared to the MCAO group, by one-way ANOVA and Tukey's test. (C) Immunofluorescent staining with of Iba1 (green), iNOS (red), and nuclei (blue) in the sham, MCAO, and MCAO+FTY720 groups in the ischemic penumbra of cerebral cortex. (D) Immunofluorescent staining with of Iba1 (green), TREM2 (red), and nuclei (blue) in the sham, MCAO, and MCAO+FTY720 groups in the ischemic penumbra of cerebral cortex. The 800 and 200 microns were, respectively, used to describe the size of panoramic image and details image. iNOS+/Iba1+ M1 microglia (E), and TREM2+/Iba1+ M2 microglia (F) were quantified. n ≥ 6 per group, ***p < 0.001, compared to the MCAO group, by Student's t-test with unpaired. (G–J) Western blots were used to quantify the expression of Iba1, iNOS, TREM2, and NLRP3 in each group. Densitometric analysis of all Western blot bands was normalized to GAPDH. Statistical analysis was performed using Two-way ANOVA. Data are presented as means ± SEMs, n = 4, *p < 0.05, **p < 0.01 compared with Sham group, #p < 0.05, ##p < 0.01 compared with MCAO group. All data are presented as means ± SEM.
FTY720 Treatment Promotes a Phenotypic Change in Primary Microglia From the M1 to M2 Phenotype in Oxygen-Glucose Deprivation (OGD) Model
In order to determine whether FTY720 regulated microglial polarization directly, the primary cultured microglia was induced activation by OGD. Figure 3A shows that the microglia showed an obvious amoeba-like state after 3 h OGD. However, FTY720 treatment at a concentration of 0.1 μM could significantly inhibit OGD-induced microglial activation, which exhibited a decrease in size with retracted branches compared to OGD groups, and this concentration did not induce toxicity in microglia (Figure 3B). Then, the mRNA levels of the M1/M2 markers were measured under different treatment. The results from quantitative real-time polymerase chain reaction (qPCR) revealed that the M1 markers (CD86, Cox-2, iNOS, IL-1β, IL-6, TNF-α, and IFN-γ) were significantly increased in microglia after OGD treatment (Figure 3C), and the M2 markers (IGF, TGF-β1, TGF-β2, TGF-β3, CCL2, CCR2, G-CSF, and GM-CSF) were markedly suppressed (Figure 3D). These alterations in the M1and M2 markers were significantly attenuated by FTY720 treatment (Figures 3C,D). Consistently, the results of western blotting analysis showed that FTY720 treatment attenuated OGD-induced the increases of NLRP3 inflammasome and M1 markers (iNOS, CD11b, Cox-2, and Pre-IL1β) and the decreases of M2 markers (CD206 and IGF-1α) in microglia, confirming that FTY720 could directly promote microglial polarization to M2 phenotype (Figure 3E). Furthermore, the phagocytic function of microglia was determined by pH-sensitive red dye zymosan bioparticles. The red fluorescence did not change in OGD-treated microglia. However, the red fluorescence continuously increased with 90 min after treatment FTY720 (Figure 3F). Taken together, these findings strongly indicate that FTY720 facilitates the M2 phenotypic shift of microglial polarization.
Figure 3
FTY720 treatment promotes microglial phenotypic change from M1 to M2 in OGD model. OGD for 3 h induced microglial cells activation which showed larger and rounder shape with slim branches compared with the control group (A). FTY720 (0.01 μM) suppressed the amoeboid “activated” morphology of microglia induced by3 h OGD (B). FTY720 reversed 3 h OGD-induced mRNA expressions of M1 markers (CD86, COX-2, iNOS, IFN-γ, IL-1β, TNF-a, and IL-6) (C) and mRNA expressions of M2 markers (CCL2, GCSF, GMCSF, IGF-1, TGF-β1, TGF-β2, and TGF-β3) (D) in microglial cells. In addition, FTY720also reversed 3 h OGD-induced protein expressions of NLRP3 inflammasome and M1 markers (CD11b, COX-2, iNOS andIL-1β) and protein expressions of M2 markers (CD206 and IGF-1a) in microglial cells (E). n ≥ 4 per group, *p < 0.05, **p < 0.01, ***p < 0.001, compared to the Con group; #p < 0.05, ##p < 0.01, ###p < 0.001, compared to the OGD group, by one-way ANOVA and Tukey's test. pHrodo™ Green Zymosan BioParticles were added to the cells and imaged after 30, 60, 90, and 120 min. The green staining in the microglia cells was due to Cell Tracker™ Green. (F) The microglia cells showed the time course of red fluorescence increased, documenting the accumulation of pHrodo-conjugated zymosan bioparticles (1 μm in diameter) in the intracellular acidic environment corresponding to phagosomes. All data are presented as means ± SEM.
FTY720 treatment promotes microglial phenotypic change from M1 to M2 in OGD model. OGD for 3 h induced microglial cells activation which showed larger and rounder shape with slim branches compared with the control group (A). FTY720 (0.01 μM) suppressed the amoeboid “activated” morphology of microglia induced by3 h OGD (B). FTY720 reversed 3 h OGD-induced mRNA expressions of M1 markers (CD86, COX-2, iNOS, IFN-γ, IL-1β, TNF-a, and IL-6) (C) and mRNA expressions of M2 markers (CCL2, GCSF, GMCSF, IGF-1, TGF-β1, TGF-β2, and TGF-β3) (D) in microglial cells. In addition, FTY720also reversed 3 h OGD-induced protein expressions of NLRP3 inflammasome and M1 markers (CD11b, COX-2, iNOS andIL-1β) and protein expressions of M2 markers (CD206 and IGF-1a) in microglial cells (E). n ≥ 4 per group, *p < 0.05, **p < 0.01, ***p < 0.001, compared to the Con group; #p < 0.05, ##p < 0.01, ###p < 0.001, compared to the OGD group, by one-way ANOVA and Tukey's test. pHrodo™ Green Zymosan BioParticles were added to the cells and imaged after 30, 60, 90, and 120 min. The green staining in the microglia cells was due to Cell Tracker™ Green. (F) The microglia cells showed the time course of red fluorescence increased, documenting the accumulation of pHrodo-conjugated zymosan bioparticles (1 μm in diameter) in the intracellular acidic environment corresponding to phagosomes. All data are presented as means ± SEM.
Intra-nuclear SphK2-Mediated Phosphorylation Is Necessary for FTY720-Facilitatedthe Switch of Microglial Polarization From M1 to M2
The inside-out signaling by SphK1/S1P/S1PRs has important implications for brain protection following stroke (27–29), but the function of SphK2 has been less investigated in the ischemic stroke. In our study, we used the inhibitors of SphK1, SphK2, and SphK1/2 to investigate the roles of intra-nuclear SphK2-S1P signaling axis in the microglial polarization. We found that OGD induced S1P reduction either in the nucleus or the cytoplasm of microglia (Figure 4A). Figures 4B–D showed that OGD resulted in a significant increase in the number of CD86+ cells among the microglia. The administration of FTY720 significantly reversed the increased number of CD86+ cells and enhanced the number of CD206+ cells in OGD-treated microglia, which was abolished by SKI II (SK, SphK1/2 inhibitor) and ABC294640 (ABC, SphK2 inhibitor) treatment. However, SphK1 inhibitor PF-543 (PF) failed to affect the regulation of FTY720 in the number of CD206+ cells and CD86+ cells. Simultaneously, immunofluorescence staining also showed that FTY720 induced a decrease in the M1 microglial marker (green fluorescence, iNOS, and CD86) and an increase in the M2 microglial marker (red fluorescence, CD206, and TREM2), which were reversed by SK and ABC (Figures 4E,F). And PF did not abolish the effects of FTY720. Collectively, these results suggest that the intra-nuclear SphK2-S1P axis plays a positive regulative in microglial M2 polarization.
Figure 4
Intra-nuclear SphK2-mediated phosphorylation is necessary for FTY720-facilitated the switch of microglial polarization from M1 to M2. (A) The expression of S1P was analyzed by ELISA. n ≥ 4 per group, **p < 0.01, compared to the Con group in Cytoplasm; #p < 0.05, compared to the Con group in intra-nuclear, by Student's t-test with unpaired. Fluorescence-activated cell sorting analysis of the microglia in the OGD, OGD+FTY720, OGD+FTY720+SK, OGD+FTY720+ABC, and OGD+FTY720+PF groups. Surface expression of CD86 and CD206 was detected in microglia by flow cytometry. The percentage of CD86 (B,C) and CD206 (B,D) in the microglia was analyzed. n ≥ 4 per group, ***p < 0.001, compared to the Con group; ###p < 0.001, compared to the OGD group; †††p < 0.001, compared to the OGD+FTY group, by one-way ANOVA and Tukey's test. SK and ABC reversed FTY720-induced changes in the protein expression of the M1 markers (iNOS and CD86, green) and the M2 markers (CD206 and TREM2, red) by immunofluorescent staining (E,F). PF failed to affect FTY720-induced changes in the protein expression of the M1 markers (iNOS and CD86, green) and the M2 markers (CD206 and TREM2, red) (E,F). Scale bar = 20 μm. All data are presented as means ± SEM.
Intra-nuclear SphK2-mediated phosphorylation is necessary for FTY720-facilitated the switch of microglial polarization from M1 to M2. (A) The expression of S1P was analyzed by ELISA. n ≥ 4 per group, **p < 0.01, compared to the Con group in Cytoplasm; #p < 0.05, compared to the Con group in intra-nuclear, by Student's t-test with unpaired. Fluorescence-activated cell sorting analysis of the microglia in the OGD, OGD+FTY720, OGD+FTY720+SK, OGD+FTY720+ABC, and OGD+FTY720+PF groups. Surface expression of CD86 and CD206 was detected in microglia by flow cytometry. The percentage of CD86 (B,C) and CD206 (B,D) in the microglia was analyzed. n ≥ 4 per group, ***p < 0.001, compared to the Con group; ###p < 0.001, compared to the OGD group; †††p < 0.001, compared to the OGD+FTY group, by one-way ANOVA and Tukey's test. SK and ABC reversed FTY720-induced changes in the protein expression of the M1 markers (iNOS and CD86, green) and the M2 markers (CD206 and TREM2, red) by immunofluorescent staining (E,F). PF failed to affect FTY720-induced changes in the protein expression of the M1 markers (iNOS and CD86, green) and the M2 markers (CD206 and TREM2, red) (E,F). Scale bar = 20 μm. All data are presented as means ± SEM.
Intra-nuclear SphK2-S1P Axis Decreases the HDAC1 Activities and Inhibits the Deacetylation at the KLF4 Promoter Regions
KLF4 has been identified as a crucial regulator of M2 macrophage polarization (19, 30). And KLF4 transcriptional activation is mainly dependent on the acetylation of histone H3 and H4 at the promoter region (20). As the main enzyme of acetylation, we found HDAC1 activities were significant higher in OGD group than in control groups. However, FTY720 markedly suppressed HDAC1 activity in OGD-treated microglial cells, and the effects of FTY720 could be completely abolished by SK or ABC and not be affected by PF (Figure 5A). To observe the acetylation of KLF4, the primer was used in the chromatin immunoprecipitation (ChIP)-PCR assays to target KLF4 promoter at the site (−859, −868) (Figure 5B). Result showed FTY720 significantly induced higher acetylation levels of histone H3 and H4 at the KLF4 promoter region (Sp1 binding) compared with OGD groups, which were markedly suppressed by SK or ABC treatment (Figure 5C). Also, microglia treated with PF failed to alter the effects of FTY720 on the acetylation of histone H3 and H4 at the KLF4 promoter region (Figure 5C).The intra-nuclear SphK2-S1P axis inhibits the HDAC1 expression and deacetylation of KLF4 promoter regions in intra-nuclear. (A) The expression of HDAC1 was analyzed by ELISA. n ≥ 4 per group, ***p < 0.001, compared to the Con group; ###p < 0.001, compared to the OGD group; †††p < 0.001, compared to the OGD+FTY720 group. (B) Site of KLF4 promoter located between −859 and −868 from the transcription starting site. (C,G) ChIP-qPCR assay was used to detect the acetylation levels of histone H3 and H4 at the KLF4 promoter regions. n ≥ 4 per group, **p < 0.01, ***p < 0.001, compared to the Con group; ##p < 0.01, ###p < 0.001, compared to the OGD group; †p < 0.05, ††p < 0.01, †††p < 0.001, compared to the OGD+FTY720 group, by one-way ANOVA and Tukey's test. (D) Labeled (FAM) with green to primary microglia was used to observe the efficiency of transfection. Scale bar = 100 μm. Quantitation of western blot data showing siRNA-FAM transfection efficiency. Statistical analysis was performed using One-way ANOVA followed by Bonferroni's post-hoc test. Data are presented as means ± SEMs, n = 3, **p < 0.01, ***p < 0.001, compared with 100 μM group. Quantitation of western blot data showed the declines in KLF4 (E) and in HDAC1 (F). Statistical analysis was performed using One-way ANOVA followed by Bonferroni's post-hoc test. Data are presented as means ± SEMs, n = 4, *p < 0.05, ***p < 0.001, compared with Con group.To further confirm these results, primary microglia was transfected with KLF4 siRNA and HDAC1 siRNA, respectively to observe the effects of FTY720. KLF4 and HDAC1 expression level in normal microglial cells was set as 1.0, and relative expression in cells after transfected with 100, 200, and 500 nM siRNA-FAM, respectively, were achieved, with the most significant reduction (up to 77%) using 500 nM siRNA-FAM (Figure 5D). Compared with siRNA-KLF4 (331 and 1,266), siRNA-HDAC1 (226 and 848), siRNA-KLF4 (796) significantly decreased KLF4 expression to 68% at 500 nM siRNA (Figure 5E) and siRNA-HDAC1 also significantly decreased HDAC1 expression to 68% at 500 nM siRNA (Figure 5F). So, we selected transfection of KLF4 siRNA (796) and HDAC1 (600) in the following experiments. Our results showed that LKB1 and HDAC1 knockdown, respectively, prevented the higher acetylation levels of histone H3 and H4 at the KLF4 promoter region induced by FTY720 (Figure 5G). Collectively, these findings reveal that SphK2-induced pFTY720 generation could inhibit the interaction between KLF4 and HDAC1 and the deacetylation at the KLF4 promoter region in microglia.
Suppressing KLF4 Deacetylation Is Necessary for FTY720-Mediated the Primay Microglial M1-to-M2 Polarization
The expression of iNOS and CD206 was used to quantify M1 and M2 microglia by immunofluorescence. Figure 6A shows that the application of OGD results in a significant decrease in the expression of CD206 and an increase in the expression of iNOS in microglia. The administration of FTY720 led to an increase in the expression of CD206 and a decrease in the expression of iNOS in OGD-treated microglia, which was abolished by KLF4 siRNA (796) or HDAC1 (600) transfection. Consistently, Western blotting analysis showed that knocking down KLF4 or HDAC1 reversed the FTY720-induced changes of M1 markers (iNOS, CD11b, Cox-2, and Pre-IL1β) and M2 markers (CD206 and IGF-1α) in microglia (Figures 6B–G), which revealed that knocking down KLF4 or HDAC1 reversed the FTY720-induced effects of promoting a M1-to-M2 shift. Taken together, these results confirm that suppressing KLF4 deacetylation is necessary for FTY720-mediated M2 polarization of microglia.
Figure 6
Suppressing KLF4 deacetylation is necessary for FTY720-mediated the primary microglial M1-to-M2 polarization. (A) Knockdown LKB1 or HDAC1 reversed FTY720-induced the changes in the protein expressions of M1 markers (iNOS, green) and M2 markers (CD206, red) by Immunofluorescent staining. Scale bar = 20 μm. (B–G) Representative Western blots was used to quantify the expression of M1 markers (CD11b, COX-2, iNOS, and IL-1β) and M2 markers (CD206 and IGF-1a) in each group. Densitometric analysis of all Western blot bands was normalized to GAPDH. Statistical analysis was performed using One-way ANOVA followed by Bonferroni's post-hoc test and Two-way ANOVA. Data are presented as means ± SEMs, n = 4, *p < 0.05, **p < 0.01, compared with Con group, #p < 0.05, compared with OGD group. †p < 0.05, ††p < 0.01, compared with OGD+FTY720 group.
Suppressing KLF4 deacetylation is necessary for FTY720-mediated the primary microglial M1-to-M2 polarization. (A) Knockdown LKB1 or HDAC1 reversed FTY720-induced the changes in the protein expressions of M1 markers (iNOS, green) and M2 markers (CD206, red) by Immunofluorescent staining. Scale bar = 20 μm. (B–G) Representative Western blots was used to quantify the expression of M1 markers (CD11b, COX-2, iNOS, and IL-1β) and M2 markers (CD206 and IGF-1a) in each group. Densitometric analysis of all Western blot bands was normalized to GAPDH. Statistical analysis was performed using One-way ANOVA followed by Bonferroni's post-hoc test and Two-way ANOVA. Data are presented as means ± SEMs, n = 4, *p < 0.05, **p < 0.01, compared with Con group, #p < 0.05, compared with OGD group. †p < 0.05, ††p < 0.01, compared with OGD+FTY720 group.
Discussion
Due to the growing incidence of ischemic stroke, there is a compelling need to discover new ways to alleviate the consequences of stroke. From the damage events to the regeneration processes, microglial activation has been consistently involved in the pathophysiology of ischemic damage. FTY720 is an immunomodulatory drug approved in 2010 as the first oral treatment for relapsing-remitting multiple sclerosis (MS) (31). A growing number of evidence suggests that FTY720 can protect against stroke-induced brain damage (15–17). Herein, our results confirmed that FTY720 treatment not only ameliorated infarct volumes and neurological dysfunction, but also decreased the levels of pro-inflammatory factors and NLRP3 inflammasomes after ischemic stroke. Two mg/kg FTY720 could only slight improve the behavior of MCAO model rats and reduce 40% the infarction area, however, which suggest the drug could not play the maximum therapeutic effect. It may be associated with the drug treatment time and metabolism. Once cerebral ischemia occurs, microglial cells undergo a series of phenotypic changes, such as morphological transformation, phagocytosis, and secretion of inflammatory mediators (4). Activated microglial cells act as double-edges words in ischemic stroke (6, 7). And the switch of microglial polarization from M1 to M2 may be an effective therapeutic strategy for ischemic stroke. Our data suggested that FTY720 treatment caused a reduction the M1 microglia polarization and an increase in M2 microglia polarization in the cortex of MCAOrat. The in vitro experiments also revealed FTY720 could suppress M1 marker expressions and NLRP3 inflammasomes and promote M2 marker expressions. Moreover, we found that FTY720 promoted microglial phagocytosis. Therefore, our findings indicate FTY720 promotes microglial M1-to-M2 polarization both in vivo and in vitro, which would be contribute to its neuroprotective effects on ischemic brain injury.FTY720 was phosphorylated by SphK1 or SphK2 to generate a bio-active form pFTY720, a S1P mimetic (16, 17, 31, 32). Growing pre-clinical and clinical studies have proved that FTY720 might be a potential therapeutic drug targeting brain inflammation after ischemic brain injury (15–17). It has been demonstrated that Sphk1-S1P regulates IL-17 expression after ischemic stroke via the TRAF2/NF-κB pathways, which aggravated OGDR-(or IR)-induced neuronal damage (27). Compared with our understanding of the functions of SphK1-S1P-S1PR signaling pathway in neuroinflammation, much less is known about the roles of the intra-nuclear SphK2-S1P axis. To reveal the crucial roles of intra-nuclear SphK2-generated S1P in the microglia-mediated neuroinflammation, the inhibitors of SphK1, SphK2, or SphK1/2 was used in our study. We observed that the SphK2 inhibitor completely abolished FTY720-induced microglial M1-to-M2 polarization, which was in consistent with the effects of SphK1/2 inhibitor. In contrast, SphK1 inhibitor did not affect the function of FTY720. Therefore, these results reveal that FTY720, phosphorylated by intra-nuclear SphK2, facilitates the switch of microglial polarization from the M1 phenotype to the M2 phenotype.KLF4 is an anti-inflammation transcriptional regulator, which has been reported to play a key role in regulating microglial polarization (19, 30). A recent study showed that HDAC1 and KLF4 competitively bounded to the promoter region of KLF4 and oppositely regulated KLF4 expression (20). Given the role of KLF4 in regulating microglial polarization, we hypothesized that intra-nuclear KLF4 might be involved in the intra-nuclear SphK2-S1P axis-induced microglial polarization. As a result, we found that FTY720 markedly suppressed OGD-induced an increase in the HDAC1 activities, which could be completely abolished by SK or ABC but not be affected by PF. KLF4 transcriptional activation is mainly dependent on acetylated histone H3 and H4 at the promoter region. Herein, we used the Chip-qPCR assays to detect the acetylation levels of histone H3 and H4 at the KLF4 promoter regions. Moreover, knock down KLF4 or HDAC1 prevented the higher acetylation levels of histone H3 and H4 at the KLF4 promoter region induced by FTY720. The findings revealed that FTY720 phosphorylated via intra-nuclear SphK2 directly inhibited the interaction between KLF4 with HDAC1, and thereby suppressed the deacetylation of KLF4.To confirm the crucial roles of KLF4 deacetylation in FTY720-mediated microglial polarization, we used KLF4 or HDAC1 siRNA to suppress KLF4 deacetylation in primary microglia. KLF4 or HDAC1 knockdown could significantly inhibit FTY720 mediated increases in the M2 microglial marker and reductions in the M1 microglial marker by immunofluorescence and western blotting. These results demonstrate that suppressing KLF4 deacetylation is necessary for FTY720-induced the M1-to-M2 microglial phenotype shift.
Conclusions
Phosphorylated by intra-nuclear SphK2, FTY720 promotes microglial M1 to M2 shift. Intra-nuclear pFTY720 inhibits HDAC1 activations and prevents KLF4 to interact with HDAC1, and thereby suppresses KLF4 deacetylation (Figure 7). Therefore, our data reveals that intra-nuclear SphK2-S1P axis might facilitate the transformation of microglial polarization from the M1 phenotype to the M2 phenotype, which might be intra-nuclear regulatory mechanisms of FTY720-prevented neuroinflammation.
Figure 7
Schematic model. FTY720 was phosphorylated to S1P by intra-nuclear Sphk2, and subsequently inhibited KLF4 interaction with HDAC1 and promoted the acetylation of KLF4. The acetylated KLF4 facilitated the switch of microglial polarization from M1 to M2 phenotype. All data are presented as means ± SEM.
Schematic model. FTY720 was phosphorylated to S1P by intra-nuclear Sphk2, and subsequently inhibited KLF4 interaction with HDAC1 and promoted the acetylation of KLF4. The acetylated KLF4 facilitated the switch of microglial polarization from M1 to M2 phenotype. All data are presented as means ± SEM.
Data Availability
All datasets generated for this study are included in the manuscript and/or the supplementary files.
Ethics Statement
All animal operational procedures were approved by the Institutional Animal Care and Use Committee of Jiangsu province association of experimental animals.
Author Contributions
JJ was involved in the research design, experimental performances, data analysis, and drafting of the manuscript. JW and JY performed most of the experiments. J-JH participated in the cell culture. X-PW and T-FX established the ischemic models and tested animal behavioristics. X-LS took care of all aspects including the research design, data analysis, and manuscript revision. All authors read and approved the final manuscript.
Conflict of Interest Statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Authors: Peter Kraft; Eva Göb; Michael K Schuhmann; Kerstin Göbel; Carsten Deppermann; Ina Thielmann; Alexander M Herrmann; Kristina Lorenz; Marc Brede; Guido Stoll; Sven G Meuth; Bernhard Nieswandt; Waltraud Pfeilschifter; Christoph Kleinschnitz Journal: Stroke Date: 2013-09-12 Impact factor: 7.914
Authors: Xudong Liao; Nikunj Sharma; Fehmida Kapadia; Guangjin Zhou; Yuan Lu; Hong Hong; Kaavya Paruchuri; Ganapati H Mahabeleshwar; Elise Dalmas; Nicolas Venteclef; Chris A Flask; Julian Kim; Bryan W Doreian; Kurt Q Lu; Klaus H Kaestner; Anne Hamik; Karine Clément; Mukesh K Jain Journal: J Clin Invest Date: 2011-06-13 Impact factor: 14.808
Authors: Waltraud Pfeilschifter; Bożena Czech-Zechmeister; Marian Sujak; Ana Mirceska; Alexander Koch; Abdelhaq Rami; Helmuth Steinmetz; Christian Foerch; Andrea Huwiler; Josef Pfeilschifter Journal: Biochem Biophys Res Commun Date: 2011-08-22 Impact factor: 3.575
Authors: Y Huang; J Chen; C Lu; J Han; G Wang; C Song; S Zhu; C Wang; G Li; J Kang; J Wang Journal: Cell Death Dis Date: 2014-10-23 Impact factor: 8.469
Authors: Tao Gaojian; Qian Dingfei; Li Linwei; Wang Xiaowei; Zhou Zheng; Liu Wei; Zhu Tong; Ning Benxiang; Qian Yanning; Zhou Wei; Chen Jian Journal: Cell Death Discov Date: 2020-10-06
Authors: Henryk Jęśko; Przemysław L Wencel; Sylwia Wójtowicz; Joanna Strosznajder; Walter J Lukiw; Robert P Strosznajder Journal: Mol Neurobiol Date: 2020-04-30 Impact factor: 5.590