Literature DB >> 31213910

Apolipoprotein C1 (APOC1) promotes tumor progression via MAPK signaling pathways in colorectal cancer.

Hui Ren1,2, Zhihui Chen1, Liang Yang1, Weixin Xiong1, Hong Yang3, Kaiwu Xu1, Ertao Zhai1, Li Ding4, Yulong He1,2, Xingming Song1.   

Abstract

Aim: Identifying high-efficiency prognostic markers for colorectal cancer (CRC) is necessary for clinical practice. Increasing evidence demonstrates that apolipoprotein C1 (APOC1) promotes carcinogenesis in some human cancers. However, the expression status and biological function of APOC1 in CRC remain unclear. Materials and methods: We detected the association between APOC1 expression and clinicopathological features in 140 CRC patients by immunohistochemistry. Small interfering RNA (siRNA) technology was used to downregulate APOC1 expression in CRC cells. Cell proliferation was estimated by CCK8 and clonogenic assays. The cell cycle and apoptosis were analyzed by flow cytometry. Cell migration and invasion were examined by a transwell assay. Gene set enrichment analysis (GSEA) and protein expression of signaling pathways were used to suggest the possible APOC1-associated pathways in CRC.
Results: APOC1 was highly expressed in CRC tissues. High immunohistochemistry (IHC) expression of APOC1 was correlated with the N stage, M stage and TNM stage. High IHC APOC1 expression in CRC tissues was associated with poor prognosis. Univariate and multivariate Cox regression analyses showed that APOC1 was an independent risk factor for OS. Cell proliferation of CRC cell lines was inhibited by the downregulation of APOC1. Moreover, si-APOC1 transfection induced cell cycle arrest but low apoptosis increases by regulating the expression of related proteins. Cell migration and invasion were also inhibited by the downregulation of APOC1. The Cancer Genome Atlas Colorectal Adenocarcinoma (TCGA COAD-READ) dataset analyzed by GSEA showed that APOC1 might be involved in the mitogen-activated protein kinase (MAPK) signaling pathway, which was further preliminarily confirmed by Western blotting.
Conclusion: APOC1 was overexpressed in CRC tissues, and a high level of APOC1 contributed to a poor prognosis. APOC1 expression influenced the cell proliferation ability and motility capacity of CRC via the MAPK pathway. APOC1 could act as a novel prognostic biomarker in CRC.

Entities:  

Keywords:  APOC1; MAPK signaling; apolipoprotein C1; colorectal cancer; prognosis

Year:  2019        PMID: 31213910      PMCID: PMC6549782          DOI: 10.2147/CMAR.S192529

Source DB:  PubMed          Journal:  Cancer Manag Res        ISSN: 1179-1322            Impact factor:   3.989


Introduction

Colorectal cancer (CRC) is the third most common malignant tumor and is the fourth leading cause of death from cancer worldwide.1,2 The morbidity and mortality of CRC have been increasing in recent years.3 Despite the advance in early detection, chemotherapy, surgery and target therapy, the prognosis of patient with advanced CRC remains poor. CRC development is a multistep process with the accumulation of genetic and epigenetic alterations. Therefore, it is important to clarify the molecular mechanisms controlling CRC progression and explore novel targeted drugs for improving the prognosis of CRC patients. Apolipoprotein C1 (APOC1), a producer gene located at 19q13.32, belongs to the apolipoprotein C family. The protein is mainly synthesized by the liver and other tissues such as the brain, lung, spleen and intestines.4 APOC1 participates in lipoprotein metabolism by regulating the expression of lipase, transferases and cholesteryl ester transfer protein (CETP) and inhibiting the uptake of triglyceride lipoprotein by the hepatic lipoprotein receptor. However, in recent years, some studies have confirmed that APOC1 promotes carcinogenesis and tumor development.5–7 APOC1 is highly expressed in late-stage lung cancer and is likely involved in the progression of the tumor burden. In papillary thyroid carcinoma, APOC1 can be considered a candidate prognostic biomarker for patients with papillary thyroid carcinoma.8 However, the role of APOC1 in CRC progression has not been revealed. APOC1 is a type of secretory protein commonly associated with very low-density lipoprotein(VLDL) and low-density lipoprotein (LDL).9,10 Recent studies showed that LDL can regulate cell proliferation, migration and apoptosis and induce cell inflammation via MAPK signaling pathways.11–14 MAPK signaling pathways participated in a wide range of complex biologic processes, such as cell proliferation, cell death, cell migration and cell invasion.15–17 MAPKs are a group of serine-threonine kinases that mediate a wide variety of cellular behaviors in response to extracellular stimuli.18 The foremost enzymes studied in the MAPK family include the extracellular signal-regulated kinases 1 and 2 (ERK1/2), c-Jun amino-terminal- kinase 1–3 (JNK 1/2/3) and p38MAPK. In this study, we first detected APOC1 expression in CRC tissues and analyzed its clinical significance in patients with CRC. Then, we investigated the role of APOC1 on cell proliferation, apoptosis, migration and invasion in CRC cell lines. Furthermore, by analyzing the data from TCGA cohorts, we determined that APOC1-regulated CRC progression by activating the P38 MAPK signaling pathway. Our study demonstrates that APOC1 could be a prognostic factor in CRC.

Materials and methods

Patients and tissue samples

A total of 140 cases of CRC paraffin-embedded samples and 15 paired fresh CRC samples were enrolled in this study. All samples were obtained from CRC patients undergoing colorectal surgery at the Gastroenterology of the First Affiliated Hospital of Sun Yat-sen University (FAHSYSU) in 2010 and 2017. The 140 paraffin-embedded samples were used for immunohistochemistry and histological evaluation. The patient’s demographic and clinicopathological features are shown in Supplemental Table 1. The CRC TNM status was applied according to guidelines from the 2017 American Joint Committee on Cancer staging manual (AJCC 8th edition). All patients had follow-up records of more than 5 years between 2010 and 2017. Survival time was measured from the date of surgery to the follow-up deadline or date of death (usually the result of cancer recurrence or metastasis). Another 15 paired fresh samples obtained in 2017 were used for immunohistochemistry, protein and RNA expression analysis. In addition, no patient received preoperative chemotherapy or radiotherapy. All patients had provided a written informed consent by the First Affiliated Hospital of Sun Yat-sen University Institutional Review Board for the use of these clinical materials for research purposes. And this study was conducted in accordance with the Declaration of Helsinki.
Table 1

Relationship between Apolipoprotein C1 (APOC1) expression and clinicopathological features in 140 colorectal cancers

CharacteristicsNumberLow expression (N=73)High expression (N=67)χ2p-Value
Gender0.1620.688
 Male864640
 Female542727
Age1.1480.284
 <60 years633627
 ≥60 years773740
Tumor size0.0290.866
 <5 cm703634
 ≥5 cm703733
Differentiation degree5.0760.079
 Well761
 Morderate1055649
 Poor281117
Tumor location0.8850.927
 Ascending colon301614
 Transverse colon844
 Descending colon734
 Sigmoid colon261214
 Rectum693831
T stage3.9870.263
 1330
 222139
 31075453
 4835
N Stage5.9830.05a
 0855035
 1371819
 218513
M stage5.8760.015a
 01216853
 119514
TNM stage8.7340.033a
 Ⅰ20146
 Ⅱ573324
 Ⅲ442123
 Ⅳ19514

Notes: Statistical analyses were performed by the Pearson χ2 test. The TNM staging system is based on the extent of the tumor (T), the extent of spread to the lymph nodes (N) and the presence of metastasis (M). aStatistically significant.

Relationship between Apolipoprotein C1 (APOC1) expression and clinicopathological features in 140 colorectal cancers Notes: Statistical analyses were performed by the Pearson χ2 test. The TNM staging system is based on the extent of the tumor (T), the extent of spread to the lymph nodes (N) and the presence of metastasis (M). aStatistically significant.

Immunohistochemistry (IHC)

The following procedures were performed by classical biotin–streptavidin–peroxidase IHC staining protocols according to previously described methods.19 Briefly, the protein expression of APOC1 was detected by anti-APOC1 (1:200, ab198288, Abcam Inc, Cambridge, MA, USA) antibody and a goat anti-mouse/rabbit secondary antibody (Gene Tech Co Ltd, GTVisionTM III Detection System/Mo&Rb, Shanghai, China). To estimate the score for the 140 cases of CRC paraffin-embedded samples, five high-power fields were chosen randomly for the assessment of APOC1 expression in a double-blind procedure. The sample scores were based on both the intensity of staining and the proportion of positively stained tumor tissue. The immunostaining results were scored based on the following system: for staining intensity scoring: 0 (negative), 1 (weak), 2 (moderate), 3 (strong); for staining area scoring: 0 (0%), 1 (1–25%), 2 (26–50%), 3 (51–75%) and 4 (76–100%). The staining index was calculated as the product of the proportion of positive tissue × the staining intensity score (range from 0 to 12). An optimal cutoff value was identified as follows: a staining index score ≥6 was considered as tumors with high APOC1 expression and ≤4 was considered as tumors with low expression of APOC1.20

Cell culture and treatment

Human CRC cell lines (SW1116, SW620, HCT116, SW480 and LS174T) were obtained from the American Type Culture Collection (Manassas, VA, USA). NCM460, a human immortalized colonic epithelial cell line, was obtained from IN CELL (San Antonio, TX, USA). All cell lines were cultured at 37°C with 5% CO2 in DMEM/RPMI-1640 medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FBS (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillin and 100 μg/mL streptomycin.

Cell transfection with small interfering RNA (siRNA)

To knock down the expression of APOC1, three APOC1-targeted siRNAs (si-APOC1#1–3) and a negative control siRNA (si-Control) synthesized by GenePharma (RiboBio, Guangzhou, China) were used. The siRNA sequences are shown in Table S1. SW480 and SW620 cells were transiently transfected with siRNAs using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The transfected cells were designated as SW480/si-APOC1, SW480/si-Control, SW620/si-APOC1 and SW620/si-Control, respectively.
Table S1

Small interfering RNA (siRNA) sequences that target apolipoprotein C1 (si-APOC1) and negative control siRNA (si-Control)

siRNASense sequence (5ʹ- 3ʹ)Antisense sequence(5ʹ- 3ʹ)
si-APOC1 #1GAAACACACTGGAGGACAACUUUGUGUGACCUCCUGUU
si-APOC1 #2ATTTCGGTGACTTCCGCATCUAAAGCCACUGAAGGCGUAG
si-APOC1 #3TGGGACACAGGCAGGTTCTACCCUGUGUCCGUCCAAGA
si-ControlUUCUCCGAACGUGUCACGUAAGAGGCUUGCACAGUGCA

RNA extraction, reverse transcription and real-time quantitative PCR

Total RNA was extracted from cultured cells or tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Real-time quantitative PCR was performed using SYBR Green I (Invitrogen) with an ABI PRISM 7500 system (Applied Biosystems, Foster City, CA, USA). The housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an internal control. Primers for real-time quantitative PCR are summarized in Table S2.
Table S2

PCR primers for APOC1 and downstream target genes

GeneSequence
GAPDH-FCGCTGAGTACGTCGTGGAGTC
GAPDH-RGCTGATGATCTTGAGGCTGTTGTC
APOC1-FACCCACTT AGAGTTGTGAGCCC
APOC1-RCAGACCACCTTAGTCCCTTTCC
Oncomine analysis of APOC1 expression in colorectal cancer (total 7 colorectal cancer cohorts)

Western blotting

Western blotting was performed as previously described.21 The following primary antibodies were used: APOC1 (1:1000, ab198288), cyclin B1 (1:5000, ab32053), cyclin D1 (1:5000, ab134175), caspase-9 (1:1000, ab202068), BCL-2 (1:500, ab32124), ERK1/2 (1:500, ab196883), phospho-ERK1/2 (1:500, ab65142), and GADPH (1:2500, ab9485) were purchased from Abcam Inc. Phospho-p38 (1:1000, #9211), p38 (1:1000, #9212), phospho-JNK (1:1000, #9251) and JNK (1:1000, #9252) were purchased from Cell Signaling Technology (Boston, MA, USA). Goat anti-rabbit IgG H&L (1:2000, ab6721, Abcam) was used as a second antibody.

Cell proliferation detection

Cell proliferation detection was assessed by the Cell Counting Kit-8 (CCK-8) cell proliferation kit (Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Briefly, cells were plated into 96-well plates at 2×103 cells/well with 100 μL complete medium and cultured under normal conditions. At the indicated times, cells were incubated with 100 μL of RPMI-1640 medium plus 10 μL of CCK8 reagent at 37°C for 2 hrs. Then, the absorbance was measured on a microplate reader (Bio-Rad, La Jolla, CA, USA) at a wavelength of 450 nm. Three independent repeat experiments were performed.

Flow cytometry analysis of the cell cycle and apoptosis

Flow cytometry analysis was performed as previously described.22 For cell cycle analysis, the cells were trypsinized and washed into single-cell suspensions and fixed with ice-cold 70% ethanol at −20°C overnight. The fixed cells were then subsequently stained with 20 mg/mL propidium iodide (PI) staining buffer (containing 1% Triton X-100 and 100 mg/mL RNase A) for 30 mins. DNA content was assessed using a FACSCalibur unit (Becton Dickinson, Franklin Lakes, NJ, USA) equipped with ModFit LT v2.0 software. To analyze apoptosis, cultured cells were harvested by trypsinization and were washed with PBS. Cells (1×106) from each sample were processed for annexin V-fluorescein isothiocyanate (FITC)/PI apoptosis detection according to the manufacturer’s instructions (Becton Dickinson, Franklin Lakes, NJ, USA). All the experiments were repeated at least three times.

Colony formation assay

Briefly, exponentially growing cells were seeded into 6-well plates (1000 cells/well) and cultured at 37°C with 5% CO2 for 10–14 days. The colonies were fixed with 75% ethanol for 30 mins and then were stained with 0.5% crystal violet (Beyotime, Nanjing, China) for visualization and counting. Only colonies with more than 50 cells were counted manually. Triple wells were included for each group of cells, and all experiments were repeated three times.

Transwell migration and invasion assays

Cell transwell migration and invasion assays were performed using a transwell apparatus (Corning, NY, USA) with the upper chamber of an 8-μm pore size polycarbonate membrane placed in matched 24-well cell culture plates. For the migration assay, cells (1×105) in 200 μL RPMI-1640 were seeded into the upper chamber without Matrigel; for the invasion assay, cells (2×105) in 200 μL RPMI-1640 were seeded into the upper chamber with a thin layer of 0.5 mg/L Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). For both assays, 500 μL RPMI-1640 containing 20% FBS was added to the lower chambers. The plates were incubated for 24 hrs (migration) or 48 hrs (invasion). Then, cells that had migrated or invaded to the bottom of the membrane were fixed with 75% methanol for 30 mins and stained with 0.5% crystal violet for 1 hr. Cells were counted in 5 random fields for each membrane under a microscope (Axio Observer Z1, ZEISS, Germany) at 100× magnification. Each measurement was carried out in triplicate wells, and independent experiments were repeated three times.

Bioinformatics analysis

We collected gene expression data for 380 colon and rectal adenocarcinomas (COAD-READ) and 50 normal tissues cases from The Cancer Genome Atlas website (TCGA, https://tcga-data.nci.nih.gov/tcga/). To investigate the molecular pathways associated with overexpression of APOC1 in CRC, gene set enrichment analysis (GSEA)23 was performed using the GSEA desktop software.24 Enriched gene sets comparing APOC1 higher expression and lower expression were identified using 1,000 permutations of the phenotype labels. We also used Oncomine (https://www.oncomine.org), a database of RNA and DNA sequencing information curated from The Cancer Genome Altas, Gene Expression Omnibus and other published literature to evaluate and compare the expression level of APOC1 between CRC and normal samples.

Statistical analysis

The results are expressed as mean±SD. All statistical analyses were performed using the SPSS statistical software package (standard V.20.0; IBM Corportion, Armonk, USA.). Pearson’s Chi-square test was used for comparison of patient clinicopathological characteristics with APOC1 expression. A Cox regression proportional hazards model was used for univariate and multivariate analyses to determine the independent significance of relevant clinical covariates. The association of APOC1 expression and overall survival (OS) rates of patients were calculated by the Kaplan–Meier method, and differences were analyzed using the log-rank test. Values of P<0.05 in all cases were considered statistically significant.

Results

APOC1 is overexpressed in primary CRC

To evaluate APOC1 expression in CRC and normal tissues, we first analyzed APOC1 expression in the TCGA cohort (Figure 1A and B). The upregulation of APOC1 mRNA was validated in CRC samples (N=380) compared to normal samples (N=50) from the TCGA cohorts (P=0.012) (Figure 1A). A similar trend was observed in paired tumor and adjacent normal samples in the same cohort (N=25; P=0.002) (Figure 1B). We also found that APOC1 mRNA expression was upregulated in different Oncomine CRC cohorts25–29 (Table 2). We then evaluated the mRNA and protein expression levels of APOC1 in 15 paired CRC and adjacent normal fresh samples by qPCR and Western blots. The mRNA levels were significantly elevated in the CRC tissues compared to the matched adjacent normal tissues (P<0.05, Figure 1C). Consistent with these results, the protein expression level of APOC1 in Case 1 to Case 4 was significantly lower in the adjacent normal tissues (N) compared with the matched CRC tissues (T) as shown in Western blots (Figure 1D).
Figure 1

Apolipoprotein C1(APOC1)  is overexpressed in primary colorectal cancer (CRC).

Notes: (A) APOC1 was highly expressed in CRC (n=380) samples compared to adjacent normal (n=50) samples based on The Cancer Genome Atlas (TCGA) database (unpaired t-test, P=0.012). (B) APOC1 was highly expressed in colorectal cancer samples compared to the adjacent normal samples of a matched paired group (n=25) based on The Cancer Genome Atlas (TCGA) database (paired t-test, P=0.002). (C) The mRNA expression level of APOC1 was higher in the majority of the 15 colorectal cancer tissues compared with the matched adjacent normal tissues (paired t-test, P<0.01). (D) The protein expression level of APOC1 was detected by Western blotting. Protein expression was higher in the colorectal cancer tissues (T1-T4) compared with the matched adjacent normal tissues (N1-N4). (E) Immunohistochemical detection of APOC1 protein expression in paraffin-embedded tissues. Positive APOC1 staining was observed mainly in the cytoplasm of CRC tissues; a and e, APOC1 was not detected in normal colorectal tissues; b and f, representative images of weak APOC1 staining in CRC tissues; c and g, representative images of moderate APOC1 staining in CRC tissues; d and h, representative images of strong APOC1 staining in CRC tissues; a, b, c, and d, original magnification ×100 (scale bar =100 μM); e, f, g, and h, ×400. (F) and (G) Kaplan–Meier survival analysis according to APOC1 expression in 140 patients with CRC. The overall survival (OS) and disease-free survival (DFS) for patients with high versus low APOC1 expression. The difference is statistically significant based on the log-rank test (both P<0.001).

Table 2

Oncomine analysis of APOC1 expression in colorectal cancer (total 7 colorectal cancer cohorts)

Cohort numberCohortSample (n)Fold-changeP-value
1Notterman Colon1Colon adenocarcinoma (18) vs normal (18)+7.944.94×10–5
2Gaspar Colon2Colorectal adenoma epithelia (56) vs normal (22)+1.1663.75×10–4
3Skrzypczak Colorectal 23Colon carcinoma (5) vs normal (10)+1.3739.32×10–4
Colon carcinoma epithelia (5) vs normal (10)+1.5511.76×10–5
4Kaiser Colon4Rectal mucinous adenocarcinoma (4) vs normal (5)+2.5140.039
Cecum adenocarcinoma (17) vs normal (5)+2.0490.005
Rectosigmoid adenocarcinoma (10) vs normal (5)+1.9630.016
Colon adenocarcinoma (41) vs normal (5)+1.8360.006
Colon mucinous adenocarcinoma (13) vs normal (5)+4.1477.09×10–4
Rectal adenocarcinoma (8) vs normal (5)+2.4640.015
5TCGA ColorectalColon mucinous adenocarcinoma (22) vs normal (22)+2.1356.42×10–4
Colon adenocarcinoma (101) vs normal (22)+1.5480.002
6Hong Colorectal5Colorectal carcinoma (70) vs normal (12)+2.0280.011
7Skrzypczak Colorectal3Colorectal carcinoma (36) vs normal (24)+1.3990.035
Apolipoprotein C1(APOC1)  is overexpressed in primary colorectal cancer (CRC). Notes: (A) APOC1 was highly expressed in CRC (n=380) samples compared to adjacent normal (n=50) samples based on The Cancer Genome Atlas (TCGA) database (unpaired t-test, P=0.012). (B) APOC1 was highly expressed in colorectal cancer samples compared to the adjacent normal samples of a matched paired group (n=25) based on The Cancer Genome Atlas (TCGA) database (paired t-test, P=0.002). (C) The mRNA expression level of APOC1 was higher in the majority of the 15 colorectal cancer tissues compared with the matched adjacent normal tissues (paired t-test, P<0.01). (D) The protein expression level of APOC1 was detected by Western blotting. Protein expression was higher in the colorectal cancer tissues (T1-T4) compared with the matched adjacent normal tissues (N1-N4). (E) Immunohistochemical detection of APOC1 protein expression in paraffin-embedded tissues. Positive APOC1 staining was observed mainly in the cytoplasm of CRC tissues; a and e, APOC1 was not detected in normal colorectal tissues; b and f, representative images of weak APOC1 staining in CRC tissues; c and g, representative images of moderate APOC1 staining in CRC tissues; d and h, representative images of strong APOC1 staining in CRC tissues; a, b, c, and d, original magnification ×100 (scale bar =100 μM); e, f, g, and h, ×400. (F) and (G) Kaplan–Meier survival analysis according to APOC1 expression in 140 patients with CRC. The overall survival (OS) and disease-free survival (DFS) for patients with high versus low APOC1 expression. The difference is statistically significant based on the log-rank test (both P<0.001). To estimate the relation between APOC1 expression and clinicopathological features, 140 cases of paraffin-embedded samples from patients with CRC were analyzed using immunohistochemistry staining. All patients with CRC were divided into two groups (APOC1 high or low expression) by the cutoff value that was established by immunohistochemistry. APOC1 protein expression was distributed in the cytoplasm of CRC tumor cells, but was negative in normal colon tissue cells (Figure 1E). As shown in Table 1, there was no correlation between APOC1 expression and clinicopathological features such as gender, age, tumor size, differentiation degree and tumor location, while high expression of APOC1 was significantly positively associated with N stage (P=0.05), M stage (P=0.015) and TNM stage (P=0.033). Thereafter, the Kaplan–Meier method was used to determine the effect of APOC1 expression on patient survival. The data showed that patients with high IHC expression of APOC1 had significantly shorter OS than others (P=0.005, log-rank test) (Figure 1F). The disease-free survival (DFS) results were similar (Figure 1G). Moreover, in univariate Cox regression analysis, high expression of APOC1 was significantly associated with poor OS and DSF with a HR of 2.059 (95% CI=1.231 to 3.444; P=0.006; Table 3) and 1.803 (95% CI=1.101 to 2.955; P=0.019; Table S3). After the adjustment for potential confounding factors, multivariate Cox regression analysis showed that high expression of APOC1 might be an independent prognostic factor in CRC (HR.=1.704; 95% CI=1.012 to 2.869; P=0.045; Table 3). Thus, these results suggest that APOC1 is highly expressed and upregulated in CRC, and APOC1 may be predictive for clinicopathological significant events for patients with CRC.
Table 3

Cox regression analysis of potential overall survival factors for patients with colorectal cancer

VariableUnivariate analysisMultivariate analysis
HR (95% CI)p-ValueHR (95% CI)p-Value
Age (years)0.851 (0.515 to 1.408)0.531
Gender1.464 (0.885 to 2.423)0.138
Tumor location1.080 (0.919 to 1.269)0.351
Tumor size
 <5 cm0.556 (0.338 to 0.939)0.028a
 ≥5 cm1.000
TNM stage
 I0.081 (0.023 to 0.280)<0.001a0.094 (0.027 to 0.328)<0.001a
 II0.208 (0.106 to 0.408)<0.001a0.222 (0.112 to 0.437)<0.001a
 III0.377 (0.198 to 0.719)0.003a0.385 (0.201 to 0.735)0.004a
 IV1.0001.000
APOC1 expression
 High2.059 (1.231 to 3.444)0.006a1.704 (1.012 to 2.869)0.045a
 Low1.0001.000

Notes: The TNM staging system is based on the extent of the tumor (T), the extent of spread to the lymph nodes (N) and the presence of metastasis. aStatistically significant.

Table S3

Cox regression analysis of potential diseases free survival factors for patients with colorectal cancer

VariableUnivariate analysisMultivariate analysis
HR (95% CI)p-ValueHR (95% CI)p-Value
Age (years)0.747 (0.459 to 1.215)0.240
Gender1.378 (0.845 to 2.249)0.199
Tumor location1.084 (0.927 to 1.269)0.311
Tumor size
 <5 cm0.611 (0.373 to 1.002)0.051
 ≥5 cm1.000
TNM stage
 I0.098 (0.032 to 0.294)<0.001a0.111 (0.036 to 0.339)<0.001a
 II0.204 (0.105 to 0.398)<0.001a0.218 (0.111 to 0.426)<0.001a
 III0.376 (0.200 to 0.710)0.003a0.390 (0.206 to 0.737)0.004a
 IV1.0001.000
APOC1 expression
 High1.803(1.101 to 2.955)0.019a1.450 (0.877 to 2.396)0.147
 Low1.0001.000

Notes: The TNM staging system is based on the extent of the tumor (T), the extent of spread to the lymph nodes (N) and the presence of metastasis (M).a Statistically significant.

Cox regression analysis of potential overall survival factors for patients with colorectal cancer Notes: The TNM staging system is based on the extent of the tumor (T), the extent of spread to the lymph nodes (N) and the presence of metastasis. aStatistically significant.

APOC1 is overexpressed in CRC cell lines

We subsequently examined levels of APOC1 expression in five CRC cell lines (SW1116, SW620, HCT116, SW480 and LS174T) and a human immortalized colonic epithelial cell line (NCM460) by Western blotting and RT-PCR. Western blotting analysis showed that five CRC cell lines had higher protein levels of APOC1 compared with NCM460 (Figure 2A). Similarly, APOC1 mRNA expression was at least fourfold greater in the CRC cell lines compared with NCM460 (Figure 2B). SW480 and SW620 were selected for the following experiments because of the high mRNA and protein expression levels of APOC1.
Figure 2

Overexpression of APOC1 mRNA and protein in colorectal cancer (CRC) cell lines.

Notes: (A) and (B) Expression of APOC1 protein and mRNA in CRC cell lines (SW1116, SW620, HCT116, SW480 and LS174T) and an immortalized colonic epithelial cell line (NCW460) were examined by Western blotting and qPCR. The expression levels were normalized against GAPDH. The error bars represent the the mean (SD) calculated from three parallel experiments. *P<0.05. (C) and (D) Successful knockdown of APOC1 in SW480 and SW620 CRC cell lines. qPCR and Western blotting were used to detect APOC1 knockdown efficiency in untransfected cells, cells transfected with si-Control (negative control siRNA) and cells transfected with si-RNA1, si-RNA2 and si-RNA3. **P<0.01 and ***P<0.001.

Overexpression of APOC1 mRNA and protein in colorectal cancer (CRC) cell lines. Notes: (A) and (B) Expression of APOC1 protein and mRNA in CRC cell lines (SW1116, SW620, HCT116, SW480 and LS174T) and an immortalized colonic epithelial cell line (NCW460) were examined by Western blotting and qPCR. The expression levels were normalized against GAPDH. The error bars represent the the mean (SD) calculated from three parallel experiments. *P<0.05. (C) and (D) Successful knockdown of APOC1 in SW480 and SW620 CRC cell lines. qPCR and Western blotting were used to detect APOC1 knockdown efficiency in untransfected cells, cells transfected with si-Control (negative control siRNA) and cells transfected with si-RNA1, si-RNA2 and si-RNA3. **P<0.01 and ***P<0.001. To determine the potential functions of APOC1 in CRC, SW480 and SW620 cells were transfected with different APOC1 siRNA (si-APOC1#1–3) oligomers to knock down endogenous APOC1, and a nonspecific siRNA (si-Control) was used as the negative control. APOC1 mRNA and protein expression levels were downregulated by transfection of APOC1 siRNAs (Figure 2C and D). The si-APOC1#1, which had a higher knockdown efficiency than si-APOC1#2–3, was then used in the following assays.

Silencing of APOC1 inhibits CRC cell proliferation

To clarify the role of APOC1 in cell proliferation, CCK-8 assays and clonogenic assays were performed. The results of the CCK-8 assay suggested that the proliferation rate of silenced APOC1 cells was lower than its control cells (both P<0.05, Figure 3A). Moreover, a clonogenic assay indicated that, compared with control cells, silenced APOC1 cells showed decreased colony formation capacity after 10–14 of days conventional culture (both P<0.01, Figure 3B). Collectively, these results indicated that silencing of APOC1 may inhibit CRC cell proliferation.
Figure 3

Effects of APOC1 knockdown on the proliferation, apoptosis, migration and invasion of CRC cells after transfection with si-Control or si-APOC1.

Notes: (A) Cell proliferation of SW480 and SW620 cells was detected using the CCK-8 assay. (B) Representative images of the clonogenic cell survival assays that were performed in SW480 and SW620 cells. (C) Flow cytometry analysis of the proportion of the cells indicated in each stage of the cell cycle (G1, G2 and S) and the percentage of cells in the G0/G1, S and G2/M phase of the cell cycle were quantified and expressed as the mean ± SD from three independent experiments. (D) Levels of apoptosis in the SW480 and SW620 cells after transfection with si-Control or si-APOC1 for 24 hrs. The cells were stained with Annexin V and PI. (E) Cell migration and invasion in SW480 and SW620 cells were assessed using Transwell assay with or without a Matrigel-coated transwell chamber. Magnification, ×100. (F) Detection of Bcl-2, caspase-9, cyclin D1 and cyclin B1 protein levels by Western blotting. Detection of GAPDH was used as a loading control. Blank: wild-type cells; si-Control: negative control siRNA; si-APOC1: APOC1-siRNA transfected cells (*P<0.05, **P<0.01 Vs si-APOC1).

Effects of APOC1 knockdown on the proliferation, apoptosis, migration and invasion of CRC cells after transfection with si-Control or si-APOC1. Notes: (A) Cell proliferation of SW480 and SW620 cells was detected using the CCK-8 assay. (B) Representative images of the clonogenic cell survival assays that were performed in SW480 and SW620 cells. (C) Flow cytometry analysis of the proportion of the cells indicated in each stage of the cell cycle (G1, G2 and S) and the percentage of cells in the G0/G1, S and G2/M phase of the cell cycle were quantified and expressed as the mean ± SD from three independent experiments. (D) Levels of apoptosis in the SW480 and SW620 cells after transfection with si-Control or si-APOC1 for 24 hrs. The cells were stained with Annexin V and PI. (E) Cell migration and invasion in SW480 and SW620 cells were assessed using Transwell assay with or without a Matrigel-coated transwell chamber. Magnification, ×100. (F) Detection of Bcl-2, caspase-9, cyclin D1 and cyclin B1 protein levels by Western blotting. Detection of GAPDH was used as a loading control. Blank: wild-type cells; si-Control: negative control siRNA; si-APOC1: APOC1-siRNA transfected cells (*P<0.05, **P<0.01 Vs si-APOC1).

Silencing of APOC1 induces CRC cell cycle arrest and apoptosis in CRC cells

We next evaluated the effect of APOC1 knockdown on the cell cycle distribution and apoptosis in CRC cells by flow cytometry. As shown in Figure 3C, silencing of APOC1 was associated with cell accumulation in the G0/G1 phase and decreased in the G2/M phase in SW480 and SW620, respectively, compared with the control cells (both P<0.05). Subsequently, an apoptosis assay showed that despite statistical differences, silencing APOC1 does not induce biologically significant changes in apoptosis rate. Further, biochemical markers of the cell cycle and apoptosis were detected. Western blot analyses revealed that protein levels of G1 phase-related cyclin D1 and G2 phase-related cyclins B1 and Bcl-2 were downregulated by silencing of APOC1, while caspase-9 was upregulated (Figure3F). These results suggested that silencing of APOC1 may induce G0/G1 phase cell cycle arrest and apoptosis in CRC.

Silencing of APOC1 suppresses CRC cell migration and invasion

To determine the effects of APOC1 on cell invasion and migration, transwell assays with or without Matrigel were performed. Transwell assays revealed that silencing of APOC1 in SW480 and SW620 cells led to approximately 20–40% reduction in numbers of migrated and invaded cells compared with si-Control transfected cells (P<0.01 and P<0.05) (Figure 3E). These results indicate that APOC1 protein may be necessary for cell invasion and migration, and silencing of APOC1 can efficiently repress the motility of CRC cells, and more in vivo investigation is needed.

Silencing of APOC1 suppresses the expression of the phosphorylated form of p38 MAPK

To identify the possible APOC1-associated pathways in CRC, GSEA was conducted with data from the TCGA COAD-READ dataset. As illustrated in Figure 4A and B and Figure S1, the heatmap and GSEA enrichment plot showed that APOC1 expression may be associated with extracellular matrix (ECM) receptor interaction and the Toll-like receptor (TLR) signaling pathway and is strongly associated with the mitogen-activated protein kinase (MAPK) signaling pathway.
Figure 4

Silencing of APOC1 suppresses the expression of mitogen-activated protein kinase (MAPK) signaling-related genes.

Notes: (A) GSEA-generated heatmap for highly enriched genes in the MAPK signaling pathway in the APOC1-higher expression group compared to the APOC1-lower expression group from the TCGA COAD-READ dataset. (B) GSEA on the TCGA COAD-READ dataset identified MAPK signaling pathways as a regulatory target of APOC1. The GSEA enrichment plot shows values for normalized enrichment score (NES) =1.87 and nominal P-value =0.004. (C) Protein levels of the MAPK pathway-related genes were evaluated by Western blotting in SW480 and SW620 cells at 48 hrs after transfection with si-Control or si-APOC1. GAPDH was used as a loading control. Band intensity given underneath gel image was measured using ImageJ software, presented as fold change compared with controls, respectively. Blank: wild-type cells; si-Control: negative control siRNA; si-APOC1: APOC1-siRNA transfected cells.

Figure S1

Gene set enrichment analysis (GSEA) enrichment analysis of the co-expressed genes.

Notes: (A) GSEA-generated heatmap for highly enriched genes in extracellular matrix (ECM) receptor interaction and the Toll-like receptor (TLR) signaling pathway on APOC1-higher expression group compared to the APOC1-lower expression group from the TCGA COAD-READ dataset. (B) GSEA on the TCGA COAD-READ dataset identified ECM receptor interaction and the TLR signaling pathway as regulatory targets of APOC1. The GSEA enrichment plot shows values for normalized enrichment score (NES) =2.00, NES =1.91 and P<0.001, P=0.002.

Silencing of APOC1 suppresses the expression of mitogen-activated protein kinase (MAPK) signaling-related genes. Notes: (A) GSEA-generated heatmap for highly enriched genes in the MAPK signaling pathway in the APOC1-higher expression group compared to the APOC1-lower expression group from the TCGA COAD-READ dataset. (B) GSEA on the TCGA COAD-READ dataset identified MAPK signaling pathways as a regulatory target of APOC1. The GSEA enrichment plot shows values for normalized enrichment score (NES) =1.87 and nominal P-value =0.004. (C) Protein levels of the MAPK pathway-related genes were evaluated by Western blotting in SW480 and SW620 cells at 48 hrs after transfection with si-Control or si-APOC1. GAPDH was used as a loading control. Band intensity given underneath gel image was measured using ImageJ software, presented as fold change compared with controls, respectively. Blank: wild-type cells; si-Control: negative control siRNA; si-APOC1: APOC1-siRNA transfected cells. Based on the above results and other reports, we predicted that APOC1 may promote colorectal carcinogenesis via MAPK signaling pathways. To preliminarily verify this hypothesis, we analyzed MAPK signaling pathway-related proteins in SW480 and SW620 cells at 48 hrs after transfection with or without siRNA by Western blotting. Compared with the blank and si-Control group, the phosphorylated form of p38 MAPK (p-p38) decreased after knockdown of APOC1 protein, whereas no significant changes were observed in phosphorylated-Erk1/2 (p-ERK) and phosphorylated-JNK (p-JNK) (Figure 4C). These results indicated that silencing of APOC1 suppressed p-p38 expression, and APOC1 may be involved in CRC carcinogenesis by activating the p38 MAPK signal pathway.

Discussion

CRC is a biologically heterogeneous disease involving various genetic and epigenetic alterations, and numerous molecular variables that contribute to the occurrence of CRC have been characterized.30,31 In this study, we identified APOC1 as a potential pro-oncogenic protein involved in cell proliferation, migration and invasion of CRC. Our results indicated that APOC1 mRNA and protein expression is higher in CRC tissues and cell lines than in adjacent normal tissues and immortalized colonic epithelial cell lines. Furthermore, we found that APOC1 plays a potential prognostic role in the survival of CRC patients, highlighting the potential values of APOC1 as an independent prognostic biomarker in human CRC. Mechanistically, we used bioinformatic approaches to analyze the possible pathway. We conjectured that APOC1 promotes cell proliferation, migration and invasion through the p38 MAPK signaling pathway. Previous studies have demonstrated that APOC1 plays an important role in lipid metabolism-related diseases, such as glomerulosclerosis,32 cardiovascular disease,33 diabetes34 and Alzheimer’s disease.35 However, emerging evidence suggests that APOC1 might be used as a new biomarker to evaluate the prognosis of patients with malignant tumors. Patients with higher or positive APOC1 expression showed a worse prognosis and advanced tumor progression in patients with pancreatic cancer,7 gastric cancer,36 lung cancer37 and papillary thyroid carcinoma.8 Our study showed that high APOC1 protein levels were correlated with a higher Duke’s classification, higher T stage, higher N stage, higher M stage and higher TNM stage (Table 1). Survival analysis demonstrated that patients with high APOC1 expression had shorter survival times than those with low expression (Figure 1F–G). These results indicate that AOPC1 is an important molecular marker and prognostic factor for solid tumors. Engwegen et al38 reported that APOC1 plays a potential role in distinguishing a colon cancer and a healthy control group. Similarly, Yasui et al39 found that compared with normal gastric epithelial cells, APOC1 was upregulated in gastric cancer, as shown by serial analysis of gene expression. Similar to Yasui’s report, our study found that APOC1 was highly expressed and upregulated in primary CRC (Figure 1A–E and Figure 2A–B). Trougakos et al40 indicated that knockdown or silencing of apolipoprotein-J in osteosarcoma and prostate cancer cells can significantly inhibit tumor cell proliferation and promote tumor cell apoptosis. In the present study, we found that silencing of APOC1 may attenuate the CRC cell proliferation rate (Figure 3A) and colony formation capacity (Figure 3B) and suggested that silencing of APOC1 may inhibit the proliferation function in CRC. We also found that silencing of APOC1 arrested CRC cells in the G0/G1 phase by flow cytometry (Figure 3C). Our Western blot results showed that cyclin B1 and cyclin D1 protein level were decreased in APOC1 silenced cells (Figure 3F), and it further confirmed that silencing APOC1 may arrest CRC cells in the G0/G1 phase. Flow cytometry showed that silencing of APOC1 increased CRC cell total apoptosis (Figure 3D) and confirmed the protein levels of caspase-9 and Bcl-2 by Western blotting (Figure 3F). These results suggested that APOC1 may affect cell proliferation of CRC cells by cell cycle arrest and cell apoptosis. Christine et al41 reported that APOC1 was overexpressed in invasive pancreatic carcinoma, as shown by in situ hybridization and speculated that APOC1 overexpression may increase the invasive function of pancreatic carcinoma. Similarly, silencing of APOC1 may attenuate the migration and invasion functions of CRC cells (Figure 3E). It is suggested that APOC1 may also participate in motility of CRC cells and have a promoting function. It has been reported that APOC1 could function as a potential tumor oncogene in different cancers.5–7 Some reports showed that APOC1 can activate or inhibit some kinases to regulate physiological or pathological functions, which were correlated with the genesis and development of cancers. However, the mechanism of APOC1 in cancers is not yet elucidated. Takano et al7 reported that APOC1 can affect preinvasive carcinoma by an autocrine function. In addition, it has been proved that APOC1 secreted as an autocrine was necessary for tumor cell survival and malignant phenotype. Thus, APOC1 may inhibit cells apoptosis to affect tumorigenesis and development. In contrast, a report42 indicated that APOC1 peptides can inhibit cell proliferation and promote apoptosis in breast cancer cells in vitro and suppress tumor growth in nude mice, but the mechanism was unconfirmed. To explore the molecular mechanism by which APOC1 exerted its functions on CRC, we performed GSEA on the TCGA COAD-READ dataset. GSEA is a bioinformatic approach that can analyze the possible correlation of a target gene and known functional gene sets.23 GSEA showed that many cancer-related gene sets, including ECM receptor interaction, the TLR pathway and MAPK pathways, were positively correlated with APOC1 expression (Figure 4A and B and Figure S1). Through further analysis, we found that the apolipoprotein family could trigger MAPK signaling pathways to cause cell proliferation,43 apoptosis44 and invasion.45 So, we conjectured that APOC1 may be associated with MAPK signaling pathways in CRC46,47 and further validated by immunoblotting (Figure 4C) that knockdown of APOC1 may decrease the phosphorylation of p38 without obviously changing total ERK1/2, p38, JNK1/2/3, phosphorylated-ERK1/2 and phosphorylated-JNK1/2/3. We initially conjectured that silencing APOC1 in CRC may inactivate the p38MAPK pathway to attenuate CRC cell proliferation, migration and invasion. Thus, we conjectured that APOC1 could promote CRC cell proliferation, migration and invasion via the MAPK pathway.

Conclusion

This study demonstrated that APOC1 was overexpressed in CRC tissues and that a high level of APOC1 contributed to a poor prognosis. APOC1 expression influenced the cell proliferation ability and motility capacity of CRC via the MAPK pathway. Our findings suggest that APOC1 could be used as a prognostic biomarker in CRC, although further investigation is needed.
  17 in total

1.  Revelation of Proteomic Indicators for Colorectal Cancer in Initial Stages of Development.

Authors:  Arthur T Kopylov; Alexander A Stepanov; Kristina A Malsagova; Deepesh Soni; Nikolay E Kushlinsky; Dmitry V Enikeev; Natalia V Potoldykova; Andrey V Lisitsa; Anna L Kaysheva
Journal:  Molecules       Date:  2020-01-31       Impact factor: 4.411

2.  ApoC1 promotes the metastasis of clear cell renal cell carcinoma via activation of STAT3.

Authors:  Yang-Ling Li; Lin-Wen Wu; Ling-Hui Zeng; Zuo-Yan Zhang; Wei Wang; Chong Zhang; Neng-Ming Lin
Journal:  Oncogene       Date:  2020-08-21       Impact factor: 9.867

3.  The Novel Tumor Microenvironment-Related Prognostic Gene AIF1 May Influence Immune Infiltrates and is Correlated with TIGIT in Esophageal Cancer.

Authors:  Xiaoling Xu; Ding Wang; Na Li; Jiamin Sheng; Mingying Xie; Zichao Zhou; Guoping Cheng; Yun Fan
Journal:  Ann Surg Oncol       Date:  2021-11-09       Impact factor: 4.339

4.  Construction of a novel mRNA-miRNA-lncRNA network and identification of potential regulatory axis associated with prognosis in colorectal cancer liver metastases.

Authors:  Chen Lu; Xiagang Luo; Cheng Xing; Yonghuan Mao; Yuting Xu; Wenjie Gao; Wulin Wang; Tian Zhan; Guoguang Wang; Zhengxia Liu; Chunzhao Yu
Journal:  Aging (Albany NY)       Date:  2021-06-03       Impact factor: 5.682

5.  Endogenous retroviruses are a source of enhancers with oncogenic potential in acute myeloid leukaemia.

Authors:  Özgen Deniz; Mamataz Ahmed; Christopher D Todd; Ana Rio-Machin; Mark A Dawson; Miguel R Branco
Journal:  Nat Commun       Date:  2020-07-14       Impact factor: 14.919

6.  Identification of potential crucial genes and key pathways in osteosarcoma.

Authors:  Junwei Liu; Siyu Wu; Xiaoyu Xie; Ziming Wang; Qianqian Lei
Journal:  Hereditas       Date:  2020-07-14       Impact factor: 3.271

Review 7.  Apolipoproteins and cancer.

Authors:  Liwen Ren; Jie Yi; Wan Li; Xiangjin Zheng; Jinyi Liu; Jinhua Wang; Guanhua Du
Journal:  Cancer Med       Date:  2019-10-01       Impact factor: 4.452

Review 8.  Apolipoprotein C1: Its Pleiotropic Effects in Lipid Metabolism and Beyond.

Authors:  Elena V Fuior; Anca V Gafencu
Journal:  Int J Mol Sci       Date:  2019-11-26       Impact factor: 5.923

9.  Overexpression of Apolipoprotein C1 (APOC1) in Clear Cell Renal Cell Carcinoma and Its Prognostic Significance.

Authors:  Huaying Xiao; Yifang Xu
Journal:  Med Sci Monit       Date:  2021-02-16

10.  Hub Genes and Key Pathway Identification in Colorectal Cancer Based on Bioinformatic Analysis.

Authors:  Jian Lv; Lili Li
Journal:  Biomed Res Int       Date:  2019-11-06       Impact factor: 3.411

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.