Background: Several in vitro studies have revealed that zinc oxide nanoparticles (ZnO-NPs) were able to target cancerous cells selectively with minimal damage to healthy cells. Purpose: In the current study, we aimed to evaluate the antitumor activity of ZnO-NPs in Ehrlich solid carcinoma (ESC) bearing mice by measuring their effect on the expression levels of P53, Bax and Bcl2 genes as indicators of apoptotic induction in tumor tissues. Also, we assessed the potential ameliorative or potentiation effect of 100 mg/kg N-acetyl cysteine (NAC) in combination with ZnO-NPs. Materials and methods: ESC bearing mice were gavaged with three different doses of ZnO-NPs (50, 300 and 500 mg/kg body weight) alone or in combination with NAC for seven consecutive days. In addition to measuring the tumor size, pathological changes, zinc content, oxidative stress biomarkers and DNA damage in ESC, normal muscle, liver and kidney tissues were assessed. Results: Data revealed a significant reduction in tumor size with a significant increase in p53 and Bax and decrease in Bcl2 expression levels in the tissues of ZnO-NPs treated ESC bearing mice. Moreover, a significant elevation of MDA accompanied with a significant reduction of CAT and GST. Also, a marked increase in all comet assay parameters was detected in ZnO-NPs treated groups. On the other hand, the combined treatment with ZnO-NPs and NAC significantly reduced reactive oxygen species production and DNA damage in liver and kidney tissues in all ZnO-NPs treated groups. Conclusion: ZnO-NPs exhibited a promising anticancer efficacy in ESC, this could serve as a foundation for developing new cancer therapeutics. Meanwhile, the combined treatment with ZnO-NPs and NAC could act as a protective method for the healthy normal tissue against ZnO-NPs toxicity, without affecting its antitumor activity.
Background: Several in vitro studies have revealed that zinc oxide nanoparticles (ZnO-NPs) were able to target cancerous cells selectively with minimal damage to healthy cells. Purpose: In the current study, we aimed to evaluate the antitumor activity of ZnO-NPs in Ehrlich solid carcinoma (ESC) bearing mice by measuring their effect on the expression levels of P53, Bax and Bcl2 genes as indicators of apoptotic induction in tumor tissues. Also, we assessed the potential ameliorative or potentiation effect of 100 mg/kg N-acetyl cysteine (NAC) in combination with ZnO-NPs. Materials and methods: ESC bearing mice were gavaged with three different doses of ZnO-NPs (50, 300 and 500 mg/kg body weight) alone or in combination with NAC for seven consecutive days. In addition to measuring the tumor size, pathological changes, zinc content, oxidative stress biomarkers and DNA damage in ESC, normal muscle, liver and kidney tissues were assessed. Results: Data revealed a significant reduction in tumor size with a significant increase in p53 and Bax and decrease in Bcl2 expression levels in the tissues of ZnO-NPs treated ESC bearing mice. Moreover, a significant elevation of MDA accompanied with a significant reduction of CAT and GST. Also, a marked increase in all comet assay parameters was detected in ZnO-NPs treated groups. On the other hand, the combined treatment with ZnO-NPs and NAC significantly reduced reactive oxygen species production and DNA damage in liver and kidney tissues in all ZnO-NPs treated groups. Conclusion:ZnO-NPs exhibited a promising anticancer efficacy in ESC, this could serve as a foundation for developing new cancer therapeutics. Meanwhile, the combined treatment with ZnO-NPs and NAC could act as a protective method for the healthy normal tissue against ZnO-NPstoxicity, without affecting its antitumor activity.
Zinc oxide nanoparticles (ZnO-NPs), among the most common metal oxides NPs, have received considerable attention due to their low production cost, ability to form diverse structures and various biological purposes such as bio-imaging probes, beauty agents, drug delivery and immune-modulatory agent.1–3 In addition, ZnO-NPs are being used in the food industry as additives and in packaging due to their antifungal and antibacterial properties4,5Despite the promising antitumor activity of ZnO-NPs in vitro, very limited studies have been performed on the animal model system. The advantage of using ZnO-NPs in cancer treatment is attributed to their cytotoxicity against cancer cells with a minimal damage to healthy cells.6 ZnO-NPs of different particle sizes ranging from 5 to 175 nm proved their cytotoxicity in Murine and cancer cells such as tumorU87, HepG-2, MCF-7, Colo320 and HeLa8.7–10 The exposure of MCF7 and A549 cells to ZnO-NPs (16–19 nm) to various concentrations ranged from (2.5–1,000 μg/mL) for 72 hrs, significantly reduced the cell viability in a concentration-dependent manner.11 Cancer is characterized by an imbalance between cell division and cell death.12 Therefore, apoptosis is a key process in cancer treatment and is controlled by a large number of genes such as the tumor suppressor gene P53, pro-apoptotic gene Bax and anti-apoptotic gene Bcl2. P53 is considered as the master guardian of the cell and is able to stimulate cell cycle checkpoints, while the Bax/Bcl2 protein ratio determines the life or death of cells.13–16 In addition, P53 is capable of upregulating the expression of Bax and downregulating the expression of Bcl2.17 Consequently, evaluation of the expression of some apoptotic-related genes after administration of different ZnO-NPs doses will be an indicative marker of the antitumor activity of ZnO-NPs in ESC bearing mice.Concurrently, it is of great importance to study the potential toxicity and safety of ZnO-NPs in order to evaluate its hazardous effect on the normal healthy tissues. ZnO bulk materials, at sizes larger than 100 nm, are considered to be relatively biocompatible and generally recognized as safe substances by the FDA. A previous in vivo toxicity study has shown that ZnO-NPs did not induce micronuclei formation in bone marrow or DNA damage in lung cells of rats after exposure to different doses (15, 30 and 50 mg/kg) of triethozycaprylylsilane-coated ZnO.18 Another study on mice has revealed that 50 nm ZnO-NPs did not induce micronuclei formation at concentrations up to 5 g/kg body weight (BW).19 However, acute oral exposure to high doses of ZnO-NPs (1–5 g/kg BW) has been reported to damage the liver, spleen and pancreas tissues in mice.20 Moreover, repeated dermal exposure to ZnO-NPs for 28 days has caused a dose-dependent toxicity on the skin of Sprague–Dawley rats.21 These controversial data urge the need to find methods that reduce the toxicity of ZnO-NPs to benefit from their antitumor activity and other wide applications.N-acetyl-L-cysteine (NAC) is the glutathione (GSH) precursor which causes an elevation of GSH levels that support the antioxidant and nitric oxide systems during infection, inflammation, stress and exposure to toxins.22–24 NAC has decreased reactive oxygen species (ROS) production in rat astrocytes and has reversed the elevated proportion of apoptotic cells in U87human glial cells induced by ZnO-NPs.25–27 These findings suggest that cells’ pretreatment with NAC could reverse the toxic effect of ZnO-NPs that is mediated via ROS production.28 In addition, NAC manifests a promising effect in cancer prevention as they possess anti-carcinogenic properties.29–31 In vitro NAC has been reported to inhibit the growth and invasive behavior of humancancer cells, such as colorectal,32 bladder,33,34 prostate,35 tongue36 and lung carcinoma cell.37 Moreover, NAC at a high dose (1g/kg IV) can act as a chemo-protectant against cisplatinnephrotoxicity in rats.38Therefore, in the present study, we assessed the potential antitumor activity, toxicity of ZnO-NPs and the underlying molecular mechanisms after oral administration of different doses (50, 300 and 500 mg/kg) in murineEhrlich solid carcinoma (ESC) bearing mice. In addition, we investigated the ameliorative or the potentiation effects of NAC against ZnO-NPs genotoxicity in the healthy and cancerous cells within the tumor-bearing mice.
Material and methods
Chemicals
ZnO-NPs (<100 nm, purity >99%, Cat. No. 544906), N-Acetyl-L-cysteine (NAC), and all other chemicals were purchased from Sigma-Aldrich (St Louis, Missouri, USA). Kits for all biochemical parameters were purchased from Bio-diagnostic Company (Giza, Egypt). Other molecular kits are listed elsewhere.
Nanoparticles preparation, characterization and biodistribution
ZnO-NPs of different doses (50, 300 and 500 mg/kg) were dispersed in deionized water and resuspended by ultrasonic vibration (130 W, 20 kHz) for 20 mins for all experimental work. ZnO-NPs suspensions were vortexed for 1 min before each administration.The morphology and size of ZnO-NPs were determined by transmission electron microscopy (HR-TEM, Tecnai G20, FEI, Netherland). The surface zeta potential measurements were also performed with the Malvern, UK Zetasizer Nano ZS. For TEM, a drop of ZnO-NPs solution (8 µg/mL in Milli-Q) was deposited on carbon-coated copper grids. The fills on the TEM grids were allowed to dry prior to measurement.39Biodistribution of ZnO-NPs was quantified by the determination of zinc levels in the normal muscle, ESC muscle, liver and kidney using inductively coupled plasma-mass spectrometry (ICP-MS) (Thermo Scientific iCAP 7000).19
Animals
Adult (6 weeks old) C 57BL/6 mice weighing 25–30 g were obtained from the animal house of the National Research Center (NRC, Giza) and acclimatized for 1 week prior to the experiments in an environment of controlled temperature (22–25°C), humidity and 12-hr light/dark cycle. Mice were housed in polypropylene cages (5 animals/cage) and permitted for free standard laboratory diet ad libitum. All the experimental procedures were carried out in accordance with the international guidelines for care and use of laboratory animals. The animal experimental protocol was approved by the Institutional Animal Care and Use Committee (CU-IACUC) at Faculty of Science, Cairo University (CU/I/F/38/18).
Tumor induction and experimental design
MurineEhrlich Ascites Carcinoma (ESC) bearing mouse was obtained from National Cancer Institute, Cairo University (Giza, Egypt). Mice were intramuscularly implanted with 0.2 mL of Ehrlich tumor cell suspension (containing about 2×106 viable cells) in the thigh of the left hind leg. Once solid tumor appeared on day 10; mice were randomly divided into 8 groups (5 animal/group) and were orally gavaged for seven consecutive days as follows: ESC group received deionized water alone, ESC+NAC group received 100 mg/kg BW of NAC, ESC+50ZnO-NPs, ESC+300ZnO-NPs and ESC+500ZnO-NPs groups received doses of ZnO-NPs of 50, 300 and 500 mg/kg BW, respectively. These doses are in consistence with OECD TG 420 guidelines for investigating the oral toxicity of any new substance and according to Tice and Shelby40 toxicity research.40 ESC+50ZnO-NPs+NAC, ESC+300ZnO-NPs+NAC and ESC+500ZnO-NPs+NAC groups received 100 mg/kg BW of NAC followed by ZnO-NPs doses of 50, 300 and 500 mg/kg BW, respectively, in addition to a negative control group that was not induced with tumor and received distilled water only.Tumor size was measured every four days using Vernier caliper, the following formula was used to estimate the tumor volume: Tumor volume (mm3) = Length (mm) × (width (mm))2/2.41 The individual relative tumor volume (RTV) was measured by Vx/V1, where Vx is the volume in mm3 at a given time and V1 at the start of treatment. Tumor growth inhibition (% TGI) was calculated using the equation 100−(T/C×100), where T is the mean RTV of the treated tumor and C is the mean RTV in the control group at the same point time.
Sample collection
On the 8th day, animals were anesthetized using sodium thiopental (0.5%) and were sacrificed by cervical dislocation. The livers, kidneys, right thigh muscles and solid tumor in the left thigh of mice were immediately dissected out and tissues were cut into four parts. One part was homogenized in ice-cold saline (0.9% w/v) using a homogenizer to obtain 20% homogenate. The homogenate was centrifuged at 3,000 rpm for 15 mins at 4ºC, and the resultant supernatant was used for biochemical analysis. The other parts were preserved either in 10% formalin and embedded in paraffin wax blocks for histopathological and immunohistochemical analysis, or in RNA later and stored directly at −80ºC for gene expression analysis, or minced in Hanks buffer then stored directly at −20ºC for comet analysis.
Histopathological examination
For pathological studies, fresh portions of liver, kidney, muscle and ESC from each experimental group were immediately fixed in 10% buffered formalin. They were then embedded in paraffin, sectioned by microtome into 5 µm thickness and stained with hematoxylin and eosin. The stained sections were evaluated by a histopathologist unaware of the treatments using light microscopy (U-IIIMulti-point Sensor System; Nikon, Tokyo, Japan).
Assessment of oxidative stress biomarkers
The previously prepared homogenates from kidney, liver, muscle and ESC muscle were used to measure malondialdehyde (MDA), glutathione-S-transferase (GST)43 and catalase (CAT)44 using Bio-diagnostic assay kits according to the manufacturer’s instructions.
Comet assay
The comet assay was performed as previously described.45 The degree of DNA damage was assessed according to various endpoints. Tail length was used to estimate the extent of DNA damage distant from the nucleus, while % DNA in tail represents the intensity of all tail pixels divided by the total intensity of all pixels in the comet and tail moment=tail length×% DNA in tail/100.
RNA extraction, cDNA synthesis and real-time quantitative PCR (qPCR)
To assess the expression of Bax, Bcl2 and P53 genes, total cellular RNA was extracted from examined muscles of control and treated animals using GeneJET™ RNA purification kit (Thermo Scientific, USA) according to the manufacturer’s protocol and stored at −80ºC. One microgram RNA was reversed transcribed using RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA). The primers were designed using NCBI Primer blast and synthesized by Invitrogen (Carlsbad, CA, USA) (Table 1).
Table 1
Primers sequence’ used in quantitative real-time PCR assays
Genes
Primers
Sequences (5′–3′)
bp
Accession No.
Gapdh
Forward
GTATCGGACGCCTGGTTAC
128 bp
NM_001289726
Reverse
CTTGCCGTGGGTAGAGTCAT
Bax
Forward
GTCTCCGGCGAATTGGAGAT
100 bp
NM_007527.3
Reverse
ACCCGGAAGAAGACCTCTCG
Bcl2
Forward
CATCGCCCTGTGGATGACTG
95 bp
NM_009741.5
Reverse
GGCCATATAGTTCCACAAAGGC
P53
Forward
CCCCTGTCATCTTTTGTCCCT
137 bp
NM_001127233.1
Reverse
AGCTGGCAGAATAGCTTATTGAG
Abbreviation: bp, base pair.
Primers sequence’ used in quantitative real-time PCR assaysAbbreviation: bp, base pair.qPCR was carried out in a 25 µL reaction volume using SYBR green master mix (Maxima SYBR Green/ROX qPCR Master Mix (2x) kit) and was performed in StepOnePlus Real-Time PCR System (Applied Biosystem, Foster City, CA, USA) according to the kit’s manual instructions. PCR program was adjusted as follows: an initial heat activation step at 95ºC for 15 mins followed by 40 cycles of denaturation at 95ºC for 15 s, annealing and elongation at 60ºC for 1 min and samples were analyzed in triplicates for each gene. Expression of the studied genes was normalized to the glyceraldehyde 3-phosphate dehydrogenase (Gapdh) as an internal control gene. Relative gene expression was calculated by the 2−ΔΔCt formula.
Immunohistochemistry
Immunohistochemical examinations of P53 and caspase-3 were performed using streptavidin-biotin method by Histostain-plus kit (Zymed, USA). Paraffin sections of normal and ESC muscle 5 mm thick were dewaxed in xylene and rehydrated through graded alcohols, and then antigens were retrieved by heating in Tris–EDTA buffer. Non-specific binding was blocked by 10% non-immune serum, and then tissues were incubated for 2 hrs in primary antibody diluted 1:50 with TBS. For negative control; tissues were incubated with TBS without primary antibody. The endogenous peroxidase activity of tissues was blocked with 3% hydrogen peroxide for 10 mins (BioGenex, San Ramon, CA, USA). For visualization; tissues were incubated with 100 mL horseradish peroxidase (HRP) labeled rabbit or mouse secondary antibody and then DAB chromogen was added. For counterstaining, sections were stained with hematoxylin, then dehydrated and mounted. Sections were examined using light microscope (Zeiss) to evaluate P53 and caspase-3 immuno-staining.
Statistical analysis
Results were analyzed using Statistical Package of the Social Sciences (SPSS 23). Multi-way analysis of variance (MANOVA) was chosen to study the effect of the protection (with and without NAC), different ZnO-NPs doses (0, 50, 300 and 500 mg/kg BW), tissue type (liver, kidney, muscle and muscle with ESC), experimental time (1, 4, 8 days) and their interactions on all the studied parameters. One-way ANOVA was conducted to study the effect of protection, ZnO-NPs doses on the expression level of P53, Bax and Bcl2 in ESC muscle. Bonferroni’s test was conducted to compare between the studied groups. Regression analysis and correlation coefficient analysis were applied to study the relationships between the studied variables. Data were expressed as a mean±standard error of mean (SEM).
Results
ZnO-NPs characterization
ZnO-NPs measured with transmission electron microscope (TEM) showed an average particle size=40 nm, majority of the particles comprised rod and polygonal shapes (rod NPs average width and length were 34 nm and 90 nm, respectively) with smooth surface (Figure 1A). The crystal structure of the ZnO-NPs was characterized by XRD with Cu Kα radiation (λ=0.15418 nm). X-ray diffraction (XRD) pattern of the ZnO-NPs indicated that the samples comprised crystalline wurtzite structure and no characteristic impurity peaks were identified, suggesting a high quality of the ZnO-NPs (Figure 1B). Zeta potential of ZnO-NPs was +19.6 mV and zeta deviation=3.42 mV (Figure 1D). The hydrodynamic diameter of 100% ZnO-NPs was 242 d.nm and with pdl value 0.34 as determined by the dynamic light scattering (DLS) (Figure 1C).
Figure 1
Characterization of ZnO-NPs (A) A representative micrograph of ZnO-NPs using TEM showing average particle size=40 nm, (B) XRD pattern of ZnO nanopowder showed peaks at 2θ=31.67°, 34.31°, 36.14°, 47.40°, 56.52°, 62.73°, 66.28°, 67.91°, 69.03° and 72.48°, (C) zeta potential of ZnO-NPs, (D) the hydrodynamic diameter of 100% ZnO-NPs using DLS.
Abbreviations: TEM, transmission electron microscope; XRD, X-ray diffraction; DLS, dynamic light scattering; ZnO-NPs, zinc oxide nanoparticles.
Characterization of ZnO-NPs (A) A representative micrograph of ZnO-NPs using TEM showing average particle size=40 nm, (B) XRD pattern of ZnO nanopowder showed peaks at 2θ=31.67°, 34.31°, 36.14°, 47.40°, 56.52°, 62.73°, 66.28°, 67.91°, 69.03° and 72.48°, (C) zeta potential of ZnO-NPs, (D) the hydrodynamic diameter of 100% ZnO-NPs using DLS.Abbreviations: TEM, transmission electron microscope; XRD, X-ray diffraction; DLS, dynamic light scattering; ZnO-NPs, zinc oxide nanoparticles.
ZnO-NPs biodistribution
ZnO nanoparticles biodistribution was estimated by ICP MS in normal and treated groups. Measurements per gram of dry weight of triplet samples are presented as mean±SEM (Table 2). Zn level (µg/g) in different studied tissues significantly (P<0.05) increased in a dose-dependent manner compared to the untreated ESC group. ESC given dose 500 mg/kg ZnO-NPs alone have the highest Zn level (22.86±1.19) compared with the other examined tissues in different treated groups. No significant difference (P>0.05) was observed between groups treated with ZnO-NPs alone and those treated with NAC and ZnO-NPs.
Table 2
Levels of Zn (µg/g) in muscle, liver and kidney of mice treated with different doses of ZnO-NPs (50, 300 and 500 mg/kg) with or without NAC pretreatment
Group
Muscle
Kidney
Liver
ESC
6.41±0.30*a
8.58±0.54a
8.81±0.45a
ESC+NAC
6.17±0.19*a
8.30±0.18a
9.22±0.39a
ESC+50 ZnO-NPS
12.02±0.57b
15.31±0.92*b
12.59±0.70b
ESC+50 ZnO-NPs+NAC
9.96±0.59*b
14.77±0.44b
13.01±1.21b
ESC+300 ZnO-NPs
16.17±0.48c
16.83±0.50bc
14.05±0.83b
ESC+300 ZnO-NPs+NAC
16.46±0.71c
16.90±1.13bc
14.54±1.39b
ESC+500 ZnO-NPs
22.86±1.19*d
17.96±0.74c
15.67±1.53b
ESC+500 ZnO-NPs+NAC
20.39±0.64*d
17.65±0.53*c
15.14±0.92*b
Notes: The data are presented as mean±SEM (n=5), *(P<0.05) significantly different from other tissues in the same group. In different groups, at the same tissue, doses marked with the same letters are not significantly different (P>0.05), whereas those with different letters are significantly different (P<0.05).
Levels of Zn (µg/g) in muscle, liver and kidney of mice treated with different doses of ZnO-NPs (50, 300 and 500 mg/kg) with or without NAC pretreatmentNotes: The data are presented as mean±SEM (n=5), *(P<0.05) significantly different from other tissues in the same group. In different groups, at the same tissue, doses marked with the same letters are not significantly different (P>0.05), whereas those with different letters are significantly different (P<0.05).Abbreviations: ESC, Ehrlich solid carcinoma; NAC, N-acetyle-L-cysteine; ZnO-NPs, zinc oxide nanoparticles.
ZnO-NPs reduced the solid tumor size
The antitumor activity was estimated every four days using Vernier caliper. The average tumor volume was 329±24.4 mm3 after 10 days of inoculation. After oral administration of ZnO-NPs, the rate of tumor growth was inhibited by 31.5% and 46% at dose 300 and 500 mg/kg ZnO-NPs, respectively. The tumor volume (TV in mm3) and relative tumor volume (RTV) significantly (P<0.05) reduced in all ZnO-NPs treated groups compared to untreated ESC group, and no significant (P>0.05) difference was observed in TV and RTV between groups treated with ZnO-NPs alone and those treated with NAC and ZnO-NPs (Figure 2).
Figure 2
Effects of different ZnO-NPs doses on TV in mm3 and RTV in ESC bearing mice on the 4th and 8th day in different treated groups. The data represent the mean±SE (n=5).
Effects of different ZnO-NPs doses on TV in mm3 and RTV in ESC bearing mice on the 4th and 8th day in different treated groups. The data represent the mean±SE (n=5).Abbreviations: TV, tumor volume; RTV, relative tumor volume; ESC, ehrlich solid carcinoma; SE; standard error; ZnO-NPs, zinc oxide nanoparticles; NAC, N-acetyl cysteine.Microscopic examination of skeletal muscles stained with H&E showed no histopathological alteration in normal muscle bundles, while ESC of untreated control showed necrosis of muscles and masses of chromatophilic tumor cells between the necrotic muscles and intact anaplastic area. ZnO-NPs treated groups showed masses of necrotic tumor cells surrounded by granulation tissue. The incidence of tumor necrosis increased with ZnO-NPs treatment (Figure 3).
Figure 3
Representative photomicrographs of thigh skeletal muscle tissues of ESC mice treated with different doses of ZnO-NPs (50, 300 and 500 mg/kg) with and without NAC (100 mg/kg) pretreatment. Normal muscle group (NML), (A) ESC group showing necrosis of muscles and masses of chromatophilic tumor cells between the necrotic muscles, (B) ESC+NAC group showing necrosis of chromatophilic tumor cells surrounded by granulation tissue, (C) ESC+50 ZnO-NPs group showing masses of chromatophilic tumor cells between the necrotic muscles, (D) ESC+50 ZnO-NPs+NAC group showing masses of necrotic tumor cells in between necrotic muscle bundles, (E) ESC+300 ZnO-NPs group showing masses of necrotic tumor cells. (F) ESC+300 ZnO-NPs+NAC group showing masses of tumor cells in between muscle bundles, (G) ESC+500 ZnO-NPs group showing masses of chromatophilic tumor cells and giant cells. (H) ESC+500 ZnO-NPs group showing masses of necrotic tumor cells in between muscle bundles (H and E × 100).
Representative photomicrographs of thigh skeletal muscle tissues of ESC mice treated with different doses of ZnO-NPs (50, 300 and 500 mg/kg) with and without NAC (100 mg/kg) pretreatment. Normal muscle group (NML), (A) ESC group showing necrosis of muscles and masses of chromatophilic tumor cells between the necrotic muscles, (B) ESC+NAC group showing necrosis of chromatophilic tumor cells surrounded by granulation tissue, (C) ESC+50 ZnO-NPs group showing masses of chromatophilic tumor cells between the necrotic muscles, (D) ESC+50 ZnO-NPs+NAC group showing masses of necrotic tumor cells in between necrotic muscle bundles, (E) ESC+300 ZnO-NPs group showing masses of necrotic tumor cells. (F) ESC+300 ZnO-NPs+NAC group showing masses of tumor cells in between muscle bundles, (G) ESC+500 ZnO-NPs group showing masses of chromatophilic tumor cells and giant cells. (H) ESC+500 ZnO-NPs group showing masses of necrotic tumor cells in between muscle bundles (H and E × 100).Regarding kidney tissues in normal untreated control and in ESC bearing mice groups untreated or treated with NAC, they showed normal histological structure of renal parenchyma and no histopathological alteration, while in ZnO-NPs treated groups, there were many vacuolations of renal tubular epithelium and protein cast in Bowman’s space and mononuclear inflammatory cells infiltration. On the other hand, groups of ZnO-NPs pre-treated with NAC showed no histopathological changes at dose 300 mg/kg, while at dose 500 mg/kg, vacuolation of renal epithelia and renal cast in the lumen of renal tubules could be detected (Figure 4).
Figure 4
Representative photomicrographs of kidney tissues of mice treated with different doses of ZnO-NPs (50, 300 and 500 mg/kg) with and without NAC (100 mg/kg) pretreatment. (NK) normal kidney group showing no histopathological change, (A) ESC group showing normal histological structure of renal parenchyma, (B) ESC+NAC group showing the normal histological structure of renal parenchyma, (C) ESC+50 ZnO-NPs group showing vacuolation of renal tubular epithelium (black arrow) and presence of protein cast in Bowman’s space (red arrow), (D) ESC+50 ZnO-NPs+NAC group showing vacuolation of epithelial lining renal tubules and hyalinosis of glomerular tuft (E) ESC+300 ZnO-NPs group showing slight congestion of glomerular tufts glomerular tuft, (F) ESC+300ZnO-NPs+NAC group showing no histopathological changes, (G) ESC+500ZnO-NPs group showing focal interstitial mononuclear inflammatory cells infiltration, (H) ESC+500 ZnO-NPs+NAC group showing vacuolation of epithelial lining renal tubules (head arrow) and renal cast in the lumen of renal tubules (H and E × 400).
Representative photomicrographs of kidney tissues of mice treated with different doses of ZnO-NPs (50, 300 and 500 mg/kg) with and without NAC (100 mg/kg) pretreatment. (NK) normal kidney group showing no histopathological change, (A) ESC group showing normal histological structure of renal parenchyma, (B) ESC+NAC group showing the normal histological structure of renal parenchyma, (C) ESC+50 ZnO-NPs group showing vacuolation of renal tubular epithelium (black arrow) and presence of protein cast in Bowman’s space (red arrow), (D) ESC+50 ZnO-NPs+NAC group showing vacuolation of epithelial lining renal tubules and hyalinosis of glomerular tuft (E) ESC+300 ZnO-NPs group showing slight congestion of glomerular tufts glomerular tuft, (F) ESC+300ZnO-NPs+NAC group showing no histopathological changes, (G) ESC+500ZnO-NPs group showing focal interstitial mononuclear inflammatory cells infiltration, (H) ESC+500 ZnO-NPs+NAC group showing vacuolation of epithelial lining renal tubules (head arrow) and renal cast in the lumen of renal tubules (H and E × 400).Abbreviations: ESC, Ehrlich solid carcinoma; NAC, N-acetyl cysteine; ZnO-NPs, zinc oxide nanoparticles.Microscopic examination of liver stained with H&E in normal untreated control showed normal histological structure of the central vein and surrounding hepatocytes. ZnO-NPs treated group illustrated vacuolar degeneration of hepatocytes and massive mononuclear inflammatory cells infiltration in the portal triad at 300 and 500 mg/kg, respectively. On the other hand, groups of ZnO-NPs pre-treated with NAC showed no histopathological lesions at dose 50 mg/kg, while at dose 300 and 500 mg/kg showed degeneration of hepatocytes and congestion of hepatoportal blood vessel (Figure 5).
Figure 5
Representative photomicrographs of liver tissues of mice treated with different doses of ZnO-NPs (50, 300 and 500 mg/kg) with and without pretreatment with NAC (100 mg/kg). (NL) normal liver group showing no histopathological change (A) ESC group showing hydropic degeneration of hepatocytes, (B) ESC+NAC group showing hydropic degeneration of hepatocytes, (C) ESC+50 ZnO-NPs group showing hydropic degeneration of hepatocytes, (D) ESC+50 ZnO-NPs+NAC group showing Kupffer cells activation, (E) ESC+300 ZnO-NPs group showing vacuolar degeneration of hepatocytes, (F) ESC+300 ZnO-NPs+NAC group showing vacuolar degeneration of hepatocytes, (G) ESC+500 ZnO-NPs group showing massive mononuclear inflammatory cells infiltration in the portal triad, (H) ESC+500 ZnO-NPs+NAC group showing vacuolar degeneration of hepatocytes and congestion of hepatoportal blood vessel (H and E × 400).
Representative photomicrographs of liver tissues of mice treated with different doses of ZnO-NPs (50, 300 and 500 mg/kg) with and without pretreatment with NAC (100 mg/kg). (NL) normal liver group showing no histopathological change (A) ESC group showing hydropic degeneration of hepatocytes, (B) ESC+NAC group showing hydropic degeneration of hepatocytes, (C) ESC+50 ZnO-NPs group showing hydropic degeneration of hepatocytes, (D) ESC+50 ZnO-NPs+NAC group showing Kupffer cells activation, (E) ESC+300 ZnO-NPs group showing vacuolar degeneration of hepatocytes, (F) ESC+300 ZnO-NPs+NAC group showing vacuolar degeneration of hepatocytes, (G) ESC+500 ZnO-NPs group showing massive mononuclear inflammatory cells infiltration in the portal triad, (H) ESC+500 ZnO-NPs+NAC group showing vacuolar degeneration of hepatocytes and congestion of hepatoportal blood vessel (H and E × 400).Abbreviations: ESC, Ehrlich solid carcinoma; NAC, N-acetyl cysteine; ZnO-NPs, zinc oxide nanoparticles.
ZnO-NPs induced oxidative stress and DNA damage
MDA is the most representative product of lipid peroxidation, and its concentration can indicate the rate and intensity of lipid peroxidation within the body. The current study revealed a significant elevation in MDA level (nmol/gm) and marked reduction in GST and CAT activity (P<0.05) in ZnO-NPs treated groups compared to untreated ESC group in all examined tissues. pretreatment with NAC showed no significant difference (P>0.05) in all oxidative parameters in ESC, while a significant decrease (P<0.05) in the MDA level and a significant increase (P<0.05) in the activity of both CAT and GST were recorded in the liver and kidney of all treated groups, and that indicated the protective effect of NAC against ZnO-NPs oxidative stress without affecting ZnO-NPs antitumor activity (Figure 6).
Figure 6
Effects of ZnO-NPs on oxidative stress biomarkers in different treated groups. (A) MDA content (nmol/g tissue), (B) GST activity (mg/g tissue) and (C) CAT activity (U/g tissue). The data are presented as mean±SE (n=5). *Significant difference (P<0.05).
Effects of ZnO-NPs on oxidative stress biomarkers in different treated groups. (A) MDA content (nmol/g tissue), (B) GST activity (mg/g tissue) and (C) CAT activity (U/g tissue). The data are presented as mean±SE (n=5). *Significant difference (P<0.05).Abbreviations: MDA, malondialdehyde; CAT, catalase; GST, glutathione-s-transferase; ESC, Ehrlich solid carcinoma; NAC, N-acetyl cysteine; ZnO-NPs, zinc oxide nanoparticles.All examined tissues in ZnO-NPs treated groups showed statistically significant increase (P<0.05) of all DNA damage parameters (tail length, % DNA in tail and tail moment) in a dose-dependent manner compared to the untreated ESC group, and 500 mg/kg represent the highest effective (P<0.05) dose compared to the other doses. Pretreatment with NAC in ESC revealed no significant difference, while it showed a significant reduction (P<0.05) in all DNA damage parameters compared to ZnO-NPs alone in liver and kidney (Figures 7 and 8).
Figure 7
Effects of ZnO-NPs on DNA damage parameters in all treated groups. (A) tail length (TL) in µm, (B) % of DNA damage and (C) tail moment (TM). The data represent the mean±SE (n=5). *Significant difference (P<0.05).
Figure 8
Representative fluorescent microscope photomicrographs demonstrating the extent of DNA damage assessed by alkaline comet assay in muscle with ESC, liver and kidney cells of tumor-bearing mice.
Effects of ZnO-NPs on DNA damage parameters in all treated groups. (A) tail length (TL) in µm, (B) % of DNA damage and (C) tail moment (TM). The data represent the mean±SE (n=5). *Significant difference (P<0.05).Abbreviations: ESC, Ehrlich solid carcinoma; NAC, N-acetyl cysteine; ZnO-NPs, zinc oxide nanoparticles.Representative fluorescent microscope photomicrographs demonstrating the extent of DNA damage assessed by alkaline comet assay in muscle with ESC, liver and kidney cells of tumor-bearing mice.Abbreviation: ESC, Ehrlich solid carcinoma.
ZnO-NPs altered the expression levels of some apoptotic genes in ESC
Results showed that ZnO-NPs significantly altered the expression levels of mRNA of P53, Bax and Bcl2 genes in ESC. The mRNA expression level of tumor suppressor gene P53 and pro-apoptotic gene Bax was significantly upregulated (P<0.05), while the expression of anti-apoptotic gene Bcl2 was significantly downregulated (P<0.05) in ZnO-NPs treated groups as compared with the untreated ESC group. In addition, the fold change of P53 and Bax genes was significantly higher (P<0.05) in the normal muscle compared to untreated ESC group. No significant difference was found between ZnO-NPs groups and ZnO-NPs groups pre-treated with NAC (Figure 9).
Figure 9
The relative mRNA expression of apoptosis-related genes (P53, Bax and Bcl2) in all treated groups determined by q-PCR. Data expressed relative to the housekeeping gene Gapdh, normalized to the control group. The data represent the mean±SE (n=5). *Significant difference (P<0.05).
The relative mRNA expression of apoptosis-related genes (P53, Bax and Bcl2) in all treated groups determined by q-PCR. Data expressed relative to the housekeeping gene Gapdh, normalized to the control group. The data represent the mean±SE (n=5). *Significant difference (P<0.05).Abbreviations: ESC, Ehrlich solid carcinoma; NAC, N-acetyl cysteine; ZnO-NPs, zinc oxide nanoparticles.Moreover, the expression of P53 and caspase-3 proteins was assessed in the muscle of all treated groups by immunohistochemistry and showed an elevation in the expression of P53 and caspase-3 proteins, where ESC of mice treated with 500 mg/kg of ZnO-NPs showed the highest expression level of P53 and caspase-3 proteins (Figures 10 and 11).
Figure 10
Photomicrographs representing immunohistochemistry staining of P53 expression in ESC muscle sections and showing (A) negative staining of P53 in ESC of untreated ESC group. (B) negative staining of P53 in ESC+NAC group. (C and D) ZnO-NPs (50 mg/kg) alone or combined with NAC, respectively, with moderate P53 expression. (E and F) ZnO-NPs (300 mg/kg) alone or combined with NAC, respectively, with an increase in P53 expression while groups (G and H) ZnO-NPs (500 mg/kg) alone or combined with NAC, respectively, with the highest level of P53 expression; 400× magnification.
Figure 11
Photomicrographs represent immunohistochemistry staining of caspase-3 expression in ESC muscle sections showing (A) Negative staining of caspase-3 in ESC of untreated ESC group. (B) Negative staining of caspase-3 in ESC+NAC group. (C and D) ZnO-NPs (50 mg/kg) alone or combined with NAC, respectively, with moderate caspase-3 expression. (E and F) ZnO-NPs (300 mg/kg) alone or combined with NAC, respectively, show an increase in caspase-3 expression while groups. (G and H) ZnO-NPs (500 mg/kg) alone or combined with NAC, respectively, with the highest level of caspase-3 expression; 400× magnification.
Photomicrographs representing immunohistochemistry staining of P53 expression in ESC muscle sections and showing (A) negative staining of P53 in ESC of untreated ESC group. (B) negative staining of P53 in ESC+NAC group. (C and D) ZnO-NPs (50 mg/kg) alone or combined with NAC, respectively, with moderate P53 expression. (E and F) ZnO-NPs (300 mg/kg) alone or combined with NAC, respectively, with an increase in P53 expression while groups (G and H) ZnO-NPs (500 mg/kg) alone or combined with NAC, respectively, with the highest level of P53 expression; 400× magnification.Abbreviations: ESC, Ehrlich solid carcinoma; NAC, N-acetyl cysteine; ZnO-NPs, zinc oxide nanoparticles.Photomicrographs represent immunohistochemistry staining of caspase-3 expression in ESC muscle sections showing (A) Negative staining of caspase-3 in ESC of untreated ESC group. (B) Negative staining of caspase-3 in ESC+NAC group. (C and D) ZnO-NPs (50 mg/kg) alone or combined with NAC, respectively, with moderate caspase-3 expression. (E and F) ZnO-NPs (300 mg/kg) alone or combined with NAC, respectively, show an increase in caspase-3 expression while groups. (G and H) ZnO-NPs (500 mg/kg) alone or combined with NAC, respectively, with the highest level of caspase-3 expression; 400× magnification.Abbreviations: ESC, Ehrlich solid carcinoma; NAC, N-acetyl cysteine; ZnO-NPs, zinc oxide nanoparticles.
Discussion
ZnO nanoparticles manifested a promising cytotoxic effect against several cancer cell types; like PC-3, HCT116, A549 and MDA-MB-231.46 Despite the amazing anticancer activity of ZnO-NPs in different cancer cell types, there are very limited studies performed in vivo . The current study was designed to evaluate the antitumor activity of ZnO-NPs in ESC bearing mice after oral administration of ZnO-NPs different doses (50, 300 and 500 mg/kg) and to investigate their potential toxicity in normal tissues, such as liver and kidney as being the target sites of ZnO-NPs.19 In addition, we investigated the ameliorative or the potentiation effect of NAC against ZnO-NPs genotoxicity in healthy and cancerous cells in ESC bearing mice.In our study, ZnO-NPs were found to be biodistributed in the different tissues under investigation in a dose-dependent manner, Zn level was higher in ESC than in liver and kidney and this could be attributed to the electrostatic characteristics of ZnO nanoparticles, where ZnO-NPs have neutral hydroxyl groups attached to their surface that play a critical role in their surface charge. At physiological pH conditions, the isoelectric point of ZnO-NPs equals 9–10;47,48 therefore, ZnO-NPs will have a strong positive surface charge under these conditions. Cancer cells have a high concentration of anionic phospholipids on their outer membrane.49,50 Consequently, ZnO-NPs could be driven by the electrostatic attraction towards the cancer environment promoting cellular uptake causing higher level of Zn in the tumor tissue compared to the other healthy tissues.Previous studies revealed that ZnO-NPs exert some antitumor activity, where induction of ROS and depletion in antioxidant system is considered as one of the mechanistic pathways of ZnO-NPs to persuade cancer cell death,51,52 as the increase of ROS level leads to decrease in the level of antioxidative enzymes in the cells and eventually results in an oxidative damage to the cells and tissues.53 Our data indicated that ZnO-NPs treatment increased the level of MAD, the most representative product of lipid peroxidation, and caused depletion in the antioxidant enzymes such as GST and CAT in all examined tissues (ESC, liver and kidney) compared to untreated ESC group. This is in harmony with the previous studies which indicated that ZnO-NPs were able to increase 8-oxodG level and ROS production in Caco-2 cells and embryonic kidney cells.54,55It was reported that oxidative stress occurs due to disturbance in the balance between ROS production and depletion in the antioxidant defense mechanism.56 ROS, such as H2O2, •OH and •O2‾, may spontaneously react with nucleophilic centers in the cell, and thereby covalently bind to nucleic acid, RNA and proteins and result in a single strand break, a double strand break and DNA adduct formation and therefore can induce DNA damage.57 ZnO-NPs have been reported to induce ROS generation, oxidative DNA damage and upregulate apoptosis in HepG2 cells, cervical carcinoma cells, colon adenorectal carcinoma cells and nasal mucosa cells.58–62 Moreover, Caco-2 cells exposed to ZnO-NPs were not able to repair the oxidative DNA damage that was efficiently repaired after TiO2-NPs treatment, which indicated that the high oxidant environment caused by ZnO-NPs can induce DNA damage and affect the repair pathways.55 In accordance, we reported a significant increase in the DNA damage parameters in all examined tissues especially in ESC and the inability of NAC to reverse the action in the solid carcinoma. This DNA damage could be one of the most significant reasons of cancer cell death and tumor growth inhibition in ZnO-NPs treated groups.In the presence of DNA damage or cellular stress, P53 triggers cell-cycle arrest to provide time for the damage to be repaired or for self-mediated apoptosis.15 This is in consistence with the present data that showed upregulation in the expression level of both tumor suppressor gene P53 and pro-apoptotic gene Bax and downregulation in the expression level of anti-apoptotic gene Bcl2 in ESC of ZnO-NPs treated mice. Similarly, a previous in vitro study asserted an increase in the expression level of P53 and Bax genes after treatment with ZnO-NPs.63 Upregulation of both P53 and Bax genes and downregulation of Bcl2 gene after ZnO-NPs treatment indicated the induction of apoptosis in ESC that could be the pathway of tumor cells destruction. These data were in accordance with some recent studies that proved the anticancer activity of ZnO-NPs against A549, MCF-7 and MDA-MB-231 cell line64,65 and loss of cell viability, cytotoxicity and apoptotic induction in different types of breast cancer cells like MDA-MB-231and MCF-7 cells.66Taken together, ZnO-NPs treatment led to overproduction of ROS, depletion in the antioxidant system, DNA damage and induction of apoptosis. All these events led to tumor cell death and tumor volume reduction, indicated by the significant reduction in the tumor volume of ESC in left thigh of the mice that appeared at doses 300 and 500 mg/kg of ZnO-NPs, with tumor growth inhibition 31.5% and 46% in both doses, respectively. Moreover, the histopathological examination of tumor tissue agreed with the previously illustrated data, where ZnO-NPs treatment led to masses of necrotic tumor cells surrounded by granulation tissue.In addition, pretreatment with NAC had no significant effect, neither on the tumor volume reduction nor on the antitumor efficacy of ZnO-NPs. Similarly, a previous study illustrated that NAC had no effect on the antitumor activity of ifosfamide.67,68 This might be due to the disruption of the ROS scavenging system in the tumor tissue as indicated by the significant reduction of antioxidant enzymes levels, so the elevation of ROS cannot be compensated through the action of NAC alone. In addition, our study indicated that ZnO-NPs could induce apoptosis via Bax, Bcl2 and P53 signaling pathway, which may act as another alternative way for killing tumor cell that does not depend on the ROS production.69On the other hand, the toxicity of ZnO-NPs in the liver and kidney could be detected clearly through the histopathological examination that revealed vacuolation of renal tubular epithelium and inflammatory cells infiltration and vacuolar degeneration of hepatocytes. In the same context, a previous study revealed that two weeks inhalation to occupational relevant level of ZnO-NPs led to renal inflammation through lymphocytic infiltration.70 Also, the study conducted by Esmaeillou et al71 has illustrated the swelling of the proximal tubular epithelial cells, hydropic degeneration and necrosis of tubular epithelial cells in mice exposed to ZnO-NPs through oral gavage.71However, these histopathological lesions in different tissues other than solid carcinoma were eliminated and reduced in ZnO-NPs groups pretreated with NAC. This might be due to the antioxidant properties of NAC that increased GSH levels to support the antioxidant system during inflammation, stress and exposure to toxins.22–24 In addition, previous studies illustrated that NAC was capable to prevent nephrotoxicity induced by ifosfamide without affecting the antitumor efficacy of ifosfamide,68 through decreasing lipid peroxides and increasing glutathione-S-transferase and repairing morphological damage in renal tubules and glomeruli of rat.72 Moreover, pretreatment with (100 mg/kg) of NAC repaired the oxidative DNA damage induced by (500 mg/kg) of ZnO-NPs in mice, which may be contributed to the effective role of NAC in reducing the ROS production as previously indicated in rat astrocytes25–27,73Although NAC had no significant effect on the antitumor activity of ZnO-NPs in ESC in our study, another study illustrated an anticancer activity of NAC, where it inhibited the DNA synthesis in human astrocytoma cells.74 In addition, NAC was able to inhibit abnormal cell cycle progression in human lymphoma cells and induce cell cycle arrest in murinepapilloma cells.75,76 Despite several evidence establishing anti-apoptotic effects of NAC that protects normal cells against cytotoxic stimuli, there are reports arguing for a pro-apoptotic effect of NAC. Liu et al76 and Havre et al77 reported that NAC selectively was capable of inducing apoptosis via p53 mediated pathway in several oncogenically transformed fibroblasts, but not in normal cells.76,77 This is disagreeing with our data as NAC exerted no significant effect on P53 gene expression in ESC. Moreover, a recent study demonstrated that NAC can act as a chemo-protectant without decreasing the antitumor efficacy of cisplatin in pediatric tumor models.38 These controversial data regarding NAC raise an urging need to investigate its mechanism of action in vivo.
Conclusion
Several studies demonstrated antitumor activity of ZnO-NPs in numerous cell lines but lacked in vivo evaluation. Our study revealed that ZnO-NPs possess a strong inhibition effect against cancerous tissue in mice by inducing severe oxidative stress, DNA damage and induction of apoptosis via P53-mediated pathway. Moreover, pretreatment with NAC provided a chemo-protection for the healthy normal tissues (liver and kidney) without decreasing the antitumor efficacy of ZnO-NPs in ESC bearing mice. Therefore, new cancer therapeutic strategies including ZnO-NPs combined with NAC could be developed.
Authors: Marta d'Amora; Tiziana Julia Nadjeschda Schmidt; Soultana Konstantinidou; Vittoria Raffa; Francesco De Angelis; Francesco Tantussi Journal: Oxid Med Cell Longev Date: 2022-02-04 Impact factor: 6.543
Authors: Amr Ahmed WalyEldeen; Haidan M El-Shorbagy; Hamdi M Hassaneen; Ismail A Abdelhamid; Salwa Sabet; Sherif Abdelaziz Ibrahim Journal: Naunyn Schmiedebergs Arch Pharmacol Date: 2022-07-26 Impact factor: 3.195