Literature DB >> 31200713

Interactions between genetic variants involved in the folate metabolic pathway and serum lipid, homocysteine levels on the risk of recurrent spontaneous abortion.

Zhong Lin1, Qianxi Li2, Yifan Sun3, Jingchun Huang4, Wan Wang4, Jinjian Fu5, Jianhua Xu6,7, Dingyuan Zeng8.   

Abstract

BACKGROUND: The interaction between folate pathway gene polymorphisms and homocysteine, serum lipid leverls are poorly understood in patients with recurrent spontaneous abortion (RSA). The aim of this study is to explore the effects of folate pathway gene polymorphisms (the 5-10-methylenetetrahydrofolate reductase, MTHTR C677T, MTHFR A1298C and the methionine synthase reductase, MTRR A66G) and their interactions with homocysteine on serum lipid levels in patients with RSA.
METHODS: A total of 403 RSA women and 342 healthy women were randomly selected. Genotyping of the MTHFR C677T, A1298C and MTRR A66G were performed by TaqMan-MGB technique. Serum homocysteine, folate, fasting glucose, fasting insulin, Interleukin 6, Tumor necrosis factorα (TNFα) and lipid profiles were measured according to the kits. Continuous variables were analyzed using 2-sample t-tests. Categorical variables were analyzed and compared by χ2 or Fisher's exact tests. Unconditional logistic regression model was applied to test the interactions of gene polymorphisms on RSA.
RESULTS: The distribution of genotype of CC, CT TT and T allele of MTHFR C677T, genotype of AA and C allele of MTHFR A1298C, and genotype of AA, AG and G allele of MTRR A66G were different between cases and controls (all p were < 0.05). There were significant interactions between MTHFR C677T-A1298C and MTHFR A1298C-MTRR A66G in RSA group and control group, with ORs of 1.62 (95%CI: 1.28-2.04, p < 0.001) and 1.55 (95%CI: 1.27-1.88, p < 0.001), respectively. Serum TNFα level and insulin resistant status (HOMR-IR) were higher in RSA group than in control group (p = 0.038, 0.001, respectively). All the three gene SNPs except MTRR 66AG gene variant had detrimental effects on HOMA-IR (all p were < 0.05). RSA group who carried the MTHFR 677CT, TT, CT/TT genotypes and MTRR 66AG, AG/GG genotypes had detrimental effects on serum homocysteine levels, the MTHFR 677CT, CT/TT genotype carriers had favorable effects on serum folate levels, the MTHFR 677TT, CT/TT, 1298 AC, AC/CC genotype carriers had detrimental effects on serum low-density lipoprotein cholesterol (LDL-C) levels, and the MTRR 66AG genotype carriers had lower high-density lipoprotein cholesterol (HDL-C) levels than the AA genotype carriers (all p were < 0.05).
CONCLUSIONS: Interaction between the MTHFR C677T, A1298C and MTHFR A1298C, MTRR A66G are observed in our RSA group. Besides, all the three gene SNPs except MTRR 66AG gene variant had detrimental effects on HOMA-IR. MTHFR C677T and MTRR A66G gene variants had detrimental effects on serum homocysteine levels and insulin resistance status, while MTHFR C677T, A1298C and MTRR A66G gene variants had detrimental effects on certain serum lipid profiles.

Entities:  

Keywords:  Homocysteine; Lipid profiles; MTHFR A1298C; MTHFR C677T; MTRR A66G; Recurrent spontaneous abortion

Mesh:

Substances:

Year:  2019        PMID: 31200713      PMCID: PMC6570969          DOI: 10.1186/s12944-019-1083-7

Source DB:  PubMed          Journal:  Lipids Health Dis        ISSN: 1476-511X            Impact factor:   3.876


Background

Recurrent spontaneous abortion (RSA) is a common health problem, defined as the loss of two or more consecutive pregnancies before 20 weeks of gestation which is challenging for both the patients and obstetricians [1]. RSA is a complex multi-factorial disorder and caused very often by genetic disorders, uterine pathologies, endocrine dysfunctions, autoimmune diseases, and environmental factors [1]. Dyslipidemia has been postulated as association with adverse pregnancy outcome, including RSA [2]. Dyslipidemia, as mainly defined by increased serum total cholesterol (TC) and low density lipoprotein cholesterol (LDL-C) levels, serving as a crucial risk factor for some medical diseases such as cardiovascular diseases, diabetes and insulin resistance, has become a serious public health problem worldwide because of its high prevalence [3-5]. It was reported that the prevalence of dyslipidemia among Chinese adults increases yearly and the prevalence of dyslipidemia was 52.72% among adults in northwestern China in 2010 [6]. The etiology of dyslipidemia is complicated, both genetic and environmental factors as well as their interactions are considered to be the contributors for the cause of dyslipidemia [7, 8]. The 5–10-methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C and methionine synthase reductase (MTRR) A66G gene, may contribute to the risk of the development of hyperhomocysteinemia and are now believed to be good candidate for susceptibility to dyslipidemia and insulin resistance [9, 10]. Numerous epidemiological studies revealed that high homocysteine levels have been suggested to be associated with changing serum lipid levels. Recent attention has focused on certain gene polymorphism and biomarkers interaction that may predispose to an increased risk of severe pregnancy complications, including RSA [11]. Only recently genetic analyses of affected patients was it discovered that C677T, A1298C polymorphisms of MTHFR and A66G of MTRR may represent the important candidates for exploration of the risk of developing disease as their key roles for not only in gene expression but also in modifications of serum lipid and homocystein concentrations [12]. Few studies so far have investigated the effect of homocysteine, insulin resistance, TNFαand lipid levels and the MTHFR, MTRR gene polymorphisms on RSA risk. Mtiraoui et al. [13] have demonstrated that MTHFR gene polymorphisms were associated with progression of recurrent miscarriage through elevations of plasma homocysteine levels. Ikkruthi et al. [14] have revealed that hyperhomocysteinemia was associated with hyperlipoproleinemia. Li et al. [9] identified that MTHFR C677T, A1298C and MTRR A66G gene polymorphisms combined with low folate were the major determinant of plasma lipid levels. In summary, elevated plasma levels of homocysteine may cause RSA and dysregulation of cholesterol and triglyceride biosynthetic pathways, with changed expression by DNA methylation. As a consequence, we hypothesize that the MTHFR and MTRR gene polymorphisms associated with higher levels of homocysteine may be related with different serum lipid levels in the RSA populations. The aim of this study is to explore the interactions of these three gene polymorphisms (MTHFR C677T, MTHFR A1298C and MTRR A66G), homocysteine and serum lipid profiles with RSA in Chinese population.

Methods

Study population

This investigation was carried out as a case–control study conducted between January 1, 2013 and November 12, 2015, in the Gynecology clinic of Liuzhou Maternity and Child Healthcare Hospital. A total of 403 women who had 2 or more consecutive spontaneous abortions were diagnosed as RSA and recruited as case group. Control group consisted of 342 healthy women of reproductive age with at least 1 delivery and no history of abortion. Women who had chromosomal abnormalities, personal or family history of thrombosis, induced abortions, infection or systemic diseases were excluded from this study. A questionnaire detailing age, ethnic, education level, gynecological history, smoking, drinking, X-ray contact, chemical exposure, folate supplement, multivitamin supplement were asked to fill and consent form indicating their acceptance to participate were signed and obtained. This study was approved by the Institutional Review Board at Liuzhou Maternity and Child Healthcare Hospital.

Laboratory tests

EDTA-anticoagulated blood (5 ml sample) and buccal cell samples were obtained from participants and was processed within 30 min of collection for biochemical analysis and genetic analysis, respectively. The levels of triglyceride (TG), TC, high-density lipoprotein cholesterol (HDL-C), LDL-C, total protein, homocysteine and fast glucose in blood samples were measured by enzymatic method on a Hitachi Autoanalyzer (Type 7600; Hitachi Ltd., Tokyo, Japan). The levels of folate, vitamin B12 and fast insulin in blood samples were measured by chemi-luminescence method on a Abbott Autoanalyzer (Type i4000SR; Abbott Ltd., America). The levels of IL6 and TNFα were measured by liquid suspension chip on luminex200 (Austin, Texas, America).

Genotyping

Genomic DNA was extracted from buccal samples using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA). The TaqMan-MGB technique was used for detecting gene polymorphisms of the MTHFR C677T, A1298C and MTRR A66G. The primers and probes were showed in Table 1. Universal reaction conditions in a final volume of 10 μl for each genotyping are as follows: 1 μl of 20 ng/μl DNA, 5 μl of 2 × Taqman Universal Master Mix, 0.5 μl of 20 × TaqMan-MGB assay locus-specific probe, with 3.5 μl of sterile water. All PCR reagents were purchased from ABI Company. The PCR cycling conditions were 1 cycle of 95 °C for 10 min; then 20 cycles of 96 °C for 15 s, 60 °C for 60 s; then 30 cycles of 89 °C for 15 s, 60 °C for 60 s. After PCR amplification, an endpoint plate read was performed using an Applied Biosystems Real-Time PCR System. The Sequence Detection System (SDS) Software uses the fluorescence measurements made during the plate read to plot the fluorescence (Rn) values based on the signals from each well. The plotted fluorescence signals indicate the alleles that are present in each sample. All cycling protocols were performed on a ABI 7900.
Table 1

TaqMan-MGB primers and probes

SNPsPrimersProbes
ForwardReverseForwardReverse
MTHFR C677TGAAAAGCTGCGTGATGATGTTGAAGGAGAAGGTGTCAATCG [G]CTCCCGCAATCG [A]CTCCCGC
MTHFR A1298CAAGAACGAAGACTTCAAATGGGGGGAGGAGCTGACACACTT [G]CTTCACTACACTT [T]CTTCACT
MTRR A66GAGGCAAAGGCCATCGCAATCCATGTACCACAGCTTAAGAAAT [A]TGTGAGAAGAAAT [G]TGTGAG
TaqMan-MGB primers and probes

Statistical analysis

SAS version 9.4 (Cary, NC, USA) was used to perform the statistical analysis. Continuous variables were analyzed using 2-sample t-tests. Categorical variables were analyzed and compared by χ2 or Fisher’s exact tests. For the main effect of gene-gene variants interactions, unconditional logistic regression was conducted to calculate odds ratios (ORs) and their corresponding 95% confidence intervals (CIs). A p-value less than 0.05 was considered indicative of statistical significance.

Results

General characteristics, serum lipid levels and allelic frequencies

Table 2 examined the characteristics, homocysteine, serum lipid levels and allelic frequencies of MTHFR C677T, A1298C and MTRR A66G between the RSA group and healthy group. A χ2 analysis has found that folate supplement was higher in control group than in case group (p = 0.048). HOMA-IR index wes higher in the RSA group than in the control group (p = 0.001). The levels of homocysteine, serum total protein, LDL-C and TNFα were higher in RSA group than in control group (all p were < 0.05), whereas the level of HDL-C was lower in RSA group than in control group (p = 0.018).
Table 2

General characteristics and genotype distribution

VariableCase (n = 403)Control (n = 342) t/χ 2 p
Ethnic0.430.805
 Han198 (49.1)160 (46.8)
 Zhuang178 (44.2)159 (46.5)
 Minority27 (6.7)23 (6.7)
Education level1.200.550
  ≤ 9 years of school157 (39.0)120 (35.1)
 10–12 years of school83 (20.6)74 (21.6)
  ≥ 13 years of school163 (40.4)148 (43.3)
Gynecological surgery history1.090.298
 Yes42 (10.4)28 (8.2)
 No361 (89.6)314 (91.8)
Current smoking0.100.756
 Yes7 (1.7)7 (2.0)
 No396 (98.3)335 (98.0)
Passive smoking history0.0030.960
 Yes89 (22.1)75 (21.9)
 No314 (77.9)267 (78.1)
Drinking history0.040.847
 Yes43 (10.7)38 (11.1)
 No360 (89.3)304 (88.9)
X-ray contact history0.520.596
 Yes1 (0.2)2 (0.6)
 No402 (99.8)340 (99.4)
Chemical exposure history3.410.065
 Yes1 (0.2)5 (1.5)
 No402 (99.8)337 (98.5)
Folic acid supplement3.910.048
 Yes131 (32.5)135 (39.5)
 No272 (67.5)207 (60.5)
Multivitamin supplement1.380.240
 Yes17 (4.2)9 (2.6)
 No386 (95.8)333 (97.4)
Age, year29.58 ± 5.4829.88 ± 5.280.850.673
Folic acid, nmol/L32.45 ± 8.8634.35 ± 18.98−1.790.072
Vitamin B12, pg/ml352.70 ± 124.01347.48 ± 124.100.570.567
Homocysteine, umol/L11.89 ± 4.6211.20 ± 3.402.360.018
Total protein, g/L72.17 ± 6.7970.67 ± 9.472.520.012
Total cholesterol, mmol/L5.43 ± 20.104.42 ± 1.910.920.359
Triglyceride, mmol/L1.06 ± 0.691.03 ± 0.550.620.536
High-density lipoprotein cholesterol, mmol/L1.66 ± 0.381.73 ± 0.38−2.380.018
Low-density lipoprotein cholesterol, mmol/L2.61 ± 0.772.41 ± 0.683.62< 0.001
Fasting glucose, mmol/L4.93 ± 0.384.92 ± 0.190.150.884
Fasting insulin, pmol/L71.13 ± 14.8267.60 ± 13.843.350.001
HOMR-IR2.23 ± 0.452.12 ± 0.413.480.001
IL6, pg/ml75.12 ± 311.2040.58 ± 202.951.820.069
TNFα, pg/ml28.40 ± 92.1618.28 ± 31.022.080.038
MTHFR C677T
 CC213 (52.9)253 (74.0)35.24< 0.001
 CT153 (38.0)78 (22.8)19.87< 0.001
 TT37 (9.2)11 (3.2)10.920.001
 C allele579 (71.8)584 (85.4)
 T allele227 (28.2)100 (14.6)39.62< 0.001
MTHFR A1298C
 AA231 (57.3)221 (64.6)4.130.042
 AC144 (35.7)102 (29.8)2.920.088
 CC28 (6.9)19 (5.6)0.610.436
 A allele606 (75.2)544 (79.5)
 C allele200 (24.8)140 (20.5)3.970.046
MTRR A66G
 AA225 (55.8)226 (66.1)8.140.004
 AG148 (36.7)100 (29.2)4.670.031
 GG30 (7.4)16 (4.7)2.440.118
 A allele598 (74.2)552 (80.7)
 G allele208 (25.8)132 (19.3)8.900.003

HOMA-IR Homeostatic model assessment of insulin resistance, IL6 Interleukin 6, TNFα Tumor necrosis factor α

General characteristics and genotype distribution HOMA-IR Homeostatic model assessment of insulin resistance, IL6 Interleukin 6, TNFα Tumor necrosis factor α The frequency of MTHFR C677T, A1298C and MTRR A66G alleles and genotypes are shown in Table 2. The frequencies of CC, CT and TT genotypes and T allele of C677T were 0.529, 0.380, 0.092 and 0.282 in cases, compared with 0.740, 0.228, 0.032 and 0.146 in controls, respectively (p < 0.001–0.001). The distribution of genotype of AA and C allele of MTHFR A1298C were slightly different between cases and controls (p = 0.042 and 0.046, respectively). The distribution of genotype of AA, AG and G allele of MTRR A66G were different between cases and controls (p = 0.004, 0.0031 and 0.003, respectively). The two-factor gene-gene interaction analyses by logistic regression analysis revealed significant interactions between MTHFR C677T-A1298C and MTHFR A1298C-MTRR A66G in RSA group and control group, with ORs of 1.62 (95%CI: 1.28–2.04, p < 0.001) and 1.55 (95%CI, 1.27–1.88, p < 0.001), respectively (Table 3).
Table 3

Interactions between genetic variants in the folate pathway on the risk of recurrent spontaneous abortion

Gen-gen interactionsBSEWald p OR95%CI
C677T-A1298C0.480.1216.230.0001.621.28–2.04
C677T-A66G0.020.080.070.7991.020.87–1.20
A1298C-A66G0.440.1018.840.0001.551.27–1.88
Interactions between genetic variants in the folate pathway on the risk of recurrent spontaneous abortion

MTHFR C677T genotypes and serum homocysteine, inflammatory factor and lipid levels

Table 4 shows the interaction of MTHFR C677T gene polymorphism with RSA risk on serum homocysteine, inflammatory factor and lipid levels. All the three gene variants had detrimental effects on HOMA-IR (all p were < 0.05). The CT genotype carriers had higher serum homocysteine levels and lower folate levels in the RSA group than that in the control group (p < 0.001 and 0.047, respectively). The RSA group who carrying TT genotype had higher serum homocysteine and LDL-C levels than that in the control group (p = 0.026 and 0.006, respectively). For those RSA group who carried CT/TT genotype, they had higher serum homocysteine and LDL-C levels and lower folate levels than that in the control group (p = 0.003, 0.018 and 0.012, respectively).
Table 4

Interaction of MTHFR C677T polymorphism with recurrent spontaneous abortion on serum folate and lipid levels

VariableCasecontrol t p
CC genotypen = 213n = 253
 Folic acid, nmol/L36.49 ± 6.4735.29 ± 21.530.780.434
 Vitamin B12, pg/ml347.23 ± 114.82346.84 ± 124.510.030.976
 Homocysteine, umol/L10.33 ± 4.3410.83 ± 3.38−1.390.165
 Total protein, g/L72.87 ± 4.7870.69 ± 9.992.930.004
 Total cholesterol, mmol/L4.48 ± 1.094.51 ± 2.13−0.160.873
 Triglyceride, mmol/L1.06 ± 0.811.03 ± 0.570.680.494
 High-density lipoprotein cholesterol, mmol/L1.68 ± 0.421.74 ± 0.36−1.810.071
 Low-density lipoprotein cholesterol, mmol/L2.65 ± 0.842.16 ± 0.601.780.082
 Fasting glucose, mmol/L4.93 ± 0.384.92 ± 0.290.260.798
 Fasting insulin, pmol/L70.64 ± 14.4367.90 ± 14.032.080.038
 HOMR-IR2.21 ± 0.452.12 ± 0.422.120.035
 IL6, pg/ml81.84 ± 339.7733.09 ± 215.371.890.058
 TNFα, pg/ml29.11 ± 88.7218.86 ± 30.271.750.081
CT genotypen = 153n = 78
 Folic acid, nmol/L32.73 ± 7.8538.43 ± 9.29−3.550.000
 Vitamin B12, pg/ml359.98 ± 131.88353.94 ± 115.880.330.745
 Homocysteine, umol/L12.65 ± 3.9711.71 ± 3.061.990.047
 Total protein, g/L71.68 ± 8.0570.61 ± 8.010.920.361
 Total cholesterol, mmol/L6.99 ± 32.564.17 ± 0.810.720.475
 Triglyceride, mmol/L1.02 ± 0.520.95 ± 0.370.970.332
 High-density lipoprotein cholesterol, mmol/L1.67 ± 0.331.72 ± 0.48−0.920.358
 Low-density lipoprotein cholesterol, mmol/L2.59 ± 0.782.39 ± 0.741.820.070
 Fasting glucose, mmol/L4.95 ± 0.374.88 ± 0.390.620.532
 Fasting insulin, pmol/L72.28 ± 15.4266.89 ± 12.572.860.005
 HOMR-IR2.27 ± 0.472.11 ± 0.362.830.005
 IL6, pg/ml72.60 ± 275.5241.08 ± 147.431.090.276
 TNFα, pg/ml29.34 ± 106.3016.52 ± 34.811.250.210
TT genotypen = 37n = 11
 Folic acid, nmol/L25.72 ± 7.6724.54 ± 7.840.450.658
 Vitamin B12, pg/ml354.14 ± 142.24322.82 ± 167.570.620.541
 Homocysteine, umol/L17.80 ± 2.8615.93 ± 2.082.390.026
 Total protein, g/L70.17 ± 9.9670.42 ± 3.79−0.080.933
 Total cholesterol, mmol/L4.34 ± 1.013.96 ± 0.801.130.265
 Triglyceride, mmol/L1.11 ± 0.571.49 ± 0.73−1.850.071
 High-density lipoprotein cholesterol, mmol/L1.58 ± 0.331.62 ± 0.26−0.310.761
 Low-density lipoprotein cholesterol, mmol/L2.61 ± 0.762.43 ± 0.672.780.006
 Fasting glucose, mmol/L4.95 ± 0.434.79 ± 0.361.380.175
 Fasting insulin, pmol/L70.52 ± 16.1367.86 ± 17.260.550.583
 HOMR-IR2.21 ± 0.452.07 ± 0.540.960.341
 IL6, pg/ml14.94 ± 43.01104.44 ± 273.61−1.580.126
 TNFα, pg/ml15.72 ± 29.5720.42 ± 19.78−0.650.521
CT /TTgenotypen = 190n = 89
 Folic acid, nmol/L31.31 ± 8.9935.11 ± 21.36−2.960.003
 Vitamin B12, pg/ml358.84 ± 133.59349.61 ± 123.500.530.598
 Homocysteine, umol/L12.37 ± 4.5711.52 ± 3.652.520.012
 Total protein, g/L71.39 ± 8.4570.59 ± 7.550.730.465
 Total cholesterol, mmol/L6.48 ± 29.224.14 ± 0.810.710.478
 Triglyceride, mmol/L1.04 ± 0.531.03 ± 0.470.140.887
 High-density lipoprotein cholesterol, mmol/L1.66 ± 0.341.71 ± 0.45−1.080.281
 Low-density lipoprotein cholesterol, mmol/L2.61 ± 0.792.36 ± 0.722.380.018
 Fasting glucose, mmol/L4.95 ± 0.384.94 ± 0.390.150.158
 Fasting insulin, pmol/L71.99 ± 15.5067.08 ± 13.552.780.006
 HOMR-IR2.26 ± 0.472.11 ± 0.402.960.003
 IL6, pg/ml63.25 ± 253.5053.54 ± 119.700.370.714
 TNFα, pg/ml15.72 ± 29.5720.42 ± 19.78−0.650.521

HOMA-IR Homeostatic model assessment of insulin resistance, IL6 Interleukin 6, TNFα: Tumor necrosis factor α

Interaction of MTHFR C677T polymorphism with recurrent spontaneous abortion on serum folate and lipid levels HOMA-IR Homeostatic model assessment of insulin resistance, IL6 Interleukin 6, TNFα: Tumor necrosis factor α

MTHFR A1298C genotypes and serum homocysteine, lipid levels

Table 5 shows the interaction of MTHFR A1298C gene polymorphism with RSA risk on serum homocysteine and lipid levels. All the three gene variants had detrimental effects on HOMA-IR (all p were < 0.05). The AA genotype carriers had lower HDL-C levels in the RSA group than that in the control group (p = 0.012). The RSA group who carrying AC genotype had higher serum LDL-C levels than that in the control group (p < 0.001). For RSA cases who carried AC/CC genotype, they had higher serum LDL-C levels than that in the control group (p < 0.001).
Table 5

Interaction of MTHFR A1298C polymorphism with recurrent spontaneous abortion on serum folate and lipid levels

VariableCasecontrol t p
AA genotypen = 231n = 221
 Folic acid, nmol/L31.28 ± 9.7733.89 ± 23.08−1.580.115
 Vitamin B12, pg/ml352.21 ± 125.06347.58 ± 124.710.390.694
 Homocysteine, umol/L11.93 ± 4.6311.27 ± 2.751.810.071
 Total protein, g/L71.91 ± 7.9970.26 ± 10.931.830.067
 Total cholesterol, mmol/L4.32 ± 0.844.47 ± 2.08−1.050.295
 Triglyceride, mmol/L1.07 ± 0.771.06 ± 0.590.130.894
 High-density lipoprotein cholesterol, mmol/L1.67 ± 0.391.76 ± 0.40−2.510.012
 Low-density lipoprotein cholesterol, mmol/L2.56 ± 0.742.45 ± 0.711.650.101
 Fasting glucose, mmol/L4.92 ± 0.374.92 ± 0.380.020.987
 Fasting insulin, pmol/L72.88 ± 14.9367.83 ± 14.423.55< 0.001
 HOMR-IR2.28 ± 0.462.12 ± 0.433.74< 0.001
 IL6, pg/ml58.24 ± 239.9336.23 ± 138.031.190.235
 TNFα, pg/ml29.47 ± 108.5719.73 ± 35.541.290.198
AC genotypen = 144n = 102
 Folic acid, nmol/L34.18 ± 6.8035.24 ± 6.50−1.230.218
 Vitamin B12, pg/ml354.39 ± 129.77350.37 ± 116.890.250.804
 Homocysteine, umol/L11.85 ± 4.6311.06 ± 4.351.490.137
 Total protein, g/L72.69 ± 4.5271.63 ± 6.121.520.129
 Total cholesterol, mmol/L7.41 ± 33.554.21 ± 1.230.960.337
 Triglyceride, mmol/L1.07 ± 0.590.96 ± 0.441.540.126
 High-density lipoprotein cholesterol, mmol/L1.65 ± 0.361.70 ± 0.35−1.150.252
 Low-density lipoprotein cholesterol, mmol/L2.73 ± 0.832.34 ± 0.653.880.000
 Fasting glucose, mmol/L4.95 ± 0.394.94 ± 0.420.160.873
 Fasting insulin, pmol/L68.94 ± 14.6467.46 ± 13.490.030.409
 HOMR-IR2.16 ± 0.432.11 ± 0.400.890.372
 IL6, pg/ml109.82 ± 422.0951.87 ± 305.401.260.208
 TNFα, pg/ml28.91 ± 69.9215.59 ± 21.632.160.032
CC genotypen = 28n = 19
 Folic acid, nmol/L33.18 ± 9.0934.99 ± 8.43−0.690.494
 Vitamin B12, pg/ml348.11 ± 80.49330.79 ± 157.100.500.622
 Homocysteine, umol/L12.43 ± 5.9911.84 ± 4.580.360.717
 Total protein, g/L71.67 ± 4.2270.19 ± 4.621.140.262
 Total cholesterol, mmol/L4.27 ± 0.744.93 ± 2.66−1.230.226
 Triglyceride, mmol/L0.89 ± 0.371.00 ± 0.49−0.910.366
 High-density lipoprotein cholesterol, mmol/L1.78 ± 0.421.62 ± 0.321.440.156
 Low-density lipoprotein cholesterol, mmol/L2.41 ± 0.672.38 ± 0.530.160.876
 Fasting glucose, mmol/L4.93 ± 0.385.00 ± 0.35−0.810.420
 Fasting insulin, pmol/L68.09 ± 13.3366.68 ± 11.630.450.657
 HOMR-IR2.14 ± 0.462.12 ± 0.360.240.809
 IL6, pg/ml37.96 ± 81.3630.61 ± 91.730.340.735
 TNFα, pg/ml17.62 ± 22.3318.33 ± 27.97−0.110.910
AC /CCgenotypen = 172n = 121
 Folic acid, nmol/L34.02 ± 7.2035.20 ± 6.80−1.420.155
 Vitamin B12, pg/ml353.37 ± 122.93347.30 ± 23.500.420.678
 Homocysteine, umol/L11.86 ± 4.6311.06 ± 4.351.490.137
 Total protein, g/L72.52 ± 4.7371.40 ± 5.921.800.073
 Total cholesterol, mmol/L6.92 ± 30.794.32 ± 1.550.930.356
 Triglyceride, mmol/L1.04 ± 0.570.96 ± 0.451.140.253
 High-density lipoprotein cholesterol, mmol/L1.67 ± 0.371.68 ± 0.35−0.420.672
 Low-density lipoprotein cholesterol, mmol/L2.67 ± 0.812.35 ± 0.633.690.000
 Fasting glucose, mmol/L4.94 ± 0.394.95 ± 0.40−0.220.826
 Fasting insulin, pmol/L68.79 ± 14.3967.27 ± 13.020.980.325
 HOMR-IR2.16 ± 0.432.11 ± 0.390.930.351
 IL6, pg/ml97.57 ± 386.5846.67 ± 269.041.370.170
 TNFα, pg/ml26.98 ± 64.4316.26 ± 23.262.040.042

HOMA-IR Homeostatic model assessment of insulin resistance, IL6 Interleukin 6, TNFα Tumor necrosis factor α

Interaction of MTHFR A1298C polymorphism with recurrent spontaneous abortion on serum folate and lipid levels HOMA-IR Homeostatic model assessment of insulin resistance, IL6 Interleukin 6, TNFα Tumor necrosis factor α

MTRR A66G genotypes and serum homocysteine, lipid levels

Table 6 shows the interaction of MTRR A66G gene polymorphism with RSA risk on serum homocysteine and lipid levels. The AA genotype carriers had higher HOMA-IR, total protein and LDL-C levels in the RSA group than that in the control group (p = 0.011, 0.008 and < 0.001, respectively). The RSA group who carrying AG genotype had higher serum homocysteine levels and lower serum HDL-C levels than that in the control group (p = 0.047 and 0.010, respectively). For RSA patients who carried AG/GG genotype, they had higher HOMA-IR, serum homocysteine levels than that in the control group (p = 0.020 and 0.030, respectively).
Table 6

Interaction of MTRR A66G polymorphism with recurrent spontaneous abortion on serum folate and lipid levels

VariableCasecontrol t p
AA genotypen = 225n = 226
 Folic acid, nmol/L33.20 ± 9.0633.58 ± 8.42−0.570.572
 Vitamin B12, pg/ml362.49 ± 134.76346.12 ± 126.651.330.185
 Homocysteine, umol/L11.38 ± 4.5911.05 ± 3.490.860.393
 Total protein, g/L72.83 ± 5.2171.08 ± 8.412.640.008
 Total cholesterol, mmol/L6.27 ± 26.854.48 ± 2.250.990.320
 Triglyceride, mmol/L1.17 ± 0.551.05 ± 0.561.750.081
 High-density lipoprotein cholesterol, mmol/L1.68 ± 0.411.72 ± 0.39−1.150.251
 Low-density lipoprotein cholesterol, mmol/L2.67 ± 0.792.39 ± 0.723.970.000
 Fasting glucose, mmol/L4.94 ± 0.394.92 ± 0.410.240.820
 Fasting insulin, pmol/L71.08 ± 15.2367.63 ± 14.542.200.028
 HOMR-IR2.23 ± 0.472.11 ± 0.422.560.011
 IL6, pg/ml67.27 ± 259.6145.69 ± 255.260.790.426
 TNFα, pg/ml26.26 ± 85.5116.97 ± 22.951.470.143
AG genotypen = 148n = 100
 Folic acid, nmol/L31.89 ± 9.3833.84 ± 7.62−1.860.064
 Vitamin B12, pg/ml335.09 ± 107.21340.27 ± 117.81−0.360.720
 Homocysteine, umol/L12.29 ± 4.3111.29 ± 3.071.990.047
 Total protein, g/L71.31 ± 7.8169.38 ± 11.931.540.126
 Total cholesterol, mmol/L4.31 ± 1.064.24 ± 0.680.580.561
 Triglyceride, mmol/L0.93 ± 0.370.98 ± 0.52−1.000.317
 High-density lipoprotein cholesterol, mmol/L1.65 ± 0.331.77 ± 0.37−2.600.010
 Low-density lipoprotein cholesterol, mmol/L2.52 ± 0.732.45 ± 0.610.740.462
 Fasting glucose, mmol/L4.94 ± 0.374.94 ± 0.38−0.050.960
 Fasting insulin, pmol/L71.43 ± 14.3468.49 ± 13.091.840.067
 HOMR-IR2.24 ± 0.432.16 ± 0.401.820.070
 IL6, pg/ml102.91 ± 403.6134.88 ± 120.712.020.044
 TNFα, pg/ml28.02 ± 71.1120.87 ± 40.681.080.281
GG genotypen = 30n = 16
 Folic acid, nmol/L30.15 ± 9.4048.46 ± 80.78−1.240.222
 Vitamin B12, pg/ml366.17 ± 110.06411.75 ± 114.65−1.320.194
 Homocysteine, umol/L13.84 ± 5.6612.71 ± 3.860.710.480
 Total protein, g/L71.54 ± 10.6472.81 ± 4.08−0.460.649
 Total cholesterol, mmol/L4.56 ± 1.464.69 ± 1.92−0.270.792
 Triglyceride, mmol/L0.87 ± 0.331.03 ± 0.56−1.170.250
 High-density lipoprotein cholesterol, mmol/L1.67 ± 0.361.69 ± 0.32−0.220.828
 Low-density lipoprotein cholesterol, mmol/L2.59 ± 0.872.48 ± 0.730.430.670
 Fasting glucose, mmol/L4.87 ± 0.334.94 ± 0.31−0.920.360
 Fasting insulin, pmol/L70.39 ± 14.9563.61 ± 12.912.190.032
 HOMR-IR2.18 ± 0.462.00 ± 0.421.810.074
 IL6, pg/ml18.62 ± 36.3438.53 ± 180.82−0.620.543
 TNFα, pg/ml37.97 ± 155.9714.07 ± 15.961.080.283
AG/GGgenotypen = 178n = 116
 Folic acid, nmol/L31.59 ± 8.5635.86 ± 30.44−1.760.079
 Vitamin B12, pg/ml340.33 ± 108.01350.13 ± 119.48−0.730.467
 Homocysteine, umol/L12.55 ± 4.5811.49 ± 3.212.180.030
 Total protein, g/L71.34 ± 8.3269.85 ± 11.241.310.193
 Total cholesterol, mmol/L4.36 ± 1.144.31 ± 0.950.390.699
 Triglyceride, mmol/L0.92 ± 0.360.98 ± 0.52−1.380.108
 High-density lipoprotein cholesterol, mmol/L1.65 ± 0.341.76 ± 0.37−2.500.113
 Low-density lipoprotein cholesterol, mmol/L2.52 ± 0.752.46 ± 0.620.870.383
 Fasting glucose, mmol/L4.93 ± 0.364.94 ± 0.37−0.480.640
 Fasting insulin, pmol/L71.18 ± 14.4667.56 ± 13.162.540.011
 HOMR-IR2.23 ± 0.432.13 ± 0.412.340.020
 IL6, pg/ml82.54 ± 353.4935.57 ± 133.611.780.077
 TNFα, pg/ml30.42 ± 98.1819.58 ± 37.311.480.141

HOMA-IR Homeostatic model assessment of insulin resistance, IL6 Interleukin 6, TNFα Tumor necrosis factor α

Interaction of MTRR A66G polymorphism with recurrent spontaneous abortion on serum folate and lipid levels HOMA-IR Homeostatic model assessment of insulin resistance, IL6 Interleukin 6, TNFα Tumor necrosis factor α

Discussion

We demonstrated that patients carrying the MTHFR 677CT, TT and MTRR 66AG genotypes, as well as MTHFR C677T, MTHFR A1298C and MTRR A66G alleles had a significantly higher risk of experiencing RSA. In the current study, interaction between the MTHFR C677T and A1298C polymorphism, and interaction between the MTHFR A1298C and the MTRR A66G polymorphism were associated with increased RSA risk. All the three gene SNPs except MTRR 66AG gene variant had detrimental effects on HOMA-IR. We found that compared with control group, RSA group who carried the MTHFR 677CT, TT, CT/TT genotypes and MTRR 66AG, AG/GG genotypes had detrimental effects on serum homocysteine levels, the MTHFR 677CT, CT/TT genotype carriers had favorable effects on serum folate and the MTHFR 677TT, CT/TT, 1298 AC, AC/CC genotype carriers had detrimental effects on serum LDL-C levels, the MTRR 66AG genotype carriers had lower HDL-C levels than the AA genotype carriers. In our main effect analysis, the MTHFR C677T and MTRR A66G were the two SNPs exhibited a statistically significant association with increased recurrent spontaneous abortion risk. Besides, We also found that the MTHFR 677CT, TT, CT/TT genotypes and MTRR 66AG, AG/GG genotypes showed a higher level of homocysteine than control group and was significantly associated with recurrent spontaneous abortion. This association is biologically plausible. Homocysteine is a key factor in one-carbon folate metabolism, along with folate, is important for the proper development and growth of fetus and placenta, thus maintaining normal pregnancy [15]. It has been well documented that severe deficiency in the gene that encodes the MTHFR and MTRR enzyme reduced specific activity and increased thermolability of the enzyme, causing mild hyperhomocysteine in plasma, considered to be an important pathogenic mechanism for the development of RSA [16-18]. Besides support from biologically functional evidence, elevated plasma of homocysteine has been proven to damage the vascular endothelium and involve in placental vascular risk and endothelial dysfunction, thus lead to RSA [19]. The association between recurrent spontaneous abortion and insulin resistance is in arguement. It was reported that increased inflammatory cytokine levels such as TNFα and plasma hyperhomocysteinemia were associated with insulin resistance and endocrine abnormalities [20, 21]. Insulin resistance may have positive association with an increase of plasma hyperhomocysteinemia which may damage pregnancy by interfering with endometrial blood flow and vascular integrity leads to increase the risk of early pregnancy abortion [21]. In Mexico general populations [22] it is observed that people who carried 677 T allele may need more folate intake than those carried the C allele. Our results revealed that the MTHFR 677CT, CT/TT genotype carriers had favorable effects on serum folate, which was in accordance with the previous study demonstrated that folate deficiency related with hyperhomocysteinemia was the risk associated with recurrent abortion [23]. Besides the modest main effect of MTHFR C677T, we also observed significant effect of gene-gene interactions, which were able to amplify the modest effect of the single genetic variant, and enhance the predictive power. Individual patients with the combination of MTHFR 677 T and MTHFR 1298C had a significantly higher risk for RSA than those with the combination of MTHFR 677C and MTHFR 1298A (OR = 1.62, 95% CI: 1.28–2.04, p = 0.004). Logistic regression analysis showed that certain gene-gene interactions among MTHFR 1298C and MTRR 66G predict a higher risk for RSA (OR = 2.36, 95% CI: 1.228–5.297, p = 0.005) compared to those with the combination of MTHFR 1298A and MTRR66A. Our results were consistence with the previous studies which reported that the folate pathway gene variants and gene-gene interactions could significantly impact the occurrence of RSA [18, 24, 25]. Several studies have reported the association between the MTHFR C677T polymorphism, high homocysteine and serum lipid profiles in humans, with some indicating that the T allele was associated with unfavorable lipid profiles [26-28]. One study indicated the positive relationship between the MTHFR C677T polymorphism and the lipoprotein level in unexplained recurrent miscarriages [29]. We found that the MTHFR 677TT, CT/TT genotypes and MTHFR 1298 AC, AC/CC genotypes had detrimental effects on serum LDL-C levels and the MTRR 66GG genotype had favourable effects on serum HDL-C levels in RSA group. Our study was consistence with the study conducted by Frelut et al. who reported that MTHFR C677T gene variant was significantly increased LDL-C level [30]. Recently, Westerbuck et al. reported that sterol regulatory element binding proteins (SREBPs) can be activated by endoplasmic reticulum stress which induced by homocysteine [31]. This SREBPs was crucial for the genes responsible for cholesterol biosynthesis, uptake and intracellular accumulation. Besides support from biologically functional evidence, MTHFR-deficient mice presented hyperhomocysteinemia in mice fed control or folate-deficient diets [32]. Moreover, homocysteine was reported inversely correlated with HDL-C [9]. Publications about the influence of MTHFR A1298C mutant on serum lipid metabolic profiles were relatively rare. Chang et al. [33] found no significant associations exist between lipid profiles and MTHFR A1298C gene variants. Li et al. [9] demonstrated that MTHFR C677T and A1298C with low folate showed higher risk of low levels of high-density lipoprotein cholesterol (p for trend: 0.008 and 0.031). Unlike the previous studies, our data showed that MTHFR A1298C mutant was associated with higher level of LDL-C in RSA group than the healthy controls. Based on the positive association between MTHFR C677T, A1298C and serum homocysteine level [9, 24–26], and the favorable effect of homocysteine level on lipid metabolism [9], we speculate that MTHFR C677T and A1298C polymorphism and high homocysteine level interactively increased the prevalence of dyslipidemia in RSA patients. MTRR is responsible for homocysteine remethylation. The MTRR A66G polymorphism results in its enzyme expression and affecting plasma homocysteine levels [34]. Homocysteine levels further affects serum lipid profiles [9, 34]. Many previous studies have explored the relationship between the MTRR gene polymorphisms and serum or plasma lipid profiles in humans, but with no consistence results [34-37]. For example, Misiak et al. [35] found there was no significant association between MTRR 66GG and TG or HDL-C levels in schizophrenia patients and healthy controls. But Jiang et al. [34] revealed that hypertensive patients who carried the MTRR 66GG genotype had lower serum TC and LDL-C levels than patients carried MTRR 66AA genotype. Zhi et al. [37] revealed that MTRR 66GG genotype was associated with increased risk of high TG (TG ≥1.7 mmol/L), while no significant association was found between this polymorphism and low HDL-C levels. Our data revealed that the MTRR 66AG genotype carriers had lower HDL-C levels than the AA genotype carriers, which was consistence with the previous studies reported that MTRR gene variants can affect the lipid metabolisms via plasma homocysteine levels [34-37]. But the molecular mechanism of these metabolites under conditions of folate pathway gene polymorphisms with dyslipidemia in different diseases especially RSA is not fully understood, and is worthy to be explored in the future.

Limitation

There are some limitations to our study. First of all, the single-center design may limit the generalizability of our study results. Secondly, this case-control study is hospital-based and selection bias may exist, however, since the controls were from the same region with cases and were randomly selected from health examination population, which may reduce the effect of selection bias.

Conclusions

In conclusion, we present the first study to date in the interactions of the MTHFR C677T, A1298C and MTRR A66G polymorphisms with the RSA risk on some serum lipid profiles. Interaction between the MTHFR C677T, A1298C and MTHFR A1298C, MTRR A66G are observed in our RSA group. Besides, all the three gene SNPs except MTRR 66AG gene variant had detrimental effects on HOMA-IR. MTHFR C677T and MTRR A66G gene variants had detrimental effects on serum homocysteine levels, while MTHFR C677T, A1298C and MTRR A66G gene variants had detrimental effects on certain serum lipid profiles. Further studies are in urgent to confirm or refute our findings in the future.
  37 in total

1.  Maternal homocysteine and chorionic vascularization in recurrent early pregnancy loss.

Authors:  W L Nelen; J Bulten; E A Steegers; H J Blom; A G Hanselaar; T K Eskes
Journal:  Hum Reprod       Date:  2000-04       Impact factor: 6.918

2.  A common mutation in the 5,10-methylenetetrahydrofolate reductase gene as a new risk factor for placental vasculopathy.

Authors:  E F van der Molen; G E Arends; W L Nelen; N J van der Put; S G Heil; T K Eskes; H J Blom
Journal:  Am J Obstet Gynecol       Date:  2000-05       Impact factor: 8.661

3.  Types of pregnancy loss in recurrent miscarriage: implications for research and clinical practice.

Authors:  L Bricker; R G Farquharson
Journal:  Hum Reprod       Date:  2002-05       Impact factor: 6.918

Review 4.  Genetic factors in fetal growth restriction and miscarriage.

Authors:  Hideto Yamada; Fumihiro Sata; Yasuaki Saijo; Reiko Kishi; Hisanori Minakami
Journal:  Semin Thromb Hemost       Date:  2005-06       Impact factor: 4.180

5.  Alanine amino transferase concentrations are linked to folate intakes and methylenetetrahydrofolate reductase polymorphism in obese adolescent girls.

Authors:  Marie-Laure Frelut; Nathalie Emery-Fillon; Jean-Claude Guilland; Hunh Han Dao; Geneviève Potier de Courcy
Journal:  J Pediatr Gastroenterol Nutr       Date:  2006-08       Impact factor: 2.839

6.  Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways.

Authors:  G H Werstuck; S R Lentz; S Dayal; G S Hossain; S K Sood; Y Y Shi; J Zhou; N Maeda; S K Krisans; M R Malinow; R C Austin
Journal:  J Clin Invest       Date:  2001-05       Impact factor: 14.808

7.  Lipoprotein (a) and other prothrombotic risk factors in Caucasian women with unexplained recurrent miscarriage. Results of a multicentre case-control study.

Authors:  Manuela Krause; Barbara Sonntag; Robert Klamroth; Achim Heinecke; Carola Scholz; Claus Langer; Inge Scharrer; Robert R Greb; Arnold von Eckardstein; Ulrike Nowak-Göttl
Journal:  Thromb Haemost       Date:  2005-05       Impact factor: 5.249

8.  Methylenetetrahydrofolate reductase C677T and A1298C polymorphism and changes in homocysteine concentrations in women with idiopathic recurrent pregnancy losses.

Authors:  N Mtiraoui; W Zammiti; L Ghazouani; N Jmili Braham; S Saidi; R R Finan; W Y Almawi; T Mahjoub
Journal:  Reproduction       Date:  2006-02       Impact factor: 3.906

9.  A common mutation A1298C in human methylenetetrahydrofolate reductase gene: association with plasma total homocysteine and folate concentrations.

Authors:  G Friedman; N Goldschmidt; Y Friedlander; A Ben-Yehuda; J Selhub; S Babaey; M Mendel; M Kidron; H Bar-On
Journal:  J Nutr       Date:  1999-09       Impact factor: 4.798

10.  Gene-gene interaction between fetal MTHFR 677C>T and transcobalamin 776C>G polymorphisms in human spontaneous abortion.

Authors:  Henrik Zetterberg; Alexis Zafiropoulos; Demetrios A Spandidos; Lars Rymo; Kaj Blennow
Journal:  Hum Reprod       Date:  2003-09       Impact factor: 6.918

View more
  4 in total

1.  Hypermethylation of dihydrofolate reductase promoter increases the risk of hypertension in Chinese.

Authors:  Guodong Xu; Zhiyi Wang; Lian Li; Wenxia Li; Jingcen Hu; Shuyu Wang; Hongxia Deng; Bo Li; Changyi Wang; Zhishen Shen; Liyuan Han
Journal:  J Res Med Sci       Date:  2020-12-30       Impact factor: 1.852

2.  Systemic risk factors correlated with hyperhomocysteinemia for specific MTHFR C677T genotypes and sex in the Chinese population.

Authors:  Tianyuan Xiang; Hang Xiang; Muyang Yan; Sheng Yu; Matthew John Horwedel; Yang Li; Qiang Zeng
Journal:  Ann Transl Med       Date:  2020-11

3.  The association between 5, 10 - methylenetetrahydrofolate reductase and the risk of unexplained recurrent pregnancy loss in China: A Meta-analysis.

Authors:  Genzhu Wang; Zhaohui Lin; Xiaoying Wang; Qiang Sun; Zhikun Xun; Baiqian Xing; Zhongdong Li
Journal:  Medicine (Baltimore)       Date:  2021-04-30       Impact factor: 1.817

Review 4.  A Novel Review of Homocysteine and Pregnancy Complications.

Authors:  Chuce Dai; Yiming Fei; Jianming Li; Yang Shi; Xiuhua Yang
Journal:  Biomed Res Int       Date:  2021-05-06       Impact factor: 3.411

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.