Literature DB >> 31198404

A Peptide Analogue of Selectin Ligands Attenuated Atherosclerosis by Inhibiting Monocyte Activation.

Zhishuai Ye1,2, Shanfeng Zhang2, Yubo Liu3, Shujing Wang4, Jianing Zhang3, Rongchong Huang1.   

Abstract

BACKGROUND: Circulating monocytes play a critical role in the pathogenesis of atherosclerosis. Monocyte homing to sites of atherosclerosis is primarily initiated by selectin. Thus, blockade of the interaction of selectins and their ligands holds a significant role in monocyte homing which might be a potential approach to treat atherosclerosis. Here, we investigated the efficacy of a novel peptide analogue of selectin ligands IELLQAR in atherosclerosis. METHODS AND
RESULTS: In this study, we firstly measured the effect of the IELLQAR selectin-binding peptide on the inhibition of binding of selectins to monocytes by flow cytometry, which exhibited a dose-dependent inhibitory effect on the binding of the P-, E-, and L-selectins to monocytes, especially the inhibition of P-selectin binding to human peripheral blood monocytes (PBMCs) (half maximal inhibitory concentration (IC50~5 μM)) and THP-1 cells (IC50~10 μM). Furthermore, IELLQAR inhibited P-selectin-induced activation of CD11b on the surface of monocytes and decreased adhesion of monocytes to the endothelium. ApoE-/- mice with or without IELLQAR (1 or 3 mg/kg) fed a Western-type diet (WTD) or which had disturbed blood flow-induced shear stress underwent partial left carotid artery ligation (PLCA) to induce atherosclerosis. In the WTD- and PLCA-induced atherosclerosis models, atherosclerotic plaque formation and monocyte/macrophage infiltration of the arterial wall both decreased in ApoE-/- mice treated with the IELLQAR peptide. Our results also revealed that IELLQAR inhibited the differentiation of monocytes into macrophages through P-selectin-dependent activation of the nuclear factor- (NF-) κB and mammalian target of rapamycin (mTOR) pathways.
CONCLUSION: Collectively, our results demonstrated that IELLQAR, a peptide analogue of selectin ligands, inhibited selectin binding to monocytes, which led to subsequent attenuation of atherosclerosis via inhibition of monocyte activation. Hence, use of the IELLQAR peptide provides a new approach and represents a promising candidate for the treatment of atherosclerosis in the early stage of disease.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31198404      PMCID: PMC6526553          DOI: 10.1155/2019/8709583

Source DB:  PubMed          Journal:  Mediators Inflamm        ISSN: 0962-9351            Impact factor:   4.711


1. Introduction

Cardiovascular diseases are currently the major causes of mortality worldwide, with atherosclerosis being the most dominant underlying pathology [1]. Circulating monocytes, which play a critical role in the pathogenesis of atherosclerosis, adhere to the endothelium and infiltrate the subendothelial space where they differentiate into macrophages, then take up lipids and develop into foam cells [2-4]. During inflammation, monocyte recruitment involves tethering, rolling, arrest, adhesion, and transmigration. In this multistep cascade, selectins bind with glycosylated ligands to mediate the initial “rolling” step. Furthermore, the engagement of selectins and P-selectin glycoprotein ligand-1 (PSGL-1) permits further arrest and crawling by the activation of the β2 integrin [5]. Significantly, PSGL-1 ligation of monocytes also activates the intracellular Akt/mammalian target of rapamycin (mTOR) pathway, which mediates cell chemotaxis and phagocytosis [6], and the NF-κB pathway, which controls the production levels of proinflammatory cytokines [7]. Selectins are Ca2+-dependent lectins, consisting of three subfamily members (P-, E-, and L-selectins) that all contain an N-terminal C-type domain. Structurally diverse glycoprotein ligands bind to selectins with high affinity. The most well-characterized ligand is PSGL-1, which is a core 2 decorated O-glycan expressed on the surfaces of lymphoid and myeloid cells. The tetrasaccharide sialyl Lewis X (sLeX; NeuAcα2-3Galβ1-4 [Fucα1-3] GlcNAc) motif is present as a terminal epitope on a significant proportion of O-glycans that is essential for the binding of selectins [8]. Hence, the P-selectin/PSGL-1 interaction presents a promising target for the treatment of inflammatory diseases [9-11]. To date, several small molecular inhibitors designed through modifications of sLeX, the terminal motif of PSGL-1, have been developed for a wide range of therapeutic uses. For example, rivipansel (GMI-1070) is a glycomimetic pan-selectin antagonist that was shown to be effective against sickle cell disease in a phase II trial [9], and bimosiamose (TBC1269) was successfully used as a pan-selectin antagonist for the treatment of chronic obstructive pulmonary disease [10] and asthma [12]. IELLQAR, a selectin ligand mimicry peptide, was isolated and synthesized by screening a peptide harboring phage library using anti-Lewis antibody. This peptide inhibited the binding of the E-, P-, and L-selectins to the ligand sLeX [13]. IELLQAR has been showing considerable anticancer activities by inhibiting sialyl Lewis X-dependent B16 melanoma cell colonization of the lung in a mouse [14]. Besides its antitumor activity, IELLQAR has also possessed anti-inflammatory activity. It has been shown that IELLQAR inhibited the early influx of leukocytes into rat heart allografts and inflammatory exudation in the mouse abdominal cavity [15, 16]. Thus, in this study, we demonstrate that IELLQAR can inhibit the binding of all 3 selectins to monocytes and decrease adhesion of monocytes to the endothelium, as well as the differentiation of monocytes. Importantly, IELLQAR effectively suppress the development of atherosclerosis in an ApoE mouse model.

2. Materials and Methods

2.1. Study Approval

The study protocol was approved by the Ethics Committee of the First Affiliated Hospital of Dalian Medical University (Dalian, China) (approval no. PJ-KS-KY-2017-98(X)) and conducted in accordance with the principles of the Declaration of Helsinki. The protocols of all mouse experiments were approved by the Institutional Animal Care and Use Committee of Dalian Medical University.

2.2. Reagents

The selectin ligand mimicry peptide IELLQAR was a gift from Prof. Zhang and has been characterized previously [14]. For the cell culture study, IELLQAR was dissolved in 1 mM phosphate-buffered saline (PBS). For the animal study, IELLQAR was suspended in normal saline at a concentration of 1 mg/mL. The human recombinant P-selectin Fc chimera (137-PS-050), E-selectin Fc chimera (724-ES-100), L-selectin Fc chimera (728-LS-100), monocyte chemoattractant protein-1 (MCP-1; 279-MC-050), and intercellular adhesion molecule 1 (ICAM-1; 720-IC-050) were purchased from R&D Systems Inc. (Minneapolis, MN, USA). Lipopolysaccharide (LPS; L4391), tumor necrosis factor alpha (TNF-α; T6674), the mTOR activators 4,6-dimorpholino-N-(4-nitrophenyl)-1,3,5-triazin-2-amine (MHY1485, SML0810) and 3-benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one (3BDO, SML1687), CaCl2 (793639), bovine serum albumin (BSA, A1933), and β-mercaptoethanol (M3148) were purchased from Sigma-Aldrich Corporation (St. Louis, MO, USA). Primer sequences for quantitative real-time polymerase chain reaction (qRT-PCR) analysis were designed and purchased from GenePharma Co. Ltd. (Shanghai, China). Calcein-AM (ab141420), mouse interleukin- (IL-) 6 (ab100712), TNF-α (100747), and IL-1β (ab100704) ELISA Kits and the cholesterol assay kit (ab65390) were purchased from Abcam (Cambridge, UK). The following antibodies (Abs) were used in this study: anti-human NF-κB p65 (D14E12), anti-human phospho-NF-κB p65 (Ser536, 93H1), anti-human inhibitor of nuclear factor kappa B kinase subunit epsilon (IκBα; L35A5), anti-human phospho-IκBα (Ser32, 14D4), anti-human phospho-class IA phosphoinositide 3-kinase (PI3K) p85 (Tyr458; 4228), anti-human phospho-mTOR (Ser2448, D9C2) (all purchased from Cell Signaling Technology Inc., Beverly, MA, USA), anti-human phospho-Akt (S478, ab81283), anti-human cluster of differentiation (CD) 11b (ab133357), anti-mouse CD68 (ab955) (purchased from Abcam), anti-human mTOR (20657), anti-human PI3K p85 (60225), anti-human Akt (10176), anti-human glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 60004) (purchased from Proteintech, Wuhan, China), anti-mouse lymphocyte antigen 6 complex (Ly-6C; sc52650) (purchased from Santa Cruz Biotechnology Inc., Dallas, TX, USA), phycoerythrin- (PE-) conjugated anti-human P-selectin (304905), PE-conjugated anti-human E-selectin (HCD62E), PE-conjugated anti-human L-selectin (DREG56), PE-conjugated anti-mouse CD45 (103105), fluorescein isothiocyanate- (FITC-) conjugated anti-mouse CD11b (101205), and allophycocyanin-conjugated anti-mouse Ly-6C (128015) (purchased from BioLegend, San Diego, CA, USA).

2.3. Cell Culture

Human monocyte THP-1 cells were obtained from the American Type Culture Collection. Human peripheral blood monocytes (PBMCs) were isolated from healthy donors by lymphocyte separation gradient centrifugation (Ficoll-Hypaque; Sigma-Aldrich Corporation). The blood samples were centrifuged at 500 ×g for 20 min. Following centrifugation, mononuclear cells were separated by density gradient centrifugation from platelets, plasma, granulocytes, and red blood cells. THP-1 and PBMCs were maintained in 1640 medium supplemented with 10% fetal bovine serum, 100 U/mL of penicillin, 100 μg/mL of streptomycin, and 0.05 μM β-mercaptoethanol. THP-1 and PBMCs were treated with 1 μg/mL LPS or 100 ng/mL TNF-α to activate NF-κB and 2 μM MHY1485 or 60 μM 3BDO to activate mTOR, respectively. Primary HUVECs were purchased from ScienCell Research Laboratories (Carlsbad, CA, USA) and cultured in endothelial cell medium (ScienCell Research Laboratories), which was changed every 2 days, at 37°C under a humidified atmosphere of 5% CO2/95% air.

2.4. Flow Cytometry

Flow cytometry was used to quantify the inhibition capacities of P-, E-, and L-selectin chimeras to bind to human monocytes. Monocytes were incubated with increasing concentrations of IELLQAR (1, 3, 10, and 30 μM) or BSA, as a control, in the presence of 10 μg/mL of P-, E-, or L-selectin for 30 min and then blocked with Tris-buffered saline containing 1 mM CaCl2 and 5% BSA for 1 h. Afterward, the cells were incubated with PE-conjugated anti-human P-, E-, or L-selectin for 30 min. Murine peripheral blood samples were stained with PE-conjugated anti-mouse CD45, FITC-conjugated anti-mouse CD11b, and allophycocyanin-conjugated anti-mouse Ly-6C. Inflammatory monocytes were identified as CD45+CD11b+Ly-6Chigh cells. Flow cytometry was performed using a FACSCalibur flow cytometer (BD Immunocytometry Systems, San Jose, CA, USA), and the results were analyzed with CellQuest Pro software (BD Biosciences, San Jose, CA, USA).

2.5. Adhesion Assay under Static Conditions

PBMCs and THP-1 cells were incubated with PBS alone, 10 μg/mL of P-selectin, or 10 μg/mL of P-selectin plus 10 μM IELLQAR for 2 h. At the end of the incubation period, the cells were harvested and prestained with 5 mM calcein-AM at 37°C for 30 min. HUVECs were activated by pretreating with 2 μg/mL of LPS for 6 h. After washing in PBS, fluorescent tag-labeled dendritic cells were added onto the HUVEC monolayer at a density of 1 × 106 cells/mL. Nonadherent monocytes were carefully removed by washing three times with PBS after 30 min. The adhesion of PBMCs or THP-1 cells to HUVECs was quantified by counting fluorescent-tagged cells in random areas of four independent images per condition.

2.6. Adhesion Assay under Flow Conditions

A flow adhesion assay was conducted in a parallel plate flow chamber (31-010; GlycoTech, Gaithersburg, MD, USA) as previously described [17]. In brief, dishes were coated with 10 μg/mL of P-selectin, 10 μg/mL of P-selectin plus 5 μg/mL of ICAM-1, or BSA as the control. PBMCs and THP-1 cells were preincubated with or without 10 μM IELLQAR at 37°C overnight. At the end of the incubation period, the cells were harvested and stained with 5 mM of calcein-AM and then perfused through a microfluidic flow chamber for 5 min. The flow of cells was initiated with a syringe pump connected to the outlet flow chamber at 2 dynes/cm2 of shear stress. At each shear stress value, cell adhesion of at least four fields of view was calculated along the length of the chamber.

2.7. RNA Isolation and Real-Time PCR

Total RNA was extracted using the RNAiso Plus total RNA extraction reagent (Takara Bio Inc., Shiga, Japan), and complementary DNA was synthesized using a qRT-PCR kit (Takara Bio Inc.) according to the manufacturer's recommendations. The primer sequences for qRT-PCR are shown in Table 1. Relative changes in mRNA expression were normalized to GAPDH and calculated using the 2-ΔΔCT method.
Table 1

Primer sequences.

SpeciesNameForward primer (5′-3′)Reverse primer (5′-3′)
HumanIL-6CAAAGATGTAGCCGCCCCACTTCTGCCAGTGCCTCTTTGC
TNF-αCAGCCTCTTCTCCTTCCTGATGCCAGAGGGCTGATTAGAGA
MCP-1CTTCTGTGCCTGCTGCTCATCAGGTGACTGGGGCATTGAT
GAPDHCCATGGAGAAGGCTGGGGCAAAGTTGTCATGGATGACC

MouseMCP-1TGTGCTGACCCCAAGAAGGAAGTGCTTGAGGTGGTTGTGG
CCR2AGGGCTGTGAGGCTCATCTTGTCTCTGTCACCTGCATGGC
ICAM-1CATGCCGCACAGAACTGGATGGTGTCGAGCTTTGGGATGG
GAPDHTGGCCTTCCGTGTTCCTACGAGTTGCTGTTGAAGTCGCA

CCR2: CC chemokine receptors 2; GAPDH: glyceraldehyde 3 phosphate dehydrogenase; ICAM-1: intercellular adhesion molecule-1; IL-6: interleukin-6; MCP-1: monocyte chemotactic protein-1; TNF-α: tumor necrosis factor α.

2.8. Detection of Serum Cytokines and Lipids

Murine serum TNF-α, IL-6, IL-1β, and lipid profiles were measured using enzyme-linked immunosorbent assay kits and a cholesterol assay kit in accordance with the manufacturers' instructions.

2.9. Western Blot Analysis

Total protein concentration was measured using a bicinchoninic acid assay kit (Beyotime Institute of Biotechnology, Haimen, China). In brief, 30 μg of proteins was loaded into each lane of sodium dodecyl sulfate polyacrylamide gels, separated by electrophoresis, and then transferred to polyvinylidene fluoride membranes (Pall Corporation, Port Washington, NY, USA), which were incubated with primary Abs. Anti-rabbit or mouse horseradish peroxidase-linked Ab (ZSGB-BIO Technology Co. Ltd., Beijing, China) was used as the secondary Ab. Detection was performed using an enhanced chemiluminescence kit (Advansta Inc., Menlo Park, CA, USA). Densitometry of proteins was analyzed with Gel-Pro software (Media Cybernetics, Bethesda, MA, USA).

2.10. Animal Model

ApoE-deficient mice (B6.129P2-Apoetm1unc/J), aged 8 weeks, were purchased from the Jackson Laboratory (Bar Harbor, ME, USA) and randomized into one of three treatment groups (n = 15/group): normal saline (NS) as a control group and two IELLQAR treatment groups (1 and 3 mg/kg). For induction of atherosclerosis with a WTD, all mice were fed a high-fat diet (21% fat + 0.15% cholesterol) for 12 weeks, and agents were administered every 4 weeks for a total of 12 weeks. For the PLCA model, animals were segregated into four groups: sham and PLCA with NS or two doses of IELLQAR. PLCA surgery was performed as previously reported by others [18]. In brief, a ventral midline incision of about 1–2 cm in length was made to the neck of mice after sedation with 3% sodium pentobarbital. Three (left external carotid, internal carotid, and occipital artery) of four branches were ligated using a 10-0 silk suture, and the superior thyroid artery was not ligated to provide the sole source for blood circulation. Mice were fed a normal chow diet and injected with the indicated agents every 2 weeks for a total of 4 weeks.

2.11. Histological Study

Aortic roots from mice were embedded in 10% buffered formalin, and 5 μm thick serial sections were prepared and then stained with hematoxylin and eosin (H&E) for analysis of the formed lesions. Masson's trichrome stain was used to delineate the collagen content, and the Movat stain was used to show the necrotic areas of the atherosclerotic lesions. Atherosclerotic lesions were stained with Oil red O and quantified by en face analysis of the whole aorta.

2.12. Immunostaining

PBMCs and THP-1 cells were incubated with PBS alone, 10 μg/mL of P-selectin, 10 μM IELLQAR, or 10 μg/mL of P-selectin plus 10 μM IELLQAR for 2 h. Then, the samples were incubated with anti-human CD11b Ab (20 μg/mL) and an Alexa Fluor® 555-conjugated Ab (1 : 1000 dilution) at 37°C for 30 min. Slides of the aortic sinus sections were stained with anti-mouse Ly-6C Ab (5 μg/mL) and an Alexa Fluor 488-conjugated Ab (1 : 1000 dilution) at 37°C for 30 min. Control immunostaining was performed using the respective nonimmune IgG Abs. The relative fluorescence intensity was calculated using Image-Pro Plus 5.0 software (Media Cybernetics).

2.13. Statistical Analysis

Data from at least three independent experiments are presented as the mean ± standard error of the mean (SEM). Statistically significant differences were identified by one-way analysis of variance followed by the least significant difference multiple comparison tests using IBM SPSS Statistics for Windows, version 21.0 (IBM Corporation, Armonk, NY, USA), and a probability (p) value of <0.05 was considered statistically significant.

3. Results

3.1. IELLQAR Inhibited the Binding of Selectin to Monocytes

The selectin ligand mimic IELLQAR has been previously shown to bind to E-, P-, and L-selectins and inhibit selectin-mediated adhesion in human leukemia-60 cells [13, 14]. Therefore, the influences of IELLQAR on inhibited selectin-mediated adhesion in monocytes were investigated in this study. Flow cytometry was used to measure the ability of IELLQAR to block the binding of the selectins to monocytes. Recombinant human P-, L-, or E-selectin Fc chimeras (10 μg/mL) were incubated with PBMCs and THP-1 cells in the presence of increasing concentrations of IELLQAR (1, 3, 10, and 30 μM). IELLQAR exhibited dose-dependent inhibitory effects on the binding of all three selectins to monocytes. Particularly, IELLQAR showed the highest inhibition of P-selectin binding to PBMCs (IC50: ~5 μM) and THP-1 cells (IC50: ~10 μM), with moderate inhibition of E-selectin (IC50: ~12 μM and ~20 μM, respectively) and the lowest inhibition with L-selectin (IC50: ~25 μM and ~30 μM, respectively) (Figures 1(a)–1(c)).
Figure 1

IELLQAR inhibits selectin binding to monocytes. PBMCs and THP-1 cells were incubated with increasing concentrations of IELLQAR (1, 5, and 10 μM) in the presence of 10 μg/mL of P-, E-, or L-selectin for 30 min, analyzed by flow cytometry, and plotted as the percent inhibition vs. bovine serum albumin (BSA) control. IELLQAR exhibited dose-dependent inhibitory effects against selectin family binding to monocytes, with the highest inhibition of P-selectin binding to PBMCs and THP-1 cells (a), a moderate inhibition of E-selectin (b), and the lowest inhibition of L-selectin (c). Data are presented as the mean ± SEM (n = 3).

3.2. IELLQAR Inhibited the Adhesion of P-Selectin to Monocytes and HUVECs

Selectins and their ligands mediate tethering and weak adhesion to leukocytes, while this binding activates the αMβ2 integrin (CD11b), which can bind to various members of the ICAM family on endothelial cells to support leukocyte adhesion and transmigration [5]. The distribution of CD11b on the monocyte surface was assessed to investigate the effect of IELLQAR on the activation state of CD11b induced by the selectins. PBMCs and THP-1 cells were treated with P-selectin alone, IELLQAR alone, or coincubated with P-selectin plus IELLQAR for 2 h. The results indicated that nontreated monocytes or monocytes only exposed to IELLQAR showed weak staining with CD11b. In contrast, P-selectin stimulation induced considerably brighter and larger patches of staining, whereas treatment with IELLQAR partially reversed the effect of P-selectin (Figures 2(a) and 2(b)).
Figure 2

IELLQAR inhibits the adhesion of P-selectin to monocytes and HUVECs. (a, b) PBMCs and THP-1 cells were incubated with PBS, 10 μg/mL of P-selectin, 10 μM IELLQAR, or 10 μg/mL of P-selectin plus 10 μM IELLQAR for 2 h, respectively. Then, the samples were incubated with anti-human CD11b Ab followed by Alexa Fluor® 555-conjugated rabbit Ab and fluorescence microscopy scanning. Scale bar: 50 μm. (c, d) Calcein-AM-labeled PBMCs and THP-1 cells were treated with or without 10 μM IELLQAR for 2 h. Dishes of parallel plate flow chambers were coated with P-selectin, P-selectin plus ICAM-1, or BSA overnight. Then, the cells were perfused through a microfluidic flow chamber at 2 dynes/cm2 shear stress for 5 min. Representative photographs of the adhesion of PBMCs and THP-1 cells. Scale bar: 100 μm. (e, f) Calcein-AM-labeled PBMCs and THP-1 cells were treated with PBS, P-selectin, or IELLQAR plus P-selectin for 2 h. HUVECs were activated or not by pretreating with 2 μg/mL of LPS for 6 h. Representative photographs of the adhesion of cells on HUVECs. Scale bar: 100 μm. Data are presented as the mean ± SEM (n = 3). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

We next investigated the rolling function of monocytes under static and flow conditions. PBMCs and THP-1 cells were incubated with IELLQAR or PBS for 2 h and then perfused through a microfluidic flow chamber at 2 dynes/cm2 over glass substrates coated with BSA, P-selectin plus ICAM-1, or P-selectin for 5 min. The results showed that more cells adhered to P-selectin than the controls, while ICAM-1 supplementation caused a further increase in adhesion. IELLQAR treatment significantly reduced the adhesion of P-selectin and P-selectin plus ICAM-1, respectively (Figures 2(c) and 2(d)). As shown in Figures 2(e) and 2(f), the number of P-selectin-treated monocytes was greater than control cells in attaching HUVECs regardless of LPS stimulation, whereas IELLQAR remarkably attenuated P-selectin-induced adhesion.

3.3. IELLQAR Decreased WTD-Induced Atherosclerosis and Proinflammatory Cytokine Production

To further explore the effect of IELLQAR on atherosclerosis, 8-week-old male ApoE mice were randomized to one of three treatment groups (1 or 3 mg/kg of IELLQAR or normal saline). For WTD-induced atherosclerosis, all mice were fed a high-fat diet for 12 weeks. The results showed that there was no difference in the body weights or plasma lipid levels, including low-density lipoprotein (LDL), total cholesterol (TC), triglyceride (TG), and high-density lipoprotein (HDL), among these three groups (Table 2). As compared to treatment with the vehicle alone, 1 mg/kg of IELLQAR significantly decreased the atherosclerotic lesion area along the whole aorta (Oil red O-positive), and 3 mg/kg of IELLQAR almost diminished the lesion area (Figure 3(a)). H&E, Movat, and Masson trichrome staining indicated that the groups treated with 1 and 3 mg/kg of IELLQAR exhibited smaller necrotic areas and more collagen content in the aortic sinus, as compared to the vehicle treatment group (Figure 3(b)). The decreases in the plaque necrotic areas and increases in the collagen content may be associated with plaque stability. In addition, monocyte/macrophage infiltration in the lesions was lower in mice treated with IELLQAR than those treated with the vehicle only (Figure 4(a)). The serum levels of proinflammatory cytokines (i.e., IL-1β, IL-6, and TNF-α) were decreased in mice treated with IELLQAR (Figure 4(b)).
Table 2

Intervention effects on lipid fractions in ApoE mice.

VehicleIELLQAR (1 mg/kg)IELLQAR (3 mg/kg)
Weight (g)30.90 ± 2.3329.69 ± 1.5931.69 ± 3.32
TC (mg/dL)513.69 ± 102.39496.36 ± 69.63476.93 ± 69.97
HDL (mg/dL)92.93 ± 35.6999.63 ± 21.39103.69 ± 25.69
LDL-C/VLDL-C (mg/dL)439.63 ± 125.69421.93 ± 101.39396.69 ± 98.65

Serum was collected, and lipid fractions were quantified in each regimen. Data are expressed as the mean ± SEM (n = 8). HDL: high-density lipoprotein cholesterol; LDL-C: low-density lipoprotein cholesterol; TC: total cholesterol; VLDL-C: very low-density lipoprotein cholesterol.

Figure 3

IELLQAR decreases atherosclerotic lesions in WTD-induced mice. Eight-week-old male ApoE mice were randomized into one of three treatment groups: IELLQAR (1 or 3 mg/kg) or vehicle. All mice were fed a high-fat diet for 12 weeks. (a) Representative images of Oil red O staining of the whole aorta after en face preparation and quantification of lipid content (lipid content/vascular area) (n ≥ 8). (b) Representative histological analysis results of the aortic sinus following H&E, Masson's trichrome, and Movat staining and quantification of the plaque area (plaque area/lumen area), collagen content (collagen content/plaque area), and necrotic area (necrotic area/plaque area) in the aortic sinus (n ≥ 5). Scale bar: 200 μm. Data are presented as the mean ± SEM. ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

Figure 4

IELLQAR decreases monocyte infiltration and serum proinflammatory cytokine levels in WTD-induced mice. Mice were treated as described in Figure 3. (a) Representative images of immunohistochemical staining of lesions in the aortic sinus with CD68 (n ≥ 5). Scale bar: 200 μm. (b) Serum IL-1β, IL-6, and TNF-α levels were measured by ELISA (n ≥ 5). Data are presented as the mean ± SEM; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

3.4. IELLQAR Decreased PLCA-Induced Atherosclerosis and Impaired Ly-6Chigh Monocyte Recruitment to the Arterial Walls

Recent studies suggest that disturbed blood flow-induced shear stress can induce atherosclerosis in humans and animals without a high-fat diet [18, 19]. Thus, a PLCA model of atherosclerosis was created. H&E-stained sections from the carotid artery were examined to understand the extent and distribution of plaque formation as a determination of atherosclerotic lesions. As shown in Figure 5(a), at 4 weeks after PLCA surgery, no plaque formation was observed in the sham group, and IELLQAR significantly reduced the lesion area in the carotid artery as compared to treatment with the vehicle only.
Figure 5

IELLQAR decreases PLCA-induced atherosclerosis and impaired Ly-6Chigh monocyte recruitment to the arterial walls of ApoE mice. Eight-week-old male ApoE-deficient mice randomized into four treatment groups, sham group, normal saline (NS), and two IELLQAR treatment groups (1 and 3 mg/kg), and fed a normal chow diet for 4 weeks. In PLCA surgery, three (left external carotid, internal carotid, and occipital artery) of the four branches of ApoE mice were ligated, and only the superior thyroid artery was left to provide blood circulation. (a) Representative histological analysis results of the carotid artery following H&E staining (n ≥ 5). Scale bar: 50 μm. (b) Flow cytometric dot plots showing the percentage of CD45+CD11b+Ly-6Chigh monocytes in circulation. (c) Representative histological analysis results of the carotid artery following immunofluorescence staining with Ly-6C (n ≥ 5). Scale bar: 50 μm and 25 μm, respectively. (d) The mRNA expression levels of MCP-1, CCR2, and ICAM-1 in carotid artery tissue were measured by qRT-PCR (n ≥ 5). Data are presented as the mean ± SEM; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

In the PLCA model, P-selectin expressed by dysfunctional and regenerating endothelial cells and adherent platelets contributes to monocyte recruitment to the carotid arterial wall [18, 20]. First, the number of peripheral CD45+CD11b+Ly-6Chigh monocytes was measured. Flow cytometry showed that inflammatory monocytes were downregulated after administration of IELLQAR, as compared with treatment with the vehicle only (Figure 5(b)). Also, treatment with the vehicle resulted in numerous accumulation of Ly-6C+ monocytes in the carotid artery, while these cells were rarely observed in the carotid artery following IELLQAR treatment (Figure 5(c)). Moreover, the expression of the chemokine MCP-1 and its receptor CCR2, as well as the adhesion molecule ICAM-1, in the artery was significantly decreased by IELLQAR treatment (Figure 5(d)).

3.5. IELLQAR Inhibited Monocyte Activation by P-Selectin-Dependent Activation of the NF-κB and mTOR Pathways

Binding of P-selectin to monocytes enhanced nuclear translocation of NF-κB and secretion of the chemokines MCP-1 and TNF-α in response to stimulation [7]. To study the effect of IELLQAR on the activation of monocytes, the phosphorylation status of IκBα and NF-κB p65 in PBMCs treated with P-selectin was assessed at different time points (0, 10, 20, 40, and 80 min). The results showed that P-selectin activated the NF-κB pathway with increased phosphorylation of IκBα and P65 and degradation of IκBα in a time-dependent manner (Figure 6(a)). IELLQAR strongly inhibited the phosphorylation and degradation of the NF-κB p65 subunit at the background of P-selectin, and the inhibitory effect was dose-dependent (Figure 6(b)). With P-selectin stimulation of PBMCs, all inflammation-related cytokine genes were highly upregulated as compared with the control group. IELLQAR showed an inhibitory effect on the P-selectin-induced expression of inflammation-related cytokine genes, while IELLQAR failed to suppress LPS-induced upregulation of IL-6, TNF-α, and MCP-1 (Figure 6(c)).
Figure 6

IELLQAR inhibited monocyte activation by P-selectin-dependent activation of the NF-κB pathways. (a) PBMCs were treated with P-selectin (10 μg/mL) for different times. Representative Western blots showing the expression levels of total and phosphorylated IκBα and P65. (b) PBMCs were treated with IELLQAR (1, 3, or 10 μM) and coincubated with or without 10 μg/mL of P-selectin for 30 min. Representative Western blots showing the expression levels of total and phosphorylated IκBα and P65. (c) PBMCs were treated with PBS, LPS (1 μg/ml), P-selectin, IELLQAR (10 μM) plus P-selectin, or IELLQAR plus LPS for 2 h, and the mRNA expression levels of IL-6, TNF-α, and MCP-1 were measured by qRT-PCR. Data are presented as the mean ± SEM (n = 3). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

PSGL-1 ligation in human monocytes induced mTOR signaling and mTOR blockade, which limited M1 polarization of monocytes [6, 21]. Analysis of the phosphorylation status of PI3K P85, Akt, and mTOR in PBMCs treated with P-selectin at different time points showed that the expression of PI3K/Akt/mTOR pathway proteins was increased by P-selectin treatment (Figure 7(a)). Correspondingly, IELLQAR inhibited the P-selectin-induced activation of the PI3K/Akt/mTOR pathway in PBMCs (Figure 7(b)).
Figure 7

(a, b) IELLQAR inhibited monocyte activation by P-selectin-dependent activation of the PI3K/Akt/mTOR pathways. PBMCs were treated as described in Figure 6, and the expression levels of total and phosphorylated PI3K P85, Akt, and mTOR were determined by Western blot. Data are presented as the mean ± SEM (n = 3). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

Subsequently, we investigated whether IELLQAR directly inhibited the NF-κB or PI3K/Akt/mTOR pathways. When PBMCs were stimulated with LPS or TNF-α to activate NF-κB, IELLQAR failed to suppress the phosphorylation and degradation of the NF-κB p65 subunit (Figure 8(a)). Interestingly, treatment with IELLQAR failed to inhibit the upregulated expression of the mTOR pathway proteins stimulated by the mTOR agonists MHY1485 and 3BDO (Figure 8(b)). Together, these results indicated that IELLQAR had inhibitory effects on the P-selectin-dependent NF-κB and PI3K/Akt/mTOR pathways in monocytes.
Figure 8

IELLQAR failed to directly inhibit the NF-κB and mTOR pathways. (a) PBMCs were treated with 1 μg/ml LPS or 100 ng/mL TNF-α in the presence or absence of IELLQAR for 30 min. Representative Western blots showing the expression levels of total and phosphorylated P65. (b) PBMCs were treated with 2 μM MHY1485 or 60 μM 3BDO in the presence or absence of IELLQAR for 30 min. Representative Western blots showing the expression levels of total and phosphorylated mTOR. The intensities of the protein bands were quantified and are presented as the ratio of phosphorylated protein/total protein after normalization to GAPDH. Data are presented as the mean ± SEM (n = 3). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

4. Discussion

The selectins, particularly P-selectin, have been shown to contribute to inflammatory diseases [11, 22], thrombosis [23], and cancer [24]. Therefore, the pharmacological blockade of the selectin/PSGL-1 interaction represents an important therapeutic target. In this study, a peptide analogue of selectin ligands was used to investigate the effect on atherogenesis and the mechanism underlying the inhibition of monocyte activation. The results showed that (1) IELLQAR inhibited the binding of P-, E-, and L-selectins to PBMCs and THP-1 cells and reduced the adhesion of these cells to the endothelium; (2) IELLQAR attenuated both WDT- and PLCA-induced atherosclerotic development in ApoE mice; (3) IELLQAR inhibited monocyte infiltration of arterial lesions, particularly Ly-6Chigh monocytes; and (4) IELLQAR inhibited monocyte activation through P-selectin-dependent activation of the NF-κB and PI3K/Akt/mTOR pathways. The initial tethering and rolling of monocytes over the vascular endothelium are dependent on interactions between selectins and the corresponding glycosylated ligands and are imperative to extravasate into the inflammatory lesions [25, 26]. Patients with inflammatory disorders typically have higher levels of activated platelets and endothelium displaying P-selectin, which subsequently increases platelet-leukocyte aggregation and leukocyte-endothelium adhesion, as well as greater amounts of soluble P-selectin in the peripheral blood [27, 28]. Our previous works showed that serum concentration of P-selectin was higher in coronary heart disease patients than normal individuals. In addition, P-selectin or PSGL-1 deficiency clearly attenuated the development of atherosclerosis when these mice were crossed into an ApoE background, and monocyte infiltration was significantly reduced in double-deficient mice (unpublished data). Recent studies suggested that inhibition of P-selectin with either an anti-P-selectin or PSGL-1 can significantly decrease neutrophil and platelet adhesions, macrophage accumulation, and neointimal formation [29, 30]. Although antiselectin strategies have shown therapeutic value in clinical treatment, Abs tend to be relatively large molecules, and the shallow nature of the P-selectin ligand-binding sites can lead to poor pharmacokinetics [8]. Previous studies demonstrated that posttranslational glycosylation by glycosyltransferases is necessary for selectin ligand activity. Several glycosyltransferases, such as α2,3-sialyltransferases IV, α1,3-fucosyltransferases IV and VII, and core 2 β1,6-N-acetylglucosaminyltransferase-I, are considered to participate in the synthesis of core 2 decorated O-glycan structures carrying the tetrasaccharide sialyl Lewis X and the initiation of atherosclerotic lesions [31-33]. Thus, an alternative approach is to reduce the cell surface of functional PSGL-1, in particular sLeX. To date, attempts to inhibit the biosynthesis of sLeX have been accomplished by interfering with functional glycosylation sites of sLeX to inhibit galactosylation [34], sialylation [35], and fucosylation [36]. IELLQAR, a peptide analogue of selectin ligands, potently blocks binding to the natural selectin ligand sLeX with substantially high affinity, with an IC50 value of 10−5 M [13]. The results of the present study confirmed that IELLQAR potently blocks binding to the natural selectin ligand sLeX in a dose-dependent manner to inhibit the binding of the P-, E-, and L-selectins to monocytes, with the highest inhibition against P-selectin binding to PBMCs (IC50: ~5 μM) and THP-1 cells (IC50: ~10 μM). P-Selectin induced the β2 integrin to adopt an extended conformation associated with the intermediate affinity state, which supports leukocyte deceleration and cell arrest in the endothelium [5, 37]. The binding of integrins to CAMs promotes further adhesion and signal transmission. As predicted, P-selectin enhanced the expression of CD11b on the surface of monocytes in this study, while IELLQAR remarkably decreased this effect. In the following adhesion assays, IELLQAR attenuated P-selectin-induced adhesion to the endothelium. The MCP-1/CCR2 axis plays a key role in the initial adhesion of monocytes to the endothelium. Previous studies of hypercholesterolemic mice lacking ApoE or the low-density lipoprotein receptor have suggested a role of MCP-1 in monocyte recruitment to early atherosclerotic lesions [38, 39]. We found that treatment with IELLQAR decreased monocyte infiltration of the arterial wall, which may have resulted from decreased expression levels of MCP-1, CCR2, and ICAM-1. Monocyte and macrophage phenotypes are highly heterogeneous and undergo phenotypic changes. Classical activation, such as LPS or ox-LDL, promotes a proinflammatory (M1-like) response, including the secretion of proinflammatory cytokines, which is a pivotal process in the development of atherogenesis [2, 4]. Thus, inhibition of monocyte activation is a powerful therapeutic target for the prevention and treatment of atherosclerosis. NF-κB is a key regulator of monocytes in systematic inflammation, as with atherosclerosis [40]. Our previous study suggested that PSGL-1 ligation of dendritic cells by P-selectin markedly induced phenotypic maturation and enhanced secretion of inflammatory cytokines and communication with T cells (unpublished data). Recent studies have reported that the mTOR inhibitor inhibited MCP-1 expression and macrophage accumulation, as well as decreased the size of the atherosclerotic lesion. Interestingly, Gao et al. reported that the activation of mTOR mediated NF-κB activation in monocytes and upregulated the production of inflammatory factors in patients with coronary heart disease [41]. The results of the present study showed that P-selectin induced expression of IL-1β, MCP-1, and TNF-α and activation of the NF-κB and mTOR pathways in monocytes. In contrast, the selectin inhibitor IELLQAR markedly reversed these effects. Furthermore, IELLQAR decreased the amount of inflammatory Ly-6Chigh monocytes and the associated proinflammatory cytokines IL-6, TNF-α, and IL-1β. Notably, IELLQAR administration failed to inhibit both LPS- and TNF-α-induced NF-κB activation, while MHY1485 and 3BDO induced mTOR activation, as well as the expression of associated cytokines. Together, these results suggested that IELLQAR could not directly inhibit activation of the NF-κB and mTOR pathways, while P-selectin attenuated the activation of these pathways. However, the mechanism in which the P-selectin inhibitor IELLQAR attenuates NF-κB and mTOR activation remains unclear; thus, further investigations are required to address this hypothesis.

5. Conclusion

In summary, we reported that the IELLQAR peptide analogue of selectin ligands with high inhibitory effect on P-selectin binding to monocytes (PBMCs: IC50 ~5 μM; THP-1 cells: IC50 ~10 μM) is an efficient selectin inhibitor that can inhibit the capacity of monocytes to adhere to the endothelium. Importantly, IELLQAR attenuated atherosclerotic development and monocyte infiltration in both WDT- and PLCA-induced atherosclerosis in ApoE mice. Also, IELLQAR attenuated P-selectin-induced activation of the NF-κB and mTOR pathways, as well as the expression of proinflammatory cytokines. Hence, use of the IELLQAR peptide provides a new approach and represents a promising candidate for the treatment of atherosclerosis in the early stage of disease.
  40 in total

1.  A peptide mimic of E-selectin ligand inhibits sialyl Lewis X-dependent lung colonization of tumor cells.

Authors:  M N Fukuda; C Ohyama; K Lowitz; O Matsuo; R Pasqualini; E Ruoslahti; M Fukuda
Journal:  Cancer Res       Date:  2000-01-15       Impact factor: 12.701

2.  Insights into the molecular basis of leukocyte tethering and rolling revealed by structures of P- and E-selectin bound to SLe(X) and PSGL-1.

Authors:  W S Somers; J Tang; G D Shaw; R T Camphausen
Journal:  Cell       Date:  2000-10-27       Impact factor: 41.582

3.  Single injection of P-selectin or P-selectin glycoprotein ligand-1 monoclonal antibody blocks neointima formation after arterial injury in apolipoprotein E-deficient mice.

Authors:  J William Phillips; Kurt G Barringhaus; John M Sanders; Sean E Hesselbacher; Ann C Czarnik; David Manka; Dietmar Vestweber; Klaus Ley; Ian J Sarembock
Journal:  Circulation       Date:  2003-04-21       Impact factor: 29.690

Review 4.  The adhesion molecule P-selectin and cardiovascular disease.

Authors:  Andrew D Blann; Sunil K Nadar; Gregory Y H Lip
Journal:  Eur Heart J       Date:  2003-12       Impact factor: 29.983

5.  Inhibition of NF-kappaB activation in macrophages increases atherosclerosis in LDL receptor-deficient mice.

Authors:  Edwin Kanters; Manolis Pasparakis; Marion J J Gijbels; Monique N Vergouwe; Iris Partouns-Hendriks; Remond J A Fijneman; Björn E Clausen; Irmgard Förster; Mark M Kockx; Klaus Rajewsky; Georg Kraal; Marten H Hofker; Menno P J de Winther
Journal:  J Clin Invest       Date:  2003-10       Impact factor: 14.808

6.  A peptide mimic of selectin ligands abolishes in vivo inflammation but has no effect on the rat heart allograft survival1.

Authors:  Risto Renkonen; Michiko N Fukuda; Lubomir Petrov; Timo Paavonen; Jutta Renkonen; Pekka Häyry; Minoru Fukuda
Journal:  Transplantation       Date:  2002-07-15       Impact factor: 4.939

7.  Alpha(1,3)fucosyltransferases FucT-IV and FucT-VII control susceptibility to atherosclerosis in apolipoprotein E-/- mice.

Authors:  Jonathon W Homeister; Alan Daugherty; John B Lowe
Journal:  Arterioscler Thromb Vasc Biol       Date:  2004-08-12       Impact factor: 8.311

8.  P-selectin binding to P-selectin glycoprotein ligand-1 induces an intermediate state of alphaMbeta2 activation and acts cooperatively with extracellular stimuli to support maximal adhesion of human neutrophils.

Authors:  Yan-Qing Ma; Edward F Plow; Jian-Guo Geng
Journal:  Blood       Date:  2004-06-24       Impact factor: 22.113

9.  Sialyl Lewis X-dependent lung colonization of B16 melanoma cells through a selectin-like endothelial receptor distinct from E- or P-selectin.

Authors:  Jianing Zhang; Jun Nakayama; Chikara Ohyama; Masami Suzuki; Atsushi Suzuki; Minoru Fukuda; Michiko N Fukuda
Journal:  Cancer Res       Date:  2002-08-01       Impact factor: 12.701

10.  Accumulation of tissue factor into developing thrombi in vivo is dependent upon microparticle P-selectin glycoprotein ligand 1 and platelet P-selectin.

Authors:  Shahrokh Falati; Qingde Liu; Peter Gross; Glenn Merrill-Skoloff; Janet Chou; Erik Vandendries; Alessandro Celi; Kevin Croce; Barbara C Furie; Bruce Furie
Journal:  J Exp Med       Date:  2003-06-02       Impact factor: 14.307

View more
  5 in total

1.  Synergetic Enhancement of Tumor Double-Targeted MRI Nano-Probe.

Authors:  Nikita Yabbarov; Elena Nikolskaya; Maria Sokol; Mariia Mollaeva; Margarita Chirkina; Irina Seregina; Mikhail Gulyaev; Yury Pirogov; Rem Petrov
Journal:  Int J Mol Sci       Date:  2022-03-14       Impact factor: 5.923

Review 2.  Selectins-The Two Dr. Jekyll and Mr. Hyde Faces of Adhesion Molecules-A Review.

Authors:  Igor Tvaroška; Chandrabose Selvaraj; Jaroslav Koča
Journal:  Molecules       Date:  2020-06-19       Impact factor: 4.411

Review 3.  Where the Action Is-Leukocyte Recruitment in Atherosclerosis.

Authors:  Carina Mauersberger; Julia Hinterdobler; Heribert Schunkert; Thorsten Kessler; Hendrik B Sager
Journal:  Front Cardiovasc Med       Date:  2022-01-11

Review 4.  Nanobiotechnology approaches for cardiovascular diseases: site-specific targeting of drugs and nanoparticles for atherothrombosis.

Authors:  Haikun Liu; Geoffrey Pietersz; Karlheinz Peter; Xiaowei Wang
Journal:  J Nanobiotechnology       Date:  2022-02-08       Impact factor: 10.435

5.  Trypanosoma cruzi Exploits E- and P-Selectins To Migrate Across Endothelial Cells and Extracellular Matrix Proteins.

Authors:  Smaro Panagiotidou; Marina Anastasiou; Pilar Alcaide; Mercio A Perrin
Journal:  Infect Immun       Date:  2021-07-06       Impact factor: 3.441

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.