Literature DB >> 31182149

Frequency of putative periodontal pathogens among type 1 diabetes mellitus: a case-control study.

Krishnan Mahalakshmi1, Ponnudurai Arangannal2.   

Abstract

OBJECTIVE: The aim of the present study is to compare and assess the risk of periodontitis due to the presence of four putative periodontopathic bacteria viz., Eikenella corrodens, Campylobacter rectus, Prevotella intermedia and Prevotella nigrescens. To fulfil the above objective, polymerase Chain reaction using the primers targeting 16S rRNA gene of the bacterial species was performed with the subgingival plaque collected from the permanent first molars of type 1 diabetic children and age matched healthy children.
RESULTS: The prevalence of periodontal pathogens in diabetic and healthy children was 6% and 16% for E. corrodens, 18% and 36% for C. rectus, 2% and 2% for P. intermedia, 4% and 0%, for P. nigrescens respectively. Statistically, significant difference was not observed for the prevalence of all the four periodontal pathogens between type 1 diabetic and healthy children (P = 1.00). The results of the present study thus reveal a negative correlation of type I diabetes to periodontitis in association to Eikenella corrodens, Campylobacter rectus, Prevotella intermedia and Prevotella nigrescens.

Entities:  

Keywords:  Campylobacter rectus; Eikenella corrodens; PCR; Prevotella intermedia; Prevotella nigrescens; Type 1 diabetes mellitus

Mesh:

Substances:

Year:  2019        PMID: 31182149      PMCID: PMC6558758          DOI: 10.1186/s13104-019-4364-3

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Introduction

Type 1 diabetes mellitus (T1DM) is usually diagnosed in children and young adults and was previously known as juvenile diabetes. The diagnosis of type 1 diabetes can be made at any age, but it usually manifests in childhood, adolescence or early adulthood, before the age of 20 [1]. American Diabetes Association has reported type 1 diabetes in 5–10% of patients with diabetes [1]. Periodontal diseases are the sixth most common complication among the varied systemic complications of uncontrolled diabetes [2]. Periodontal disease is caused by Gram-negative anaerobic subgingival microflora [3, 4]. These gram-negative periodontal pathogens have been detected in high frequency in adults with long-duration insulin-dependent diabetics [5]. The prevalence of gram-negative periodontal bacterial pathogens and its positive correlation to periodontal disease have been widely reported in type 2 diabetic population. In addition the subgingival microbiota in diabetes patients with periodontitis generally is similar to that observed in patients with periodontitis who are not diabetic [6-11]. Barring our earlier study, hardly there are any previous reports correlating T1DM and periodontitis with regard to the prevalence of periodontal bacterial pathogens [12]. The aim of the present study was to compare the prevalence and assess the risk of four other key periodontopathic bacteria viz., Eikenella corrodens, Campylobacter rectus, Prevotella intermedia and Prevotella nigrescens among the type 1 diabetic children and healthy children/adolescents between the age group of 7 and 14 years, using polymerase chain reaction. identification of these periodontopathic bacteria in children with type 1 diabetes can act as a biomarker for risk of periodontitis.

Main text

Methods

The present study was cleared by the institutional ethics committee of Sree Balaji Dental College and Hospital, Chennai and the Department of Endocrinology and Diabetology, Institute of Child Health and Hospital for Children (ICHS), Chennai. Type 1 diabetic children/adolescents (n = 50) were recruited based on the following inclusion and exclusion criteria. Healthy children/adolescents (n = 50) attending the Department of Paedodontics and Preventive Dentistry, Sree Balaji Dental College and Hospital, Chennai were included as control group. Children with confirmed diagnosis of T1DM, age between 7 and 14 years, the presence of all permanent first molars, were the inclusion criteria. Children with diabetic related systemic complications, children who had professional dental cleaning and periodontal therapy within the last 6 months, antibiotic therapy within the last 3 months and history of orthodontic treatment were excluded. Children with no systemic diseases, age between 7 and 14 years and with the presence of all permanent first molars were the inclusion criteria for the control group. Informed consent was obtained from the parents/guardian of all the children enrolled in the study. Plaque index [13] and gingival index [14] were recorded to assess for periodontitis. Bleeding on probing was more in T1DM children/adolescents. The clinical parameters were recorded by a single examiner (pedodontist) with 5 years of experience in the field. The probing depths ranged between 3 and 5 mm. After removal of supragingival plaque with sterile cotton roll, the subgingival plaque was collected using sterile Gracey curette from the buccal surface of all first permanent molars. The subgingival plaque was pooled in sterile eppendorf tubes containing 500 μl of phosphate buffered saline (pH 7.8). The samples were stored at − 20° until assayed. (Deep Freezer, Blue star).

PCR analysis

PCR analysis was carried out in the Microbiology laboratory of Sree Balaji Dental College and Hospital, DNA extraction was performed by boiling-lysis method and the supernatant was used as the template for PCR assay. Species—specific primers for amplification of the target organisms have been used as suggested by previous studies (Table 1) [15]. PCR cocktail (50 μL) for the detection of 16S rRNA of the four bacterial species contained 5 μl of 10× PCR buffer (pH 8.4), 1 U Taq DNA polymerase (Bangalore genei, India.), 0.25 mMol/L of each deoxyribonucleotides (dNTP) (Medox Biotech India Pvt., Ltd.), 1.5 mM MgCl2 (Sigma-Aldrich Pvt., Ltd.), 0.5 μM of each primer (Sigma-Aldrich Pvt., Ltd.) and 5 μL of the template. The DNA of bacterial sequences submitted to Gen Bank under accession no’s HQ269826, HQ269827, HQ202263 and HQ202264 were used as positive controls. PCR was carried out for 35 cycles with each cycle consisting of denaturation (94 °C for 5 min), annealing (50 °C for 1 min) and primer extension (72 °C for 1.5 min). Amplified PCR products were analyzed in 1.5% agar gel electrophoresis in Tris–Borate-EDTA buffer. The gel was stained with 0.5 µg/mL ethidium bromide and photographed under BioRad UV gel documentation system. 100 bp ladder (Medox Biotech India Pvt Ltd) served as the molecular weight marker.
Table 1

Species specific primers for PCR assay [15]

Primer pairs (5′–3′), 16S rRNAAmplicon length in bp
Eikenella corrodens
 CTAATACCGCATACGTCCTAAG688
 CTACTAAGCAATCAAGTTGCCC
Campylobacter rectus
 TTTCGGAGCGTAAAACTCCTTTTC598
 TTTCTGCAAGCAGACACTTTT
Prevotella intermedia
 TTTGTTGGGGATAAAGCGGG575
 TCAACATCTCTGTATCCTGCGT
Prevotella nigrescens
 ATGAAACAAAGGTTTCCGGTAAG804
 CCCACGTCTCTGTGGGCTGCGA
Species specific primers for PCR assay [15] The P-value was obtained by Fisher’s exact test (two-tailed). SPSS software 15 was used for all statistical analysis. In the present study, P < 0.05 was considered statistically significant. The odds ratio at 95% confidence interval was calculated to assess the association of the bacterial species to type I diabetes.

Results

The subgingival plaque samples of type I diabetic children and healthy children amplified the 16S rRNA gene of E. corrodens, C. rectus, P. intermedia and P. nigrescens in the product size of 688 bp, 598 bp, 575 bp and 804 bp respectively. None of the samples showed non-specific amplification. Table 2 shows the clinical parameters measured. A significant difference was not noticed among the T1DM and control group with regard to PD. The Plaque index was 0.35 and 0.37 for T1DM and healthy group respectively. While the gingival index was 0.88 and 0.44 for T1DM and healthy group respectively. The level of gingival bleeding (gingival index—0.88) on probing was slightly high in T1DM children. The HbA1c level of children with T1DM ranged between 5.66 and 11.50%. About 45% of the T1DM children HbA1c readings were above 8.0%. The duration of diabetes among T1DM subjects ranged 3–7 years. Table 3 shows the prevalence of four bacterial species in type I diabetic group and healthy subjects. Three of type I diabetic children showed co-occurrence of E. corrodens and C. rectus. While in healthy children five samples showed co-occurrence of E. corrodens and C. rectus. All four organisms were not present in the same subject’s subgingival plaque. T The association between T1DM and healthy subjects is not statistically significant with respect to prevalence of all the four bacterial species screened.
Table 2

Measured clinical parameters in the study group and healthy subjects

Clinical parametersT1DM/healthy rangeT1DM/healthy meanP value
Plaque index (PI)0.2–0.6/0.2–0.60.3/0.31.000
Gingival index (GI)0.6–0.9/0.2–0.70.8/0.41.000
HbA1c %5.66–11.50/NA8.9/NANA
Duration of diabetes3–7 years/NA5 years/NANA
Table 3

Prevalence of four periodontopathic bacterial species among the study group and healthy subjects

Bacterial speciesType 1 diabetic group(n = 50) (%)Healthy group(n = 50) (%)P value
Eikenella corrodens 3 (6)8 (16)0.199
Campylobacter rectus 9 (18)18 (36)0.071
Prevotella intermedia 1 (2)1 (2)1.000
Prevotella nigrescens 2 (4)0 (0)0.495
Measured clinical parameters in the study group and healthy subjects Prevalence of four periodontopathic bacterial species among the study group and healthy subjects The odds ratio (at 95% confidence interval)/risk ratio calculated for E. corrodens, C. rectus, P. intermedia and P. nigrescens were 0.3351/0.375, 0.3902/0.5, 1/1 and ∞/∞ respectively.

Discussion

Earlier studies have documented that diabetes may interfere with progression of periodontal disease [16-18]. The point that periodontal disease may complicate the severity of diabetes by worsening the degree of glycemic control has also been established [19, 20]. It is a well-recognised fact that diabetes mellitus is a risk factor for progression of periodontitis in adults [2]. Among the long term complication periodontitis is a 6th most complication for uncontrolled diabetes. Gram negative anaerobes are implicated in the etiopathogenesis of periodontitis and hence identification of putative periodontal pathogens can act as a marker for onset of periodontitis. Although culture techniques are gold standard, cultivating these obligate anaerobes are very difficult as they lose viability once exposed to oxygen, which may result in error report. Hence, PCR technique was chosen to screen for these periodontal pathogens. The association between periodontal disease and diabetes mellitus with respect to gram-negative anaerobes in the adult population has been widely studied [13, 21, 22]. While data regarding the prevalence of periodontopathic bacteria among type I diabetic children are lacking. A very low prevalence of P. intermedia was observed in T1DM and healthy cohorts. This is in line with Mohamed et al. [13] study but for type 2 diabetic groups. Similarly P. nigrescens, a black pigmented putative periodontal pathogen was present only in two samples of the T1DM group. While P. nigrescens was completely absent among healthy children. No correlation was observed with the presence of four putative periodontopathic bacteria viz., E. corrodens, C. rectus, P. intermedia and P. nigrescens to bleeding on probing and probing depth among type 1 diabetes. Although significant difference was not observed between the type I diabetes and healthy controls with regard to the prevalence of the bacterial species screened, there was increased bleeding on probing in the gingiva of type 1 diabetic children. This finding was similar to two previous reports on periodontal changes among type I diabetic children [23, 24]. The odds ratio clearly reveals a negative correlation to the prevalence of key periodontal bacterial pathogens and T1DM. However, the present study reports a very low prevalence of these anaerobic bacteria in children/adolescents. This finding shows that Children with T1DM are not at risk of developing periodontitis due to these anaerobic bacterial species as against the adults with type 2 diabetes The concurrent finding among type I diabetic and healthy children in the present study with respect to bacterial profiles is well in agreement with Lalla et al. [7]. The prevalence of P. intermedia in the present study does not corroborate with the study of Okada et al. [25] who has reported significantly higher prevalence among healthy children. An absence of significant statistical difference between type 1 diabetic and healthy cohort with regard to the prevalence of E. corrodens, C. rectus, P. intermedia and P. nigrescens is well in agreement with various other previous reports [5, 8, 10, 25–27]. The present paper emphasizes a negative association of the screened periodontal pathogens to periodontitis among T1DM children. Several earlier observational studies have reported the risk of periodontitis among type 2 diabetes mellitus on the basis of clinical parameters. While, the present study highlights a negative correlation to T1DM with regard to the presence of putative periodontopathic bacterial species in the subgingival plaque of children. Further studies with large sample size are needed to correlate an association between T1DM and periodontitis. To conclude, the results of the present study suggest that type 1 diabetes has no significant influence on the prevalence periodontal bacterial species screened. The results show an absence of risk to periodontitis due to these pathogens in T1DM children.

Limitations

Large follow-up studies to screen for array of periodontal pathogens to study their association to type 1 diabetes among children and adolescents. 16S rRNA metagenomic analysis of subgingival plaque may further help to trace the potential effect of type 1 diabetes on bacterial composition of dental plaque.
  27 in total

1.  PCR detection of 5 putative periodontal pathogens in dental plaque samples from children 2 to 12 years of age.

Authors:  M Okada; F Hayashi; N Nagasaka
Journal:  J Clin Periodontol       Date:  2001-06       Impact factor: 8.728

2.  PERIODONTAL DISEASE IN PREGNANCY. II. CORRELATION BETWEEN ORAL HYGIENE AND PERIODONTAL CONDTION.

Authors:  J SILNESS; H LOE
Journal:  Acta Odontol Scand       Date:  1964-02       Impact factor: 2.331

3.  Distribution of genotypes of Porphyromonas gingivalis in type 2 diabetic patients with periodontitis in Mexico.

Authors:  Claudia Davila-Perez; Atsuo Amano; Angel Gabriel Alpuche-Solis; Nuria Patiño-Marin; America Patricia Pontigo-Loyola; Shigeyuki Hamada; Juan Pablo Loyola-Rodriguez
Journal:  J Clin Periodontol       Date:  2006-11-20       Impact factor: 8.728

Review 4.  Care of children and adolescents with type 1 diabetes: a statement of the American Diabetes Association.

Authors:  Janet Silverstein; Georgeanna Klingensmith; Kenneth Copeland; Leslie Plotnick; Francine Kaufman; Lori Laffel; Larry Deeb; Margaret Grey; Barbara Anderson; Lea Ann Holzmeister; Nathaniel Clark
Journal:  Diabetes Care       Date:  2005-01       Impact factor: 19.112

Review 5.  Periodontal microbial ecology.

Authors:  Sigmund S Socransky; Anne D Haffajee
Journal:  Periodontol 2000       Date:  2005       Impact factor: 7.589

Review 6.  Insulin resistance and periodontal disease: an epidemiologic overview of research needs and future directions.

Authors:  R P Donahue; T Wu
Journal:  Ann Periodontol       Date:  2001-12

7.  Diabetes and periodontal disease: a case-control study.

Authors:  Guglielmo Campus; Abeer Salem; Sergio Uzzau; Edoardo Baldoni; Giancarlo Tonolo
Journal:  J Periodontol       Date:  2005-03       Impact factor: 6.993

8.  Periodontal changes in children and adolescents with diabetes: a case-control study.

Authors:  Evanthia Lalla; Bin Cheng; Shantanu Lal; Sid Tucker; Ellen Greenberg; Robin Goland; Ira B Lamster
Journal:  Diabetes Care       Date:  2006-02       Impact factor: 19.112

9.  Periodontal infection profiles in type 1 diabetes.

Authors:  Evanthia Lalla; Selma Kaplan; Shu-mei J Chang; Georg A Roth; Romanita Celenti; Karen Hinckley; Ellen Greenberg; Panos N Papapanou
Journal:  J Clin Periodontol       Date:  2006-12       Impact factor: 8.728

10.  The microbiological profiles of saliva, supragingival and subgingival plaque and dental caries in adults with and without type 2 diabetes mellitus.

Authors:  J Hintao; R Teanpaisan; V Chongsuvivatwong; C Ratarasan; G Dahlen
Journal:  Oral Microbiol Immunol       Date:  2007-06
View more
  2 in total

1.  Does Periodontal Inflammation Affect Type 1 Diabetes in Childhood and Adolescence? A Meta-Analysis.

Authors:  Biagio Rapone; Massimo Corsalini; Ilaria Converti; Maria Teresa Loverro; Antonio Gnoni; Paolo Trerotoli; Elisabetta Ferrara
Journal:  Front Endocrinol (Lausanne)       Date:  2020-05-05       Impact factor: 5.555

Review 2.  Periodontitis, Metabolic and Gastrointestinal Tract Diseases: Current Perspectives on Possible Pathogenic Connections.

Authors:  Dorin Nicolae Gheorghe; Adrian Camen; Dora Maria Popescu; Cerasella Sincar; Allma Pitru; Claudiu Marinel Ionele; Flavia Mirela Nicolae; Claudia Monica Danilescu; Alexandra Roman; Cristina Florescu
Journal:  J Pers Med       Date:  2022-02-24
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.