Hao Gao1, Xiaofeng Li1, Guangxi Zhan1, Yong Zhu2, Jing Yu3, Jiapo Wang1, Li Li1, Weimin Wu1, Na Liu1, Xiaoqing Guo1. 1. a Department of Obstetrics and Gynecology, Shanghai First Maternity and Infant Hospital , Tongji University School of Medicine , Shanghai , China. 2. b Department of Obstetrics and Gynecology , Central Theater of the Chinese PLA , Wuhan , China. 3. c Department of Pathology, Shanghai First Maternity and Infant Hospital , Tongji University School of Medicine , Shanghai , China.
Abstract
Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy, and its vulnerability to metastasis contributes to the poor outcomes of EOC patients. Long noncoding RNAs (lncRNAs) were verified to play a pivotal role in EOC metastasis. However, the potential role of lncRNA membrane-associated guanylate kinase inverted 1 (MAGI1) intronic transcript (MAGI1-IT1) in EOC is largely unknown. In this study, the function and mechanisms of MAGI1-IT1 in EOC metastasis were explored profoundly. First, MAGI1-IT1 expression was found to be significantly decreased in overexpressing miR-200a EOC cells. Second, MAGI1-IT1 expression was remarkably increased in metastatic EOC tissues, and high MAGI1-IT1 was dramatically associated with EOC FIGO III-IV stage; in addition, MAGI1-IT1 might be related to EOC dissemination via epithelial-mesenchymal transition (EMT). Next, a series of gain- and loss-of-function assays verified that, although MAGI1-IT1 has no significant role in EOC proliferation and subcutaneous xenograft growth, the upregulation of MAGI1-IT1 can remarkably facilitate EOC EMT phenotype, cells migration and invasion ability and intraperitoneal metastasis in nude mice, while downregulation of MAGI1-IT1 led to the opposite effect in vitro. Moreover, MAGI1-IT1 was validated to promote EOC metastasis through upregulation of ZEB1 and ZEB2 by competitively binding miR-200a, and the restrictive effects of MAGI1-IT1 depletion on EOC metastasis could be reversed by inhibition of miR-200a and upregulation of ZEB1 and ZEB2. Collectively, these results suggest that MAGI1-IT1 may work as a ceRNA in promoting EOC metastasis through miR-200a and ZEB1/2 and may be a potential therapeutic target for EOC.
Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy, and its vulnerability to metastasis contributes to the poor outcomes of EOC patients. Long noncoding RNAs (lncRNAs) were verified to play a pivotal role in EOC metastasis. However, the potential role of lncRNA membrane-associated guanylate kinase inverted 1 (MAGI1) intronic transcript (MAGI1-IT1) in EOC is largely unknown. In this study, the function and mechanisms of MAGI1-IT1 in EOC metastasis were explored profoundly. First, MAGI1-IT1 expression was found to be significantly decreased in overexpressing miR-200a EOC cells. Second, MAGI1-IT1 expression was remarkably increased in metastatic EOC tissues, and high MAGI1-IT1 was dramatically associated with EOC FIGO III-IV stage; in addition, MAGI1-IT1 might be related to EOC dissemination via epithelial-mesenchymal transition (EMT). Next, a series of gain- and loss-of-function assays verified that, although MAGI1-IT1 has no significant role in EOC proliferation and subcutaneous xenograft growth, the upregulation of MAGI1-IT1 can remarkably facilitate EOC EMT phenotype, cells migration and invasion ability and intraperitoneal metastasis in nude mice, while downregulation of MAGI1-IT1 led to the opposite effect in vitro. Moreover, MAGI1-IT1 was validated to promote EOC metastasis through upregulation of ZEB1 and ZEB2 by competitively binding miR-200a, and the restrictive effects of MAGI1-IT1 depletion on EOC metastasis could be reversed by inhibition of miR-200a and upregulation of ZEB1 and ZEB2. Collectively, these results suggest that MAGI1-IT1 may work as a ceRNA in promoting EOC metastasis through miR-200a and ZEB1/2 and may be a potential therapeutic target for EOC.
Entities:
Keywords:
Epithelial ovarian cancer; MAGI1-IT1; ZEB1 and ZEB2; invasion and metastasis; miR-200a
Epithelial ovarian cancer (EOC) is one of the most common gynecological malignancies [1,2]. Since EOC develops pathologically within the pelvic cavity with insidious symptoms and a lack of sensitive clinical screening, the majority of patients are unfortunately diagnosed at an advanced stage [3-5]. In addition, extensive dissemination with a high tumor recurrence rate and poor prognosis are common and severe problems in EOC cases [6-8], therefore, investigating the underlying molecular mechanisms of EOC metastasis and dissemination may help improve the diagnosis of EOC and the evolution of novel therapeutic targets.To date, noncoding RNAs (ncRNAs) have been demonstrated to regulate nearly every level of gene expression, including the activation and repression of homeotic genes and the targeting of chromatin-remodeling complexes [9]. Based on size, ncRNAs are divided into two groups: small ncRNAs, such as microRNAs (miRNAs, ~22 nt) [10], and long noncoding RNAs (lncRNAs, greater than 200 nt) [11,12]. Alterations in the expression of ncRNAs appear to be important for carcinogenesis, and their profile might identify vital tumorigenic pathways [13]. Several studies have shown that lncRNAs may interact with miRNAs and mutually modulate their expression [14,15]. They may function as competing endogenous RNAs (ceRNAs) with miRNAs and subsequently regulate protein coding gene expression by the posttranscriptional silencing of the target RNAs [16,17]. The interaction of lncRNAs and miRNAs may provide new insight into cancer biology.Researchers have validated that the miR-200 family acts as a major regulator of epithelial-mesenchymal transition (EMT) and cell differentiation by suppressing the transcription of repressors ZEB1 and ZEB2 in various cancers [18]. However, the functional role of the miR-200 family in EOC initiation, progression, metastasis, and chemo-response and whether this miRNA family is beneficial or a hindrance to treat the disease are still controversial [19,20]. In our previous study, miR-200a was verified to promote EOC cell proliferation and inhibit the cancer stem cell (CSC) phenotype [21]. In this research, a series of in vitro and in vivo experiments verified that lncRNA membrane-associated guanylate kinase inverted 1 (MAGI1) intronic transcript (MAGI1-IT1) might function as an endogenous sponge for miR-200a in EOC cells, the network of MAGI1-IT1-miR-200a-ZEB1/2 could play an important role in EOC metastasis, and provide novel targets for the molecular treatment of EOC.
Materials and methods
Microarray assay
OVCAR-3-LV-miR-200a and control cells were collected for microarray analysis. The microarray (SBC human 4*180K lncRNA array, Shanghai Biotechnology Corp., Shanghai, China) used in the present study was capable of detecting 77,103 lncRNAs and 18,853 mRNAs and covered core databases, for instance, GENCODE v21 (https://www.gencodegenes.org), Lncipedia v3.1 (https://lncipedia.org), NONCODE v4 (http://www.noncode.org), UCSC Genome Browser (http://genome.ucsc.edu), and Ensembl (http://asia.ensembl.org) and many related studies. Briefly, the RNA samples were first reverse transcribed into cDNA, and these cDNA samples were then labeled and array hybridization according to the Agilent One-Color Microarray-Based Gene Expression Analysis protocol (Agilent Technologies, Santa Clara, CA, USA). Array images were analyzed and raw data were extracted using the Agilent Feature Extraction software, and Gene-Spring software GX v12.1 was employed to finish the basic analysis of the raw data. Differentially expressed lncRNAs between the two groups were then identified through fold change, and adjusted P-value was calculated using multiple tests. Statistically significant differential expression of lncRNA was displayed through volcano plot filtering with a threshold of fold change ≥ 2 and P < 0.05. Then these differentially expressed lncRNAs were explored by using more stringent criteria (Student’s t test, P < 0.05, fold change > 2) and filtered according to transcript abundance. Moreover, the TargetScan prediction software database [www.targetscan.org/] was used to forecast the potential binding miRNAs. Fold-change and p-values were calculated from the normalized expression levels.
Ethical statement
Collection of the EOC and nonmalignant ovarian tissues and the use of archival tissues were approved by the Medical Ethics Committee at Shanghai First Maternity and Infant Hospital. The study was performed according to the Declaration of Helsinki. EOC patients diagnosed in the Shanghai First Maternity and Infant Hospital between December 2014 and December 2016 were recruited. The available medical records, histological slides, and paraffin-embedded tissue blocks associated with 10 cases of FIGO Stage I human nonmetastatic EOC and 24 cases of FIGO Stage II-IV primary and paired metastasis EOC tissues were included in this study, and 20 cases of nonmalignant ovarian tissues were used as controls. None of the patients had received prior adjuvant chemotherapy before surgery. All EOC samples were pathologically diagnosed according to the World Health Organization (WHO) classification guidelines (2014).
Immunohistochemical staining
Immunohistochemistry (IHC) was performed as previously described [22]. Briefly, 4-μm-thick tissue sections were stained with primary polyclonal antibodies against E-cadherin, N-cadherin, β-catenin, ZEB1 (1:200, Cat.9782, Cell Signaling Technology, USA), and ZEB2 (1:200, cat. 14026–1-AP, Proteintech, USA) diluted in antibody diluent (cat. 8112 L, Cell Signaling Technology, USA), then incubated with secondary antibody, and finally stained with 3,3-diaminobenzidine and hematoxylin. Images were obtained with a Nikon eclipse TE2000 fluorescence microscope. Stained tissues were classified according to staining intensity by two investigators. The staining extent in tissue cores was quantified using a four-tier grading system: 0 = <5% positive staining, 1 = 5% to 20% positive staining, 2 = 20% to 50% positive staining, and 3 = >50% positive staining. For statistical analysis, we divided cases into two groups: negative expression (with scores of 0) and positive expression (with scores of 1, 2, or 3) [23].
Cell culture
The human EOC cell lines ES-2, HEY, HO-8910, OVCAR-3 and SKOV3, and normal human ovarian surface epithelium cell line HOSEpiC were obtained from the American Type Culture Collection (ATCC), and were cultured and passaged according to the manufacturer’s instructions. All cell lines were cultured in RPMI-1640 medium (HyClone, USA) containing 10% fetal bovine serum (FBS, Gibco, USA), 100 units/mL penicillin, and 100 mg/mL streptomycin at 37°C in a humidified 5% CO2 incubator.
Transfection of lentiviral vectors, siRNAs and plasmids in EOC cells
For ectopic expression of MAGI1-IT1, ES-2 and SKOV3 were transfected with a lentiviral vector with eGFP, encoding MAGI1-IT1, and a negative control vector (LV-MAGI1-IT1 and LV-Vector, Genechem, Shanghai, China) by using polybrene (5.0 µg/mL). Cells were selected with a medium containing 0.2 mg/mL puromycin after 48 h of infection. To deplete the expression of MAGI1-IT1, miR-200a, and ZEB1 and ZEB2, ES-2 and SKOV3 cells were treated with siRNA-MAGI1-IT1 (Sangon Biotech, Shanghai, China), miR-200a inhibitor (RiboBio Company, Guangzhou, China), siRNA-ZEB1 and siRNA-ZEB2 (Sangon Biotech, Shanghai, China), or respective corresponding siRNA-Nc, by using X-tremeGENE HP DNA Transfection Reagent (Roche, USA). To upregulate the expression of ZEB1 and ZEB2, the EOC cells were treated with ZEB1-expressing plasmids and ZEB2-expressing plasmids, or control plasmids, respectively. Cells were harvested at 48 h posttransfection for future experiments. The method of miR-200a overexpression in ES-2 and SKOV3 was constructed by LV-miR-200a as described before [16]. The dysregulation of MAGI1-IT1 was confirmed by using qRT-PCR, and the downregulation of ZEB1 and ZEB2 were confirmed by using Western blot.
Cell viability assay
Cell proliferation assays were performed using Cell Counting Kit-8 (CCK-8, Cat. KGA317, KeyGen BioTECH, China) according to the manufacturer’s instructions. EOC cells (2.0x104) were seeded in 96-well plates with 100 µL maintenance medium. The number of viable cells was assessed by measuring the absorbance at 450 nm with a Microplate Reader (BioTek Instruments, Winooski, VT, USA) after two-hours of incubation. The viability rate was calculated as the experimental OD value/control OD value.
Colony-formation assay
For colony-formation assays, cells were plated on 6-well plates at a concentration of 150 cells/well and incubated for approximately 2 weeks. Then, colonies of cells were observed, fixed with 100% methanol and stained with hematoxylin.
Cell cycle analysis with flow cytometry (FCM)
ES-2 and SKOV3 cells were collected after trypsin digestion and fixed with 70% ethanol overnight at 4°C. After fixation, the cells were washed with PBS 2 times and treated with RNaseA and propidium iodide (PI, 50 μg/mL) for 30 min. Then, a FACScalibur Flow Cytometer (BD Biosciences, USA) with FACSDiva software (BD Bioscience, USA) was used to analyze the cell cycle, and the data were modified using ModFit LT 3.2 software (Verity Software House, USA).
Cell migration and invasion assays
For cell migration and invasion assays, 1.0 × 105 cells in 150 µL RPMI-1640 with 2% FBS were cultured in the upper chambers of an 8 μm Transwell insert (Corning) with Matrigel (invasion) or without Matrigel (migration) in the 24-well plate. After 16–48 h incubation, cells remaining in the upper side of the inserts were gently removed. Tumor cells that moved through the membrane were fixed in methanol and stained with hematoxylin. Migrated cells were photographed at 200× magnification under an inverted microscope, and the number of migratory/invasive cells was calculated in ten randomly selected fields.
Electron microscopy
For scanning electron microscopy (SEM) preparations, 1.0 × 105 SKOV3 cells were seeded on coverslips precoated with Matrigel matrix. The cells were fixed with 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.3) with 2% sucrose at room temperature for 20 min and were then dehydrated through a graded ethanol series, critical point-dried in CO2, and gold coated via sputtering. The samples were then examined using a Hitachi S-4800 scanning electron microscope (Hitachi), and the number of invadopodia formed by single cells were counted via Image J Software and analyzed by Student’s t-test.
Construction of subcutaneous and orthotopic ovarian xenograft tumor models in nude mice
All animal experiments were approved by the Institutional Use and Care of Animals Committee and conducted according to the approved animal protocol of the Animal Centre of Tongji University. Animal experiments were performed according to the Institution’s guidelines and animal research principles. Female nude mice, aged 4 to 6 weeks (weighing approximately 20 g), were housed and cared for at the Animal Centre of Tongji University (Shanghai, China).For subcutaneous ovarian xenografts, 1 × 106 SKOV3 cells transfected with LV-MAGI1-IT1 or LV-vector in 100 μL PBS were subcutaneously injected into the left and right flanks of mice, respectively. Tumor length (L) and width (W) were measured every 3 days using a digital Vernier caliper. Tumor volume was determined using the following formula: volume = L*W2/2. Mice were sacrificed according to tumor burden, and xenografts were excised and weighed.For orthotopic ovarian xenografts, nude mice were anaesthetized via isoflurane, the skin was disinfected with Betadine, and the left ovary and the oviduct were exteriorized out from a 1–2 cm lateral midline skin incision on the back. Then, 5 × 105 SKOV3 cells transfected with LV-MAGI1-IT1 or LV-vector in 10 μL PBS were injected under the ovarian bursa of the mouse using a 32-gauge syringe (Cat. 80386, Hamilton). After injection, the ovaries were replaced in the peritoneal cavity, and the peritoneal cavity and the skin were gradually closed and disinfected. Xenograft growth was monitored by a NightOWL LB 983 In Vivo Imaging System (Berthold Technologies) every two days. Mice were sacrificed 40 days after inoculation of the orthotopic ovarian xenografts or according to tumor burden.
Quantitative RT-PCR (qRT-PCR)
Total RNA from ES-2 and SKOV3 cells and EOC tissues was extracted by TRIzol Reagent (Invitrogen, USA), and cDNA synthesis was performed by using a PrimeScript TM RT Master Mix kit (TaKaRa BIO, Shiga, Japan) according to the manufacturer’s protocol. The expression level of MAGI1-IT1 was detected by using a Super Real PreMix Plus (SYBR Green) Kit (Tiangen Biotech, Beijing, China) and an Applied Biosystems Step One PlusTM Real-Time PCR System. GAPDH acted as endogenous controls for lncRNAs and mRNAs, meanwhile U6 acted as endogenous controls for miRNAs. The Bulge-LoopTM RT-qPCR primers for miR-200a and U6 small nuclear RNA were obtained from RiboBio Company (Guangzhou, China). The sequences are covered by a patent. The 2−ΔΔCt method was used to calculate the relative mRNA expression level. Primers sequences used for real-time PCR were as follows:GAPDH (forward): ACAACTTTGGTATCGTGGAAGG;GAPDH (reverse): GCCATCACGCCACAGTTTC;MGAI1-IT1(forward): TGATGCTGCTGATCTGGTCT;MGAI1-IT1 (reverse): GCCAAGTCTCTGCTCGTACC;ZEB1 (forward): GCACCTGAAGAGGACCAGAG;ZEB1 (reverse): TGCATCTGGTGTTCCATTTT;ZEB2 (forward): AAATGC ACAGAGTGTGGCAAGG; andZEB2 (reverse): CTGCTGATGTGCGAACTGTAGGA.
Western blot analysis
Total protein from cells and tissues was lysed in Whole Cell Lysis Assay (Cat. KGP250, KeyGen BioTECH, China). A total of 30 µg of protein per sample was resolved by 10% SDS-PAGE and transferred to PVDF membranes. The membranes were first incubated overnight at 4°C in BSA in TBS containing 0.05% Tween 20 with primary antibodies against E-cadherin, N-cadherin, β-catenin, ZEB1 (1:1000, Cat.9782, Cell Signaling Technology, USA), and ZEB2 (1:1000, cat. 14,026–1-AP, Proteintech, USA) diluted in antibody diluent (cat. 8112 L, Cell Signaling Technology, USA), followed by incubation with secondary antibodies (Cat. KGAA3d5, KeyGen BioTECH, China) conjugated with horseradish peroxidase at room temperature for 1 h. The protein bands were detected by using an enhanced chemiluminescence plus kit (Millipore) as recommended by the manufacturer.
Fluorescence in situ hybridization (FISH)
FISH probes for MAGI1-IT1 were purchased from Ribobio Company (Guangzhou, China), and DAPI was used as a nuclear positive control. Briefly, ES-2 and SKOV3 cells were grown on slides, rinsed gently in PBS, fixed in 4% formaldehyde solution, permeabilized in PBS containing 0.5% Triton X-100 for 5 min at 4℃, and then washed in PBS 3 × 5 min. Hybridization was carried out with a FISH probe overnight at 37℃ in the dark. Samples were sequentially washed with 4× SSC containing 1% Tween-20, 2× SSC, and 1× SSC for 5 min each, and then, nuclei were counterstained with DAPI. The coverslips were mounted onto glass slides with neutral gum and observed by confocal laser-scanning microscopy (TCS SP5, Leica).
Statistical analysis
All experiments were repeated at least three times in duplicate. Data are presented as the mean ± SD. Differences between the treated and control groups were analyzed using Student’s t-test, and the associations between various demographic parameters were evaluated by Fisher’s exact test. The co-expression pattern of MAGI1-IT1, miR-200a and ZEB1/2 in EOC tissue samples was analyzed by linear regression analysis. The level of significance was set at P < 0.05. All statistical analyses were performed with SPSS 20.0 software (IBM Software, USA).
Results
Expression and clinical significance of lncRNA MAGI1-IT1 in EOC
In our study, 44 dysregulated transcripts of lncRNAs and 8 dysregulated mRNAs were differentially altered in miR-200a-overexpressing OVCAR-3 cells (GEO accession GSE122123, Figure 1(a,b), and Supplemental Table 1). MAGI1-IT1 (NR_145422.1, and Supplemental File 1) was found to be one of the most downregulated gene among the dysregulated lncRNAs, compared with the controls (4.41-fold), and the possible functions of 14 mRNAs related to MAGI1-IT1 were primarily involved in biological adhesion, cell junction, cytoskeletal protein, localization and so on, as predicted by bioinformatic analysis (Figure 1(c)). In addition, MAGI1-IT1 expression was significantly decreased in miR-200a-overexpressing ES-2 and SKOV3 cells compared with control cells (P < 0.01) (Figure 1(d)).
Figure 1.
MAGI1-IT1 was identified as a tumor-promoting lncRNA.
A. B. The differentially expressed lncRNAs (A) and mRNAs (B) between miR-200a-overexpressing OVCAR-3 and control cells were detected by a microarray. C. The possible functions and biological process of MAGI1-IT1-related mRNA were predicted by PANTHER analysis. D. qRT-PCR analysis of MAGI1-IT1 expression in ES-2 and SKOV3 cells with overexpressed miR-200a. E. qRT-PCR analysis of MAGI1-IT1 expression in nonmalignant ovarian and EOC tissue samples. F. Representative IHC staining and average scores for EMT markers in FIGO stage II-IV primary and metastatic EOC tissue samples. Scale bar, 50 μm. All the data were analyzed using Student’s t-test and are expressed as the mean ± SD, and statistically significant differences are presented as follows: *P < 0.01, **P < 0.01, and ***P < 0.001.
MAGI1-IT1 was identified as a tumor-promoting lncRNA.A. B. The differentially expressed lncRNAs (A) and mRNAs (B) between miR-200a-overexpressing OVCAR-3 and control cells were detected by a microarray. C. The possible functions and biological process of MAGI1-IT1-related mRNA were predicted by PANTHER analysis. D. qRT-PCR analysis of MAGI1-IT1 expression in ES-2 and SKOV3 cells with overexpressed miR-200a. E. qRT-PCR analysis of MAGI1-IT1 expression in nonmalignant ovarian and EOC tissue samples. F. Representative IHC staining and average scores for EMT markers in FIGO stage II-IV primary and metastatic EOC tissue samples. Scale bar, 50 μm. All the data were analyzed using Student’s t-test and are expressed as the mean ± SD, and statistically significant differences are presented as follows: *P < 0.01, **P < 0.01, and ***P < 0.001.In order to explore the functional role of MAGI1-IT1 in EOC progression, the MAGI1-IT1 expression was measured in EOC tissues. As the results showed, the MAGI1-IT1 was significantly increased in the omental and mesenteric metastases of EOC, relative to primary EOC and nonmalignant ovarian tissues (P < 0.001) (Figure 1(e)), and ectopic MAGI1-IT1 expression was positively associated with III-IV FIGO stage in patients (P < 0.05, Table 1). In addition, the epithelial-mesenchymal transition (EMT) markers were further detected in FIGO stage II-IV primary and paired metastatic EOC tissues by IHC. As the results showed, the expression of epithelial markers E-cadherin was remarkably downregulated, while the mesenchymal markers N-cadherin, β-Catenin, ZEB1 and ZEB2 were significantly upregulated in metastatic EOC tissues, relative to primary EOC tissues (P < 0.05) (Figure 1(f)). Therefore, MAGI1-IT1 might be related to EOC invasion and dissemination via EMT.
Table 1.
Correlation betwen MAGI1-IT1 expression level and patient clinicopathological features (N = 34).
Clinicopathological parameters
Highexpression
Lowexpression
Χ2
P value
Age (years)
≤60
5
10
2.982
0.084
>60
12
7
FIGO stage
I-II
2
11
10.088
0.001
III-IV
15
6
Tumor size (cm)
≤5
3
7
2.267
0.132
>5
14
10
Differentiation
Well or moderate
4
8
2.061
0.151
Poorly
13
9
Lymphnode metastasis
Positive
4
1
2.110
0.146
Negative
13
16
Serum CA-125 level (U/ml)
≥35
17
17
/
/
<35
0
0
Histological pathology
Serous
12
14
0.821
0.663
Mucinous
4
2
Endometrial
1
1
All the data are evaluated by Fisher’s exact test, and statistically significant differences are presented as follows: P < 0.05.
Correlation betwen MAGI1-IT1 expression level and patient clinicopathological features (N = 34).All the data are evaluated by Fisher’s exact test, and statistically significant differences are presented as follows: P < 0.05.
MAGI1-IT1 presented no dramatic effects on EOC cell proliferation in vitro or in vivo
The EOC cell lines ES-2, HEY, HO-8910, OVCAR-3 and SKOV3 cell lines are common used for studying EOC biological malignant behaviour, and the expression level of MAGI1-IT1 and miR-200a were detected in five human EOC cell lines. As the results show, MAGI1-IT1 showed the highest expression level in SKOV3 while relatively low in ES-2; in addition, miR-200a expression was negatively correlated with MAGI1-IT1 in these two cells, relative to other EOC cell lines (Supplemental FigureS1 A), therefore, ES-2 and SKOV3 cells were chosen as experimental subjects. In addition, to evaluate the biological functions of MAGI1-IT1 in EOC, the stable upregulation (Supplemental FigureS1 B) and transient downregulation of MAGI1-IT1 cell lines were successfully constructed, and MAGI1-IT1 expression was effectively up- or downregulated in ES-2 and SKOV3 cells compared with control cells (P < 0.01) (Supplemental FigureS1 C, D).To analyze the effect of MAGI1-IT1 on EOC proliferation, CCK-8, colony formation, and FCM cell cycle analyses were conducted in vitro, and in vivo nude mouse subcutaneous xenografts were performed. As the results show, MAGI1-IT1 had no obvious modulatory function on EOC cell viability, colony-formation ability or each stage of the cell cycle compared with the respective control groups (Figure 2(a–c)). Furthermore, upregulation of MAGI1-IT1 had no significant effects on the tumor volume or weight of subcutaneous xenografts in nude mice (Figure 2(d)).
Figure 2.
MAGI1-IT1 had no significant influence on EOC cell proliferation in vitro or in vivo.
A. B. C. CCK8 analysis (A), colony formation assays (B), and cell cycle (C) of overexpression or knockdown of MAGI1-IT1 in ES-2 and SKOV3 cells. D. The tumor growth curve and weights of MAGI1-IT1-overexpressing SKOV3 subcutaneous ovarian xenografts. The tumor weights in each group were quantified. All data were analyzed using Student’s t-test and are expressed as the mean ± SD, with no significant difference.
MAGI1-IT1 had no significant influence on EOC cell proliferation in vitro or in vivo.A. B. C. CCK8 analysis (A), colony formation assays (B), and cell cycle (C) of overexpression or knockdown of MAGI1-IT1 in ES-2 and SKOV3 cells. D. The tumor growth curve and weights of MAGI1-IT1-overexpressing SKOV3 subcutaneous ovarian xenografts. The tumor weights in each group were quantified. All data were analyzed using Student’s t-test and are expressed as the mean ± SD, with no significant difference.
MAGI1-IT1 promoted EOC cell migration and invasion in vitro and in vivo
To evaluate the role of MAGI1-IT1 in EOC cell migration and invasion, Transwell assays with (invasion) or without (migration) Matrigel matrix were carried out in dysregulated MAGI1-IT1 EOC cells. As the results show, overexpression of MAGI1-IT1 dramatically increased the number of cells that penetrated the membrane, while knockdown of MAGI1-IT1 expression led to the opposite effect (P < 0.001, Figure 3(a)). Invadopodia appear as irregular actin-based dots without a definable ring structure, and are closely related to more aggressive phenotype with greater migration and invasion ability [24,25]. In addition, notably longer and more elongated invadopodia protruded from the surface of MAGI1-IT1-overexpressing SKOV3 cells, as detected by SEM, compared with the control groups (P < 0.001, Figure 3(b)). Furthermore, the results of the nude mouse orthotopic ovarian tumor models show that the metastasis of xenografts were significantly promoted by MAGI1-IT1 (Figure 3(c)). After dissection, overexpression of MAGI1-IT1 was found to dramatically increase the tumor burden and EOC dissemination to peritoneal organs, including omentum and mesentery, compared with the control group, and overexpression of MAGI1-IT1 also significantly enhanced the numbers and weight of metastatic nodules (diameter >2 mm) (P < 0.05, Figure 3(d)).
Figure 3.
MAGI1-IT1 markedly enhanced EOC cell invasion and metastasis in vitro and in vivo.
A. Transwell assays of dysregulation of MAGI1-IT1 in EOC cells in vitro. Scale bar, 100 μm. B. SEM and statistical numbers of invadopodia in MAGI1-IT1-overexpressing SKOV3 cells. Scale bar, 50 μm. C. The growth of MAGI1-IT1-overexpressing SKOV3 orthotopic ovarian xenografts was detected with a NightOWL LB 983 In Vivo Imaging System. D. After sacrifice, the ovarian tumors in nude mice were removed and are shown by red arrows in the images. The average number of peritoneal tumor nodules and average weight of tumors from each group were quantified. E. Western blot analysis of EMT markers in dysregulation MAGI1-IT1 EOC cells. F. Representative IHC staining and average scores for EMT markers in orthotopic ovarian xenografts. Scale bar, 50 μm. All data were analyzed using Student’s t-test and are expressed as the mean ± SD, and statistically significant differences are presented as follows: *P < 0.05, **P < 0.01 and ***P < 0.001.
MAGI1-IT1 markedly enhanced EOC cell invasion and metastasis in vitro and in vivo.A. Transwell assays of dysregulation of MAGI1-IT1 in EOC cells in vitro. Scale bar, 100 μm. B. SEM and statistical numbers of invadopodia in MAGI1-IT1-overexpressing SKOV3 cells. Scale bar, 50 μm. C. The growth of MAGI1-IT1-overexpressing SKOV3orthotopic ovarian xenografts was detected with a NightOWL LB 983 In Vivo Imaging System. D. After sacrifice, the ovarian tumors in nude mice were removed and are shown by red arrows in the images. The average number of peritoneal tumor nodules and average weight of tumors from each group were quantified. E. Western blot analysis of EMT markers in dysregulation MAGI1-IT1 EOC cells. F. Representative IHC staining and average scores for EMT markers in orthotopic ovarian xenografts. Scale bar, 50 μm. All data were analyzed using Student’s t-test and are expressed as the mean ± SD, and statistically significant differences are presented as follows: *P < 0.05, **P < 0.01 and ***P < 0.001.Moreover, compared with control groups, the E-cadherin was significantly downregulated, while the N-cadherin, β-Catenin, ZEB1 and ZEB2 were dramatically upregulated in MAGI1-IT1 overexpressing EOC cells and orthotopic ovarian xenografts; on the contrast, downregualtion of MAGI1-IT1 EOC cells caused the opposite effects in vitro, respectively. Collectively, these results suggested that MAGI1-IT1 could facilitate EOC EMT phenotype, invasion and dissemination in vitro and in vivo.
MAGI1-IT1 may serve as a ceRNA of mir-200a in regulating ZEB1/2 expression
To further investigate the underlying mechanism of MAGI1-IT1 in EOC dissemination, the FISH experiment was executed to identify the distribution of MAGI1-IT1 in ES-2 and SKOV3 cells. As the results show, MAGI1-IT1 was principally localized in the cytoplasm, with weak expression in the nucleus (Figure 4(a)). Since cytoplasmic lncRNAs have the ability to bind to many biomolecules, ceRNAs have emerged as an important mechanism for lncRNAs and miRNAs regulatory networks [26,27]. Thus, the associations among MAGI1-IT1, corresponding miRNAs and mRNAs were subsequently predicted. As the results show, there are two binding sites between miR-200a and MAGI1-IT1, which indicates that miR-200a may be a potential target of MAGI1-IT1 (Figure 4(b)). Since miR-200a was validated to suppress the transcription of repressors ZEB1 and ZEB2 in various cancers [18], the co-expression pattern of MAGI1-IT1, miR-200a, ZEB1 and ZEB2 was explored in EOC tissues and parental EOC cell lines. As the results showed, an inverse correlation between MAGI1-TI1 and miR-200a (R = 0.6564; P < 0.001), and positive correlations between MAGI1-TI1 and ZEB1 (R = 0.6664; P < 0.001), and MAGI1-TI1 and ZEB2 (R = 0.8400; P < 0.001) were observed in human EOC metastatic tissues (Figure 4(c)). In addition, the expression of MAGI1-IT1, ZEB1 and ZEB2 were significantly upregulated, while the expression of miR-200a was remarkably downregulated in SKOV3 and ES-2 cells, relative to HOSEpiC cells. These results suggested a potential functional correlation between MAGI1-IT1, miR-200a, and ZEB1 and ZEB2 (P < 0.05, Figure 4(d)).
Figure 4.
MiR-200a was the target gene of MAGI1-IT1.
A. Fluorescence in situ hybridization (FISH) analysis of MAGI1-IT1 subcellular localization in ES-2 and SKOV3 cell lines. Scale bar, 50 μm. B. Sequences of the binding site for MAGI1-IT1 and miR-200a, predicted by UCSC. C. The correlation analysis of MAGI1-IT1 and ZEB1/2 in human metastastic EOC tissues. D. qRT-PCR analysis of MAGI1-IT1, miR-200a, ZEB1 and ZEB2 mRNA expression in HOSEpiC, ES-2 and SKOV3 cells. E-H. Western blot analysis of ZEB1/2 protein expression in EOC cell lines upon MAGI1-IT1 knockdown (E), overexpression of miR-200a (F), overexpression of miR-200a and MAGI1-IT1 (G), and both MAGI1-IT1 knockdown and miR-200a inhibition (H) as indicated.
MiR-200a was the target gene of MAGI1-IT1.A. Fluorescence in situ hybridization (FISH) analysis of MAGI1-IT1 subcellular localization in ES-2 and SKOV3 cell lines. Scale bar, 50 μm. B. Sequences of the binding site for MAGI1-IT1 and miR-200a, predicted by UCSC. C. The correlation analysis of MAGI1-IT1 and ZEB1/2 in human metastastic EOC tissues. D. qRT-PCR analysis of MAGI1-IT1, miR-200a, ZEB1 and ZEB2 mRNA expression in HOSEpiC, ES-2 and SKOV3 cells. E-H. Western blot analysis of ZEB1/2 protein expression in EOC cell lines upon MAGI1-IT1 knockdown (E), overexpression of miR-200a (F), overexpression of miR-200a and MAGI1-IT1 (G), and both MAGI1-IT1 knockdown and miR-200a inhibition (H) as indicated.Moreover, further experiments validated that knockdown of MAGI1-IT1 and overexpression of miR-200a significantly decreased the expression levels of ZEB1 and ZEB2 (Figure 4(e,f)). Furthermore, inhibition of ZEB1 and ZEB2 expression induced by miR-200a overexpression was abrogated by MAGI1-IT1 overexpression (Figure 4(g)), and inhibition of ZEB1 and ZEB2 expression induced by MAGI1-IT1 knockdown was abrogated by the inhibition of miR-200a expression (Figure 4(h)). These findings indicated that MAGI1-IT1 may modulate ZEB1 and ZEB2 expression by competitively binding miR-200a.
Effect of MAGI1-IT1 on EOC invasion and metastasis via regulation of the mir-200a-ZEB1/2 network
First, miR-200a overexpression and knockdown of ZEB1 and ZEB2 were validated to strongly mimic the repressive effects of MAGI1-IT1 depletion on EOC migration and invasion (P < 0.001) (Figure 5(a,b); Supplemental FigureS2 A, B). Moreover, the results of the corresponding rescue experiments show that inhibition of miR-200a and overexpression of ZEB1 and ZEB2 can significantly reverse the repressive effects of MAGI1-IT1 knockdown on the number of penetrated EOC cells (P < 0.05) (Figure 5(c,d); Supplemental FigureS2 C, D). These findings indicate that miR-200a and ZEB1/2 are functional downstream targets of MAGI1-IT1 during EOC invasion and metastasis.
Figure 5.
MAGI1-IT1 promoted EOC invasion and metastasis via the regulation of the miR-200a-ZEB1/2 network.
A.B. Transwell assay analysis of the migration and invasion of EOC cells in vitro upon overexpression of miR-200a(A) and ZEB1/2 (B) knockdown. C. D. Transwell assays of the migration and invasion of EOC cells in vitro upon inhibition of miR-200a with MAGI1-IT1 downregulation (C) and upregulation of ZEB1/2 with MAGI1-IT1 downregulation (D). All data were analyzed using Student’s t-test and are expressed as the mean ± SD, and statistically significant differences are presented as follows: *P < 0.05, **P < 0.01 and ***P < 0.001.
MAGI1-IT1 promoted EOC invasion and metastasis via the regulation of the miR-200a-ZEB1/2 network.A.B. Transwell assay analysis of the migration and invasion of EOC cells in vitro upon overexpression of miR-200a(A) and ZEB1/2 (B) knockdown. C. D. Transwell assays of the migration and invasion of EOC cells in vitro upon inhibition of miR-200a with MAGI1-IT1 downregulation (C) and upregulation of ZEB1/2 with MAGI1-IT1 downregulation (D). All data were analyzed using Student’s t-test and are expressed as the mean ± SD, and statistically significant differences are presented as follows: *P < 0.05, **P < 0.01 and ***P < 0.001.
Discussion
Recently, a significant number of lncRNAs have been identified to participate in EOC growth and metastasis via ceRNA regulation [28,29]. Generally, lncRNAs can function both in cis and in trans as decoys, guides and scaffolds by directly interacting with DNA, RNA or proteins [30,31]. For instance, Lu et al. revealed that lncRNA nuclear enriched abundant transcript 1 (NAET1) promoted EOC cell metastasis through miR-382-3p/ROCK1 axial [32]. Shan et al. demonstrated that the lncRNA PTAF/miR-25/SNAI2 axis promoted EOC tumor progression and metastasis [33]. Chang et al. validated that lncRNA homeobox (HOX) transcript antisense intergenic RNA (HOTAIR) regulated CCND1 and CCND2 expression by sponging miR-206 in ovarian cancer [34].In our previous study, miR-200a was validated to promote EOC cell proliferation and inhibit the CSC phenotype [21]. In our preliminary experiments, lncRNA MAGI1-IT1 was found to be significantly downregulated in miR-200a-overexpressing EOC cells, and the targeted mRNAs were predicted to be associated with tumor metastasis. As transcribed from an intron of MAGI1, MAGI1-IT1 was first reported in cardiac hypertrophy (CH) and was validated to be highly associated with CH via ceRNA [35]. In this study, unlike the inhibitory role of MAGI1 [36-39], MAGI1-IT1 was highly expressed in EOC metastatic tissues compared with primary EOC and benign ovarian tissues, and aberrant MAGI1-IT1 expression was closely associated with unfavorable EOC clinicopathological features III-IV FIGO stages. Then, a series of in vitro and in vivo experiments confirmed that MAGI1-IT1 could remarkably facilitate EOC metastatic ability and invadopodia protrusions. However, MAGI1-IT1 was validated to have no significant influence on the proliferation of EOC in vitro and in vivo. These results suggested that MAGI1-IT1 has a possible oncogenic role in EOC EMT and dissemination.Next, the potential mechanisms of MAGI1-IT1 in regulating EOC metastasis were further explored. Because of the cytoplasm localization of MAGI1-IT1 and the inspiration of regulatory ceRNA [40,41], we hypothesized that MAGI1-IT1 may also serve as a ceRNA to enhance mRNA expression by targeting certain miRNAs. As a result of bioinformatics analysis, MAGI1-IT1 might be a target of miR-200a. Studies have demonstrated that ZEB1/2, as E-cadherin transcriptional repressors, play a crucial role in tumor dissemination and mutually repress gene expression with the miR-200 family in a reciprocal feedback loop [18,42]. Therefore, the regulatory networks of MAGI1-IT1, miR-200a and ZEB1/2 were further investigated.In the present study, a negative association between MAGI1-IT1 and miR-200a expression, and positive association between MAGI1-IT1 and ZEB1/2 were observed in human EOC metastatic tissues and EOC cell lines. In addition, we found that depletion of MAGI1-IT1 and upregulation of miR-200a significantly increased the expression levels of ZEB1 and ZEB2. In addition, overexpression of MAGI1-IT1 could reverse the repressive effects of miR-200a on ZEB1 and ZEB2 expression. On the other hand, depletion of miR-200a could reverse the restrictive effects of MAGI1-IT1 downregulation on ZEB1 and ZEB2 expression, respectively. Moreover, depletion of miR-200a and upregulation of ZEB1 and ZEB2 expression could resume the tumor-metastasis promoting effects of MAGI1-IT1. These results suggest that MAGI1-IT1 might act as a competitor to restrict the miR-200a active site to sustain the expression of the core transcription factors ZEB1/2.The reason why MAGI1-IT1 had no significant effect on EOC cells proliferation and tumor growth may be related with the target its binding to. Researches have validated that miR-200a can directly bound and suppress ZEB1/2 [18], however, the function role of miR-200a on EOC proliferation is still controversial [19,20]. Some researches have demonstrated that miR-200a could suppress the proliferation of humanovarian carcinoma cells by targeting FOXD1 and affecting its downstream P53 signaling pathway [43]; on the contrary, other studies held the view that miR-200a may promote ovarian cancer cells proliferation and tumor growth by targeting PTEN [21,44] In addition, some researches have demonstrated ZEB1 and ZEB2 were dramatically associated with the inhibition of cell apoptosis in chemoresistance EOC cells [45-47]. Since miR-200a might bind with Snail, transforming growth factor-β (TGF-β), friend of GATA 2 (FOG2) or other targets [19], thus, the regulations role and mechanisms of MAGI1-IT1 on EOC proliferation deserves further exploration.Taken together, this study demonstrates an important role of lncRNA MAGI1-IT1 in regulating ZEB1 and ZEB2 expression by competitively binding miR-200a and then promoting EOC migration and invasion, moreover the regulatory axis of MAGI1-IT1-miR-200a-ZEB1/2 may provide new insights for EOC diagnostic and therapeutic intervention.
Authors: Tsz-Lun Yeung; Cecilia S Leung; Kay-Pong Yip; Chi Lam Au Yeung; Stephen T C Wong; Samuel C Mok Journal: Am J Physiol Cell Physiol Date: 2015-07-29 Impact factor: 4.249