Sergiy Perepelytsya1,2, Jozef Uličný3, Aatto Laaksonen4,5,6, Francesca Mocci6,7. 1. Bogolyubov Institute for Theoretical Physics of the National Academy of Sciences of Ukraine, 03143 Kyiv, Ukraine. 2. Department of Theoretical and Mathematical Physics, Kyiv Academic University, 03142 Kyiv, Ukraine. 3. Department of Biophysics, Institute of Physics, P. J. Šafárik University, 041 54 Košice, Slovakia. 4. State Key Laboratory of Materials-Oriented and Chemical Engineering, Nanjing Tech University, 210009 Nanjing, China. 5. Division of Physical Chemistry, Department of Materials and Environmental Chemistry, Arrhenius Laboratory, Stockholm University, 10691 Stockholm, Sweden. 6. Centre of Advanced Research in Bionanoconjugates and Biopolymers, Petru Poni Institute of Macromolecular Chemistry, Iasi, 700487, Romania. 7. Department of Chemical and Geological Sciences, University of Cagliari, I-09042 Monserrato, Italy.
Abstract
The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.
The interactions of natural pan class="Chemical">polyamines (mical">pan class="Chemical">putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.
Authors: Andrea M Katz; Igor S Tolokh; Suzette A Pabit; Nathan Baker; Alexey V Onufriev; Lois Pollack Journal: Biophys J Date: 2017-01-10 Impact factor: 4.033
Authors: Diana A Kondinskaia; Andrei Yu Kostritskii; Alexey M Nesterenko; Alexandra Yu Antipina; Andrey A Gurtovenko Journal: J Phys Chem B Date: 2016-06-23 Impact factor: 2.991