Literature DB >> 31114917

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

Sergiy Perepelytsya1,2, Jozef Uličný3, Aatto Laaksonen4,5,6, Francesca Mocci6,7.   

Abstract

The interactions of natural pan class="Chemical">polyamines (mical">pan class="Chemical">putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.
© The Author(s) 2019. Published by Oxford University Press on behalf of Nucleic Acids Research.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31114917      PMCID: PMC6614828          DOI: 10.1093/nar/gkz434

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN: 0305-1048            Impact factor:   16.971


  63 in total

1.  RNA and its ionic cloud: solution scattering experiments and atomically detailed simulations.

Authors:  Serdal Kirmizialtin; Suzette A Pabit; Steve P Meisburger; Lois Pollack; Ron Elber
Journal:  Biophys J       Date:  2012-02-21       Impact factor: 4.033

2.  Competitive binding exchange between alkali metal ions (K+, Rb+, and Cs+) and Na+ ions bound to the dimeric quadruplex [d(G4T4G4)]2: a 23Na and 1H NMR study.

Authors:  Flaminia Cesare Marincola; Ada Virno; Antonio Randazzo; Francesca Mocci; Giuseppe Saba; Adolfo Lai
Journal:  Magn Reson Chem       Date:  2009-12       Impact factor: 2.447

3.  VMD: visual molecular dynamics.

Authors:  W Humphrey; A Dalke; K Schulten
Journal:  J Mol Graph       Date:  1996-02

4.  Spermine Condenses DNA, but Not RNA Duplexes.

Authors:  Andrea M Katz; Igor S Tolokh; Suzette A Pabit; Nathan Baker; Alexey V Onufriev; Lois Pollack
Journal:  Biophys J       Date:  2017-01-10       Impact factor: 4.033

5.  Sequence-specific Mg2+-DNA interactions: a molecular dynamics simulation study.

Authors:  Weifeng Li; Lars Nordenskiöld; Yuguang Mu
Journal:  J Phys Chem B       Date:  2011-11-10       Impact factor: 2.991

Review 6.  [Physical properties of the DNA-water system].

Authors:  V Ia Maleev; M A Semenov; A I Gasan; V A Kashpur
Journal:  Biofizika       Date:  1993 Sep-Oct

7.  Equilibrium dialysis studies of polyamine binding to DNA.

Authors:  W H Braunlin; T J Strick; M T Record
Journal:  Biopolymers       Date:  1982-07       Impact factor: 2.505

Review 8.  Implications and concepts of polyamine-nucleic acid interactions.

Authors:  B G Feuerstein; L D Williams; H S Basu; L J Marton
Journal:  J Cell Biochem       Date:  1991-05       Impact factor: 4.429

9.  Atomic-Scale Molecular Dynamics Simulations of DNA-Polycation Complexes: Two Distinct Binding Patterns.

Authors:  Diana A Kondinskaia; Andrei Yu Kostritskii; Alexey M Nesterenko; Alexandra Yu Antipina; Andrey A Gurtovenko
Journal:  J Phys Chem B       Date:  2016-06-23       Impact factor: 2.991

10.  Opposite effect of polyamines on In vitro gene expression: Enhancement at low concentrations but inhibition at high concentrations.

Authors:  Ai Kanemura; Yuko Yoshikawa; Wakao Fukuda; Kanta Tsumoto; Takahiro Kenmotsu; Kenichi Yoshikawa
Journal:  PLoS One       Date:  2018-03-01       Impact factor: 3.240

View more
  3 in total

1.  Molecular dynamics study of the competitive binding of hydrogen peroxide and water molecules with DNA phosphate groups.

Authors:  Sergiy Perepelytsya; Jozef Uličný; Sergey N Volkov
Journal:  Eur Biophys J       Date:  2021-04-08       Impact factor: 1.733

Review 2.  Role of Polyamines and Hypusine in β Cells and Diabetes Pathogenesis.

Authors:  Abhishek Kulkarni; Cara M Anderson; Raghavendra G Mirmira; Sarah A Tersey
Journal:  Metabolites       Date:  2022-04-12

3.  Caging Polycations: Effect of Increasing Confinement on the Modes of Interaction of Spermidine3+ With DNA Double Helices.

Authors:  Tudor Vasiliu; Francesca Mocci; Aatto Laaksonen; Leon De Villiers Engelbrecht; Sergiy Perepelytsya
Journal:  Front Chem       Date:  2022-02-25       Impact factor: 5.221

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.