Literature DB >> 31109310

Sigma-2 receptor/TMEM97 agonist PB221 as an alternative drug for brain tumor.

Chia-Chi Liu1,2, Ching-Fang Yu3, Shu-Chi Wang4, Hsueh-Yin Li1, Chiu-Min Lin1, Hsia-Han Wang1, Carmen Abate5, Chi-Shiun Chiang6,7,8.   

Abstract

BACKGROUND: There are limited effective drugs that can reach the brain to target brain tumors, in particular glioblastoma, which is one of the most difficult cancers to be cured from. Because the overexpression of the sigma-2 receptor is frequently reported in glioma clinical samples and associated with poor prognosis and malignancy, we herein studied the anti-tumor effect of the sigma-2 receptor agonist PB221 (4-cyclohexyl-1-[3-(5-methoxy-1,2,3,4-tetrahydronaphthalen-1-yl)propyl]piperidine) on an anaplastic astrocytoma tumor model based on previous encouraging results in pancreatic cancer and neuroblastoma SK-N-SH cells.
METHODS: The expression of the sigma-2 receptor, transmembrane protein 97 (TMEM97), in ALTS1C1 and UN-KC6141 cell lines was measured by RT-PCR and quantitative RT-PCR. The binding of sigma-2 receptor fluorescent ligands PB385 (6-[5-[3-(4-cyclohexylpiperazin-1-yl)propyl]-5,6,7,8-tetrahydronaphthalen-5-yloxy]-N-(7-nitro-2,1,3-benzoxadiazol-4-yl)hexanamine) and NO1 (2-{6-[2-(3-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)propyl)-3,4-dihydroisoquinolin-1(2H)-one-5-yloxy]hexyl}-5-(dimethylamino)isoindoline-1,3-dione) was examined by flow cytometry and the fluorescent plate reader. The antitumor activity of PB221 was initially examined in the murine brain tumor cell line ALTS1C1 and then in the murine pancreatic cell line UN-KC6141. The potential therapeutic efficacy of PB221 for murine brain tumors was examined by in vitro migration and invasion assays and in vivo ectopic and orthotopic ALTS1C1 tumor models.
RESULTS: The IC50 of PB221 for ALTS1C1 and UN-KC6141 cell lines was 10.61 ± 0.96 and 13.13 ± 1.15 μM, respectively. A low dose of PB221 (1 μM) significantly repressed the migration and invasion of ALTS1C1 cells, and a high dose of PB221 (20 μM) resulted in the apoptotic cell death of ALTS1C1 cells. These effects were reduced by the lipid antioxidant α-tocopherol, but not by the hydrophilic N-acetylcysteine, suggesting mitochondrial oxidative stress is involved. The in vivo study revealed that PB221 effectively retarded tumor growth to 36% of the control tumor volume in the ectopic intramuscular tumor model and increased the overall survival time by 20% (from 26 to 31 days) in the orthotopic intracerebral tumor model.
CONCLUSIONS: This study demonstrates that the sigma-2 receptor agonist PB221 has the potential to be an alternative chemotherapeutic drug for brain tumors with comparable side effects as the current standard-of-care drug, temozolomide.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31109310      PMCID: PMC6528305          DOI: 10.1186/s12885-019-5700-7

Source DB:  PubMed          Journal:  BMC Cancer        ISSN: 1471-2407            Impact factor:   4.430


Background

In adults, glioblastoma and astrocytoma are the most malignant and lethal forms of primary brain tumors. The current standard of care for brain tumors is surgical removal of tumors as much as possible, followed by radiation therapy with concomitantly adjuvant chemotherapy with temozolomide (TMZ), as proposed by Stupp [1] several years ago. The prognosis still remains poor despite maximal efforts with this strict protocol [2-4]. The main therapeutic drug approved for glioma is TMZ, which targets mainly the guanine residues, susceptible to methylation, in DNA at the O6 position [5]. It is more effective against tumors lacking the O6-methylguanine DNA methyltransferase (MGMT). The extensive heterogeneity of brain tumors makes them resistant to the current single agent therapy and has strongly stimulated research into the development of multiple adjuvant therapies, including target therapy [6] or immunotherapy [7] and the invention of new drugs to target the specific pathways of brain tumor resistance [8]. The sigma receptor was initially described as an opioid receptor [9], but was later found to be distinct from the opioid receptors [10]. Two subtypes of this receptor have been found: sigma-1 and sigma-2 [11]. The sigma-1 protein was cloned in 1996 [12], but the sigma-2 receptor gene was not clearly identified until recently. A recent paper by Alon et al. [13] identified the sigma-2 receptor as transmembrane protein 97 (TMEM97), an endoplasmic reticulum (ER)-resident membrane protein also known as meningioma-associated protein (MAC30). Prior to the identification of the sigma-2 receptor as TMEM97, the function of the sigma-2 receptor was studied through high affinity ligands [11, 14–17] and appeared to be linked to neurodegenerative diseases [17] and cancer development [14]. Sigma-2 receptor ligands have not only been proposed as biomarkers for cancers, but also potential anticancer agents, because many of them could induce tumor cell death [18]. A high affinity sigma-2 receptor ligand, PB221 (4-cyclohexyl-1-[3-(5-methoxy-1,2,3,4-tetrahydronaphthalen-1-yl-propyl)] piperidine), derived from a class of N-cyclohexylpiperazine derivatives, has been recognized as a potent inhibitor of the proliferation of the SK-N-SH human neuroblastoma cell line in vitro [19]. Recent work on this compound further demonstrated that PB221 could induce apoptosis by generating superoxide radicals in mitochondria and activating caspase in several pancreatic cell lines in vitro, as well as retarding Panc02 tumor growth in C57BL/6 J mice [20]. The sigma-2 receptor (TMEM97) is highly expressed in human glioma tissues and its expression level is associated with the malignancy of glioblastoma [21]. The knockdown of the TMEM97 gene expression by specific siRNA could inhibit cell growth, migration, and invasion of glioma cell lines U87 and U373 [21]. This suggests that the sigma-2 receptor could be a potential target for brain tumor therapy. By using a pre-clinical astrocytoma model, the present study demonstrates that the high affinity sigma-2 receptor ligand PB221 could indeed delay the growth rate of intramuscular ALTS1C1 tumors and prolong the survival of mice bearing intracranial ALTS1C1 tumors. The thus results suggest that PB221 is a potential alternative therapeutic drug for treating brain tumors.

Methods

Cell line cultures

Murine astrocytoma ALTS1C1 cells (BCRC60582, Taiwan) [22], murine pancreatic UN-KC6141 cells (kindly provided by Prof. Batra, S. K. from Department of Pathology and Microbiology, University of Nebraska Medical Center, USA) [23], and human glioma U87-MG cells (ATCC No. CRL-9589, Manassas, VA, USA) were maintained in Dulbecco’s modified Eagle’s medium (GIBCO, Thermo Fisher Scientific, Inc., USA) with 10% fetal bovine serum (GIBCO), and 1% penicillin–streptomycin (GIBCO) at 37 °C in a humidified 5% CO2/air atmosphere.

Mice, tumor inoculation, and drug treatment

Male 7-to-8-week-old C57BL/6 J mice were purchased from the National Laboratory Animal Center, Taiwan. Mice were housed in groups of five under standard conditions and given one week to acclimate to the housing facility. The health status of mice was monitored daily during the period of housing. For all experiments, mice were used according to the animal experimental guidelines set by and with the approval of the Institutional Animal Care and Use Committee of National Tsing Hua University, Taiwan (IACUC: 10239). For ectopic intramuscular tumor model, 3 × 106 cells suspended in 100 μl saline was intramuscularly injected into the right shank of C57BL/6 J mouse. When the tumor volume reached 40 mm3, mice were randomly assigned into three groups: control (n = 3), PB221 (n = 3) and TMZ (n = 3) groups. PB221 (2 mg) and TMZ (2 mg) were administrated intraperitoneally in a final volume of 100 μl once daily for 4 days and 1 day, respectively. Tumor sizes were measured daily with a caliper and tumor volumes were calculated using the formula: ab2/2, with a and b being the shortest and longest diameters, respectively. Until the experiments were completed, all animals were sacrificed by CO2 euthanasia. For orthotopic tumor model, 1 × 105 cells in 2 μl of DMEM/F12 medium were stereotactic inoculated into the right hemisphere of mouse brain as described in previous publication [22]. After ten days, mice were randomly divided into control, PB221, and TMZ groups and intraperitoneally received PB221 (1 mg) and TMZ (2 mg) in a final volume of 100 μl once daily for 5 days, and 1 day respectively. Tumor-bearing mice were anesthetized by using ketamine (50 mg/kg) and xylazine (20 mg/kg) and perfused with saline when they showed the syndromes of neurologic deficit (failure to ambulate, lethargy, or lack of feeding resulting in loss of > 20% body weight). Dissolving solution without drug was used as control.

Preparation of reagents

PB221, PB385, and NO1 were synthesized by Dr. Abate’s laboratory according to published method [16, 19, 24]. For the in vitro assay, the stock solution (10 mM) was prepared by dissolving the reagents in DMSO, and the solutions with drug were diluted in suitable solvents before experiments. DMSO without drug was used as control. N-acetyl-L-cysteine (NAC) and α-tocopherol were purchased from Sigma-Aldrich (St. Louis, USA) and dissolved in ddH2O and DMSO, respectively, with final concentrations less than 0.3%. For the in vivo experiment, PB221 (20 mg/ml or 10 mg/ml) was freshly prepared in a phosphate buffer solution containing 5% DMSO, 5% ethanol, and 10% Chremophore EL [25] just prior to the injection. TMZ was purchased from Sigma-Aldrich and the final concentration (20 mg/ml) of TMZ was freshly prepared by dissolving TMZ in phosphate buffer solution containing 18% DMSO, 8% ethanol, and 12% Chremophor EL [26] just prior to the injection.

Cell cytotoxicity assay

Cells were seeded in 96-well culture plate (1000 cells/well) and cultured overnight. After 24 h, medium was exchanged for fresh medium containing serial diluted drug concentration from 0 to 100 μM. After three days culture in routine cell culture condition, viability of cells was quantified by MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide; Sigma-Aldrich) assay according to manufacture’s protocol. Cell surviving fraction was calculated as the percentage of the number of cells left in the drug-treated wells divided by the number of cells in the wells without drug treatment. Cell number was calculated by the interpolation from a standard curve of the OD versus various cell number of each plate. The IC50 was obtained by a nonlinear fit to the dose response curve using a GraphPad Prism 7 software (GraphPad, USA).

Cell binding assay

The binding ability of cells with selective sigma-2 receptor ligands was performed by flow cytometry assay or the fluorescent plate reader. For PB385 reagent, 105 cells were incubated with different concentrations of PB385 at room temperature for 1 h. After washing with PBS buffer, fluorescent cells were analyzed by the histogram of FITC channel on a BD FACSCanto™ flow cytometry (Becton Dickinson, USA). For the binding affinity of NO1, 105 cells were incubated with various concentrations of NO1 reagent at room temperature for 1 h. After washing with PBS buffer, the relative fluorescent unit (RFU) was measured by Infinite® 200 Pro fluorescent reader (Tecan, Switzerland) with the excitation of 390 nm and emission at 525 nm.

Gene expression assay

Normal brain tissues were collected from C57BL/6 J mice and ground by homogenizer with Trizol reagent to shred the tissues completely. Total RNA of cells and tissues was isolated by Trizol reagent (Invitrogen, USA) and cDNA was synthesized using Omniscript reverse transcriptase kit (Qiagen, Germany) according to the manufacturer’s protocol, respectively. The concentration of cDNA was measured by NanoDrop™ 2000c Spectrophotometers (Thermo Fisher Scientific). Q-PCR was performed on a StepOne Real-Time PCR Systems (Thermo Fisher Scientific). The cDNA and gene primers were added to a SYBR Green PCR Master mixture (Applied Biosystems, USA). The mixture was then subjected to PCR amplification. All PCR reactions were run in triplicate. No-template and no-reverse transcription controls were performed to prevent primer dimers and genomic DNA contamination. The difference (ΔCt) between the Ct value of the gene transcript and the endogenous control β-actin determined the gene expression level. Primer sequences used are: β-actin forward primer, 5′GGCTCTTTTCCAGCCAGCCTTCC3′; β-actin reverse primer, 5′GTCTTTACGGATGTCAACG3′. TMEM97 forward primer, 5′TACTTCGTCTCGCACATCCC3′; TMEM97 reverse primer, 5′TTGCTGAACTCCTGCGGGTA3′.

Cell invasion assay

Cell invasion assay was conducted using BD BioCoat Matrigel invasion chambers (BD Biosciences, USA). 2 × 104 cells suspended in a culture medium containing 2% FBS were added into the upper inserts and 10% FBS culture medium were added to the bottom well of a 24 well plate. After 16 h incubation at 37 °C in cell incubator with 5% CO2, the invaded cells on the lower insert membrane surface were fixed with 4% PFA in the PBS and stained with 5% crystal violet. The images were captured by a Nikon Eclipse microscope (Nikon, Japan) equipped with Spot digital camera and counted by Image-Pro software.

Cell migration assay

The 12-well plate with SPLScar™ Block (SPL Life Sciences Co. Ltd., Pocheon-si, Korea) in each well was used for migration assay. 5 X 104 cells suspended in normal culture medium were seeded in the block. After 24 h, the wall (500 μM thick) was removed by sterile forceps to artificially generate a 500 μm of cell-free gap. The cell gap was monitored by a light microscope (Nikon, Japan) equipped with Spot digital camera and the gap distance was measured at 0, 16, and 24 h after the wall was removed. The migratory distance was defined as 500 μm minus the cell-free gap distance.

Cell apoptosis assay

Cells in 80% confluent was treated with PB221 (20 μM) in the absence or presence of the antioxidant NAC (10 μM) or α-tocopherol (10 μM) for 24 h. Cells were then removed, re-suspended in 1x Annexin-V binding buffer containing Annexin-V and PI, and incubated at room temperature for 15 min. FACS analysis was performed on BD LSRFortessa™ flow cytometry (Becton Dickinson) and the percentage of apoptotic cells was analyzed by BD FACSDiva software.

Quantification of mitochondria superoxide

ALTS1C1 and U87 cells were seeded into 12-well plates 24 h before treatment with PB221 (50 μM) for 2 h at 37 °C in presence or absence of lipid antioxidant α-tocopherol (100 μM) followed by staining with MitoSOX™ Red (5 μM). Two hours after incubation, cells were harvested and washed twice with PBS before analysis. The oxidation product of MitoSOX™ Red was detected by BD FACSCanto™ with an emission maximum of 580 nm.

Statistics

The statistical analysis was done by GraphPad Prism software version 7 package. All data presented as mean ± standard error of measurement. The difference between control and treatment group was derived from two-tailed Student’s t-test or one-way ANOVA and was determined to be statically significant when P-values were ≤ 0.05. The surviving curve comparison was calculated to compare two groups by Log-rank (Mantel-Cox) test.

Results

The overexpression of the sigma-2 receptor in various types of cancers, including breast carcinoma, melanoma, prostate cancer, pancreatic tumors, and brain tumors [14, 27], has caused sigma-2 receptor ligands to be potential drugs for monitoring and treating cancer [18, 28]. Previous studies have shown that several derivatives of the high affinity sigma-2 receptor agonist PB28 (1-cyclohexyl-4-[3-(5-methoxy-1,2,3,4-tetrahydronaphthalen-1-yl)propyl]piperazine), have the ability to inhibit the growth of pancreatic cancer [20, 25] and the neuroblastoma SK-N-SH cell line [19]. Among the series of PB28 derivatives, PB221 (4-cyclohexyl-1-[3- (5-methoxy-1, 2, 3, 4-tetrahydronaphthalen-1-yl) propyl]peperidine) stood out for its sigma-2 vs. sigma-1 selectivity (sigma-1 Ki = 143 nM; sigma-2 Ki = 18.8 nM) and, more importantly, for its potent cytotoxic activity against neuroblastoma SK-N-SH cells (IC50 = 3.64 μM) [19]. The present study aimed to determine if PB221 also shows potential for treating brain cancer. Its cytotoxicity against the murine astrocytoma cell line ALTS1C1 and murine pancreatic cell line UN-KC6141 was initially examined by cytotoxicity assay. Figure 1a shows that the IC50 (half maximal inhibitory concentration) of PB221 for ALTS1C1 is 10.61 ± 0.96 μM (solid circle curve of Fig. 1a), which is significantly different from the IC50 of 11.78 ± 1.32 μM of its parental drug, PB28 (the ALTS1C1* open circle curve of Fig. 1a). The IC50 of PB221 for ALTS1C1 is also comparable with the IC50 of the murine pancreatic cell line UN-KC6141 of 13.13 ± 1.15 μM. The similar IC50 for these two cell lines correlated with the similar binding ability of these cells to the selective fluorescent sigma-2 receptor ligand, NO1 (Fig. 1b) [24]. This suggests that PB221 may have similar therapeutic potential for brain tumors as shown for pancreatic tumors through the binding of sigma-2 receptors [20].
Fig. 1

The responses of brain and pancreatic cell lines to the cytotoxicity of PB221 and binding affinity with selective sigma-2 receptor agonist ligand, NO1. (a) The survival curve of various cell lines in response to a range of PB221 and PB28 concentration for 3 days was measured by MTT assay. The IC50 for murine astrocytoma ALTS1C1 cells and murine pancreatic UN-KC6141 cells was 10.61 and 13.13 μM, respectively. ALTS1C1* open circle curve is the responsive curve of ALTS1C1 to PB28 and the IC50 is 11.78 μM. (b) The binding affinity of ALTS1C1 and UN-KC6141 cells with selective sigma-2 receptor ligand, NO1, was examined by fluorescent plate reader and the relative fluorescent unit (RFU) was measured with the excitation of 390 nm and emission at 525 nm

The responses of brain and pancreatic cell lines to the cytotoxicity of PB221 and binding affinity with selective sigma-2 receptor agonist ligand, NO1. (a) The survival curve of various cell lines in response to a range of PB221 and PB28 concentration for 3 days was measured by MTT assay. The IC50 for murine astrocytoma ALTS1C1 cells and murine pancreatic UN-KC6141 cells was 10.61 and 13.13 μM, respectively. ALTS1C1* open circle curve is the responsive curve of ALTS1C1 to PB28 and the IC50 is 11.78 μM. (b) The binding affinity of ALTS1C1 and UN-KC6141 cells with selective sigma-2 receptor ligand, NO1, was examined by fluorescent plate reader and the relative fluorescent unit (RFU) was measured with the excitation of 390 nm and emission at 525 nm Additionally, RT-PCR (Fig. 2a) and quantitative RT-PCR (Fig. 2b) showed that both ALTS1C1 and UN-KC6141 cells expressed TMEM97 mRNA. TMEM97 was recently identified as the sigma-2 receptor [13] and is expressed by human glioma cell lines [21]. The suppression of TMEM97 could inhibit the proliferation, migration, and invasion of U87 and U373 human glioma cell lines [21]. The in vitro migration and invasion assays showed that a low dose (1 μM) of PB221, with minimal effects on the cell growth rate, significantly inhibited the migration (Fig. 3a and b, P < 0.05) and invasion (Fig. 3c and d, P < 0.001) of ALTS1C1 murine astrocytoma. The reduction of cell migration was significant at 16 h but was not very significant at 24 and 36 h, suggesting the inhibiting effect of the non-toxic dosage of PB221 on ALTS1C1 is transient. A recent publication shows that the activation of the sigma-2 receptor signaling pathway could lead to the production of mitochondrial superoxide in pancreatic cells [20]. Here, we found that the administration of PB221 could also increase the level of mitochondrial superoxide in murine astrocytoma cells (ALTS1C1) and human glioma cells (U87) (Fig. 4a). Furthermore, we found that the inhibitory effect of PB221 on the invasion, migration, and cell survival of ALTS1C1 was associated with mitochondrial superoxide production. Our results reveals that the effect of PB221-reduced migration and invasion (Fig. 4b and c) and the PB221-induced apoptotic cell death (Fig. 4d) on ALTS1C1 could be reduced by the lipid antioxidant α-tocopherol, but not by the hydrophilic N-acetylcysteine, as previously verified for PB28 derivatives [20] and by differently structured sigma-2 ligands, such as thiosemicarbazones in pancreatic tumor cells [29].
Fig. 2

The expression of TMEM97 by ALTS1C1 and UN-KC6141 cells. The expression of TMEM97 mRNA by normal brain cells, ALTS1C1 and UN-KC6141 cells was assessed by (a) RT-PCR and (b) quantitative PCR (Q-PCR). The difference (ΔCt) between the Ct of the gene transcript and the endogenous control β-actin determined the gene expression level

Fig. 3

Effects of PB221 on brain tumor cell migration and invasion. (a) Represented pictures of migration assay illustrate the retarded cell migration rate of ALTS1C1 cells following 1 μM PB221 treatment for 16 h. Scale bar = 100 μm. (b) A summary graph for the dose and time effects of PB221 on the migration distance of ALTS1C1 cells. *: P < 0.05 compared with control. (c) Represented pictures of invasion assay reveal the decrease of invasion cells following various doses of PB221 treatment for 16 h. (d) A summary graph for the dose effects of PB221 on ALTS1C1 cell invasion ability. ***: P < 0.001 compared with control

Fig. 4

The effect of anti-oxidant on PB221 effects on ALTS1C1 (a) A summary graph reveals the level of mitochondria superoxide in brain tumor cell lines, U87-MG and ALTS1C1 following PB221 stimulation was measured by the fluorescent intensity of MitoSoxTM Red using flow cytometry. (b) Represented pictures of migration and invasion assays illustrate the effect of anti-oxidant α-tocopherol and NAC on PB221 (1 μM)-inhibited migration and invasion ability of ALTS1C1 cells. Scale bar = 100 μm. (c) A summary graph shows the preventing effect of 10 μM of α-tocopherol, but not NAC, on PB221 (1 μM)-inhibited migration and invasion ability of ALTS1C1 cells. (d) A summary graph reveals the preventing effect of 10 μM of α-tocopherol, but not NAC, on PB221 (20 μM)-induced apoptotic cell death of ALTS1C1 cells assayed by flow cytometry. *: P < 0.05. **: P < 0.01. ***: P < 0.001

The expression of TMEM97 by ALTS1C1 and UN-KC6141 cells. The expression of TMEM97 mRNA by normal brain cells, ALTS1C1 and UN-KC6141 cells was assessed by (a) RT-PCR and (b) quantitative PCR (Q-PCR). The difference (ΔCt) between the Ct of the gene transcript and the endogenous control β-actin determined the gene expression level Effects of PB221 on brain tumor cell migration and invasion. (a) Represented pictures of migration assay illustrate the retarded cell migration rate of ALTS1C1 cells following 1 μM PB221 treatment for 16 h. Scale bar = 100 μm. (b) A summary graph for the dose and time effects of PB221 on the migration distance of ALTS1C1 cells. *: P < 0.05 compared with control. (c) Represented pictures of invasion assay reveal the decrease of invasion cells following various doses of PB221 treatment for 16 h. (d) A summary graph for the dose effects of PB221 on ALTS1C1 cell invasion ability. ***: P < 0.001 compared with control The effect of anti-oxidant on PB221 effects on ALTS1C1 (a) A summary graph reveals the level of mitochondria superoxide in brain tumor cell lines, U87-MG and ALTS1C1 following PB221 stimulation was measured by the fluorescent intensity of MitoSoxTM Red using flow cytometry. (b) Represented pictures of migration and invasion assays illustrate the effect of anti-oxidant α-tocopherol and NAC on PB221 (1 μM)-inhibited migration and invasion ability of ALTS1C1 cells. Scale bar = 100 μm. (c) A summary graph shows the preventing effect of 10 μM of α-tocopherol, but not NAC, on PB221 (1 μM)-inhibited migration and invasion ability of ALTS1C1 cells. (d) A summary graph reveals the preventing effect of 10 μM of α-tocopherol, but not NAC, on PB221 (20 μM)-induced apoptotic cell death of ALTS1C1 cells assayed by flow cytometry. *: P < 0.05. **: P < 0.01. ***: P < 0.001 The above in vitro results reveal the potential of PB221 as a target agent for sigma-2 overexpressing tumors. We used an intramuscular ALTS1C1 tumor model to further examine the potential of PB221 as a therapeutic drug for brain tumors. Figure 5a shows that the administration of four doses of PB221 (2 mg/mouse/injection) significantly (P < 0.001 at day 19) delayed the growth rate of ALTS1C1, with similar results as those for one dose of TMZ (2 mg/mouse/injection). However, the mice receiving one dose of TMZ were too sick to receive further treatment of TMZ. Conversely, mice could tolerate up to four doses of PB221, despite reduced body weight, which gradually returned to within the normal range in 11 days (Fig. 5b). The clinical importance of PB221 for brain tumors was further examined in an orthotopic model. Although the four doses of PB221 (2 mg/mouse/injection) was tolerable for mice carrying intramuscular tumors, the mice needed 10 days to regain their body weight. Despite this unwanted side effect, PB221 was not discarded as a potential therapeutic agent considering its promising effect against intracranial tumors. Rather, the administration protocol of PB221 was reduced to 1 mg/mouse/injection but extended to five doses in a week. Figure 5c shows that administering PB221 effectively prolonged the mean survival time of ALTS1C1 tumor-bearing mice by 20% (26 vs. 31 days, P < 0.0001). Figure 5d again demonstrates that five doses of PB221 (1 mg/mouse/injection) were tolerated well by treated mice bearing ALTS1C1 tumors for 10 days. Figure 5b and d also show that PB221 had similar side effects as the current therapeutic drug, TMZ, and was tolerable with the modified administration procedure. This result clearly demonstrates that PB221 has potential as an alternative agent for brain tumor therapy.
Fig. 5

The in vivo anti-tumor effects of PB221 against ALTS1C1 tumors. (a) The tumor growth curves of intramuscular ALTS1C1 tumors following the treatment of PB221 and TMZ. One dose of TMZ (2 mg/mouse/injection) and 4 doses of PB221 (2 mg/mouse/injection) were intraperitoneally injected into tumor-bearing mice at day 10 following the tumor inoculation as indicated by the arrows in the graph. The data represented the average tumor volume in each group from one representative experiment of three independent experiments. *: P < 0.05. **: P < 0.01. ***: P < 0.001. (b) The change of mouse body weight following the intramuscular tumor implantation and the treatment of 4 doses of PB221 (2 mg/mouse/injection) and one dose of TMZ (2 mg/mouse/injection). *: P < 0.05. (c) The animal survival curve for mouse-bearing intracranial ALTS1C1 tumor and the treatment of 5 doses of PB221 (1 mg/mouse/injection) and one dose of TMZ (2 mg/mouse/injection). **: P < 0.01; ****: P < 0.0001. (d) The change of mouse body weight following the intracranial tumor inoculation and the treatment of 5 doses of PB221 (1 mg/mouse/injection) and one dose of TMZ (2 mg/mouse/injection). *: P < 0.05. **: P < 0.01

The in vivo anti-tumor effects of PB221 against ALTS1C1 tumors. (a) The tumor growth curves of intramuscular ALTS1C1 tumors following the treatment of PB221 and TMZ. One dose of TMZ (2 mg/mouse/injection) and 4 doses of PB221 (2 mg/mouse/injection) were intraperitoneally injected into tumor-bearing mice at day 10 following the tumor inoculation as indicated by the arrows in the graph. The data represented the average tumor volume in each group from one representative experiment of three independent experiments. *: P < 0.05. **: P < 0.01. ***: P < 0.001. (b) The change of mouse body weight following the intramuscular tumor implantation and the treatment of 4 doses of PB221 (2 mg/mouse/injection) and one dose of TMZ (2 mg/mouse/injection). *: P < 0.05. (c) The animal survival curve for mouse-bearing intracranial ALTS1C1 tumor and the treatment of 5 doses of PB221 (1 mg/mouse/injection) and one dose of TMZ (2 mg/mouse/injection). **: P < 0.01; ****: P < 0.0001. (d) The change of mouse body weight following the intracranial tumor inoculation and the treatment of 5 doses of PB221 (1 mg/mouse/injection) and one dose of TMZ (2 mg/mouse/injection). *: P < 0.05. **: P < 0.01

Discussion

After more than a decade of trials with various novel compounds, the poor prognosis for glioma patients is still a challenge for brain tumor therapy. TMZ-based radiotherapy remains the standard care and main treatment strategy despite the static survival rate of around 15%. Also, the 20% increase in the median survival rate from radiotherapy (12.1 to 14.6 months) by TMZ [1] remains unchanged because TMZ mainly targets tumors with aberrant MGMT proteins. Finding new compounds is urgently needed. In this study, we reported the potential of the sigma-2 receptor agonist PB221 for treating brain tumors in a murine ALTS1C1 tumor model. We demonstrated that the tolerated dose of PB221 could increase the survival time of mice bearing intracranial brain tumors by 20%. The overexpression of the sigma-2 receptor by cancer cells has been reported in several types of tumors, including breast, pancreatic, and brain tumors [14, 18]. This has led to the discovery of sigma-2 receptor ligands as potential compounds in cancer diagnosis and therapy [28]. Among the many sigma-2 receptor ligands, serial analogues of PB28 have been developed and their potential for cancer imaging and therapy, addressed [15, 16, 18–20, 24, 25, 30]. Berardi et al. showed that one PB28 derivative, PB221, had a 3-fold increase on in vitro antiproliferation activity against neuroblastoma SK-N-SH cells compared with parental PB28 (EC50 = 3.64 ± 0.68 vs 9.97 ± 0.55) [19]. The structural difference in the basic moiety (piperidine for PB221 and piperazine for PB28) of the two compounds causes PB221 to have a much higher selectivity for the sigma-2 receptor than PB28. Furthermore, a recent study by Pati et al. not only demonstrated PB221 as a promising drug for pancreatic cancer, but also identified the cytotoxic pathway of PB221 which involves elevating mitochondrial superoxide production and causing caspase activation in Panc02 pancreatic cancer cells [20]. Our study demonstrated that PB221 not only has antiproliferation activity against brain tumor cells, but also retards the migration and invasion ability of highly invasive murine astrocytoma cells in vitro. Previous studies have shown that different structures of PB28-derived sigma-2 ligands killed pancreatic tumor cells through different mechanisms. For example, the killing action of PB183 [20] and SW43 [31] of pancreatic cancer cells is caspase-independent and relies more on cellular oxidation. Conversely, the antitumor effect of PB221 depends on the caspase-associated apoptotic pathway and mitochondrial superoxide activity [20, 29]. We found that the increase in the level of mitochondrial superoxide caused by the administration of PB221 also occurred in murine astrocytoma cells (ALTS1C1) and human glioma cells (U87). This suggests that an oxidation-associated pathway may similarly be involved in the cytotoxic effect of PB221 on brain tumor cells with PB221-induced apoptotic cell death counteracted by the lipid antioxidant α-tocopherol, but not by the hydrophilic N-acetylcysteine. Indeed, this study illustrated that the effects of PB221 on slowing brain tumor cell migration and invasion was through mitochondrial superoxide production. This evidence demonstrates that the antitumor activities of PB221 are mediated mainly by mitochondrial superoxide production in both pancreatic [20, 29] and brain (current study) cancers. These results are in agreement with similar results from thiosemicarbazones sigma-2 ligands in pancreatic tumor cells [29], confirming the mitochondrial superoxide production as a common outcome of sigma-2 receptor ligand activity. Our results showed that a non-lethal dose of PB221 transiently inhibited the migration and invasion of ALTS1C1, which is similar to using an siRNA approach to silence the TMEM97 gene (proposed as a sigma-2 receptor gene) [13]; however, the effect of the latter is permanent, while the effect of a non-lethal dose of PB221 is transient. This, together with previous biological data on binding and activity in sigma-2 overexpressing cells [19, 20], supports the idea that the sigma-2 receptor is a likely target molecule of PB221. In addition, our result also showed that PB221 could inhibit the proliferation of murine astrocytoma cells (ALTS1C1) and murine pancreatic cells (UN-KC6141). All of these cells not only express mRNA of the TMEM97 gene, but also strongly bind to the sigma-2-selective fluorescent tracer (NO1) [24]. This further supports PB221 as a selective agonist of the sigma-2 receptor. Finally, ALTS1C1 cells also showed a good binding affinity to another selective sigma-2 receptor ligand, PB385 (Additional file 1: Figure S1). However, besides the sigma-2 receptor, other targets for PB221 should not be ruled out.

Conclusions

This study illustrated that a tolerable dose of PB221 could delay tumor growth and extend the survival time of ALTS1C1 tumor-bearing mice by 20%, which is slightly better than a similar tolerable dose of TMZ (~ 12% increase of survival time). These results propose PB221 as a potential drug for treating brain tumors. Figure S1. ALTS1C1 cell line had high binding affinity with selective sigma-2 receptor ligand, PB385. ALTS1C1 cells were incubated with PB385 (1 nM, 5 nM, 10 nM and 1 μM) for 1 h at room temperature, and the binding affinity was analyzed by flow cytometry. (TIF 5646 kb)
  30 in total

Review 1.  Early development of sigma-receptor ligands.

Authors:  Sanju Narayanan; Rohit Bhat; Christophe Mesangeau; Jacques H Poupaert; Christopher R McCurdy
Journal:  Future Med Chem       Date:  2011-01       Impact factor: 3.808

2.  Fluorescent derivatives of σ receptor ligand 1-cyclohexyl-4-[3-(5-methoxy-1,2,3,4-tetrahydronaphthalen-1-yl)propyl]piperazine (PB28) as a tool for uptake and cellular localization studies in pancreatic tumor cells.

Authors:  Carmen Abate; John R Hornick; Dirk Spitzer; William G Hawkins; Mauro Niso; Roberto Perrone; Francesco Berardi
Journal:  J Med Chem       Date:  2011-07-20       Impact factor: 7.446

3.  Analogues of σ receptor ligand 1-cyclohexyl-4-[3-(5-methoxy-1,2,3,4-tetrahydronaphthalen-1-yl)propyl]piperazine (PB28) with added polar functionality and reduced lipophilicity for potential use as positron emission tomography radiotracers.

Authors:  Carmen Abate; Mauro Niso; Enza Lacivita; Philip D Mosier; Annamaria Toscano; Roberto Perrone
Journal:  J Med Chem       Date:  2011-01-13       Impact factor: 7.446

4.  A sigma-like binding site in rat pheochromocytoma (PC12) cells: decreased affinity for (+)-benzomorphans and lower molecular weight suggest a different sigma receptor form from that of guinea pig brain.

Authors:  S B Hellewell; W D Bowen
Journal:  Brain Res       Date:  1990-09-17       Impact factor: 3.252

Review 5.  Recurrent glioblastoma multiforme: a review of natural history and management options.

Authors:  Lewis C Hou; Anand Veeravagu; Andrew R Hsu; Victor C K Tse
Journal:  Neurosurg Focus       Date:  2006-04-15       Impact factor: 4.047

6.  Tumor-secreted SDF-1 promotes glioma invasiveness and TAM tropism toward hypoxia in a murine astrocytoma model.

Authors:  Shu-Chi Wang; Ji-Hong Hong; Chuen Hsueh; Chi-Shiun Chiang
Journal:  Lab Invest       Date:  2011-09-05       Impact factor: 5.662

7.  Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma.

Authors:  Roger Stupp; Warren P Mason; Martin J van den Bent; Michael Weller; Barbara Fisher; Martin J B Taphoorn; Karl Belanger; Alba A Brandes; Christine Marosi; Ulrich Bogdahn; Jürgen Curschmann; Robert C Janzer; Samuel K Ludwin; Thierry Gorlia; Anouk Allgeier; Denis Lacombe; J Gregory Cairncross; Elizabeth Eisenhauer; René O Mirimanoff
Journal:  N Engl J Med       Date:  2005-03-10       Impact factor: 91.245

8.  Exploring the importance of piperazine N-atoms for sigma(2) receptor affinity and activity in a series of analogs of 1-cyclohexyl-4-[3-(5-methoxy-1,2,3,4-tetrahydronaphthalen-1-yl)propyl]piperazine (PB28).

Authors:  Francesco Berardi; Carmen Abate; Savina Ferorelli; Vincenzo Uricchio; Nicola A Colabufo; Mauro Niso; Roberto Perrone
Journal:  J Med Chem       Date:  2009-12-10       Impact factor: 7.446

9.  Lysosomal membrane permeabilization is an early event in Sigma-2 receptor ligand mediated cell death in pancreatic cancer.

Authors:  John R Hornick; Suwanna Vangveravong; Dirk Spitzer; Carmen Abate; Francesco Berardi; Peter Goedegebuure; Robert H Mach; William G Hawkins
Journal:  J Exp Clin Cancer Res       Date:  2012-05-02

10.  The novel sigma-2 receptor ligand SW43 stabilizes pancreas cancer progression in combination with gemcitabine.

Authors:  John R Hornick; Jinbin Xu; Suwanna Vangveravong; Zhude Tu; Jonathan B Mitchem; Dirk Spitzer; Peter Goedegebuure; Robert H Mach; William G Hawkins
Journal:  Mol Cancer       Date:  2010-11-22       Impact factor: 27.401

View more
  13 in total

Review 1.  Roles, molecular mechanisms, and signaling pathways of TMEMs in neurological diseases.

Authors:  Qinghong Chen; Junlin Fang; Hui Shen; Liping Chen; Mengying Shi; Xianbao Huang; Zhiwei Miao; Yating Gong
Journal:  Am J Transl Res       Date:  2021-12-15       Impact factor: 4.060

2.  TMEM97 is transcriptionally activated by YY1 and promotes colorectal cancer progression via the GSK-3β/β-catenin signaling pathway.

Authors:  Dong Mao; Xiaowei Zhang; Zhaoping Wang; Guannan Xu; Yun Zhang
Journal:  Hum Cell       Date:  2022-07-30       Impact factor: 4.374

3.  Neuroprotective Effects of σ2R/TMEM97 Receptor Modulators in the Neuronal Model of Huntington's Disease.

Authors:  Jing Jin; Nicolas Arbez; James J Sahn; Yan Lu; Kathryn T Linkens; Timothy R Hodges; Anthony Tang; Robyn Wiseman; Stephen F Martin; Christopher A Ross
Journal:  ACS Chem Neurosci       Date:  2022-09-15       Impact factor: 5.780

Review 4.  Multi-Target Directed Ligands (MTDLs) Binding the σ1 Receptor as Promising Therapeutics: State of the Art and Perspectives.

Authors:  Francesca Serena Abatematteo; Mauro Niso; Marialessandra Contino; Marcello Leopoldo; Carmen Abate
Journal:  Int J Mol Sci       Date:  2021-06-14       Impact factor: 5.923

Review 5.  Sigma-2 Receptor-A Potential Target for Cancer/Alzheimer's Disease Treatment via Its Regulation of Cholesterol Homeostasis.

Authors:  Kai Yang; Cheng Zeng; Changcai Wang; Meng Sun; Dan Yin; Taolei Sun
Journal:  Molecules       Date:  2020-11-20       Impact factor: 4.411

Review 6.  PB28, the Sigma-1 and Sigma-2 Receptors Modulator With Potent Anti-SARS-CoV-2 Activity: A Review About Its Pharmacological Properties and Structure Affinity Relationships.

Authors:  Carmen Abate; Mauro Niso; Francesca Serena Abatematteo; Marialessandra Contino; Nicola Antonio Colabufo; Francesco Berardi
Journal:  Front Pharmacol       Date:  2020-12-07       Impact factor: 5.810

7.  Histatin-1 is an endogenous ligand of the sigma-2 receptor.

Authors:  Kyung-No Son; Hyun Lee; Dhara Shah; Sushma Kalmodia; Ryan Cree Miller; Marwan Ali; Arun Balasubramaniam; Stephanie M Cologna; Hyunjoon Kong; Deepak Shukla; Vinay Kumar Aakalu
Journal:  FEBS J       Date:  2021-07-23       Impact factor: 5.542

8.  Recent Advances in the Development of Sigma Receptor Ligands as Cytotoxic Agents: A Medicinal Chemistry Perspective.

Authors:  Antonino N Fallica; Valeria Pittalà; Maria N Modica; Loredana Salerno; Giuseppe Romeo; Agostino Marrazzo; Mohamed A Helal; Sebastiano Intagliata
Journal:  J Med Chem       Date:  2021-06-02       Impact factor: 7.446

9.  MRP1-Collateral Sensitizers as a Novel Therapeutic Approach in Resistant Cancer Therapy: An In Vitro and In Vivo Study in Lung Resistant Tumor.

Authors:  Chiara Riganti; Roberta Giampietro; Joanna Kopecka; Costanzo Costamagna; Francesca Serena Abatematteo; Marialessandra Contino; Carmen Abate
Journal:  Int J Mol Sci       Date:  2020-05-08       Impact factor: 5.923

10.  Modeling human pediatric and adult gliomas in immunocompetent mice through costimulatory blockade.

Authors:  Xiaoyan Lan; Dorota A Kedziorek; Chengyan Chu; Anna Jablonska; Shen Li; Mihoko Kai; Yajie Liang; Miroslaw Janowski; Piotr Walczak
Journal:  Oncoimmunology       Date:  2020-06-05       Impact factor: 8.110

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.