Haibo Zou1, Xiangang Xu2, Lanyun Luo1, Yu Zhang3, Le Luo1, Yutong Yao1, Guangming Xiang1, Xiaolun Huang1, Guan Wang1. 1. Department of Hepatobiliary Surgery, Sichuan Academy of Medical Sciences & Sichuan Provincial People's Hospital , Chengdu , Sichuan , China. 2. Department of Hepatobiliary Surgery, Guizhou Provincial People's Hospital , Guiyang , Guizhou , China. 3. Graduate School, Chengdu Medical College , Chengdu , Sichuan , China.
Abstract
The present research was major in investigating the regulation association among hsa_circ_0101432 (has_circ_RPPH1), miR-1258, miR-622 and MAPK1 in hepatocellular carcinoma (HCC), and we explored the mechanism underlying pathogenesis of HCC. Microarray analysis was employed to detect hsa_circ_0101432 expression in HCC. Hsa_circ_0101432 was verified as a circRNA by testing divergent primers and RNase R. And qRT-PCR was performed to determine the expression of hsa_circ_0101432, miR-1258, miR-622 and MAPK1 mRNA. Furthermore, miRanda predicted that mRNAs targeted miR-1258 and miR-622. CCK-8 assay, colony formation assay, flow cytometry as well as transwell assay were performed to detect cell viability, proliferation, apoptosis and invasive ability, respectively. Xenograft in nude mice was applied to observe tumor growth in vivo. Up-regulated hsa_circ_0101432 and down-regulated miR-1258 and miR-622 were detected in HCC while Hsa_circ_0101432 enhanced expression of MAPK1 mRNA by targeting miR-1258 and miR-622. Knocking down hsa_circ_0101432 or overexpressing miR-1258 and miR-622 inhibited proliferation and invasive ability of HCC cell and promoted cell apoptosis. Hsa_circ_0101432 was confirmed to promote tumor growth via inhibiting miR-1258 and miR-622 expression and promoting MAPK1 mRNA expression by in vivo experiment. Hsa_circ_0101432 inhibited HCC cell apoptosis, promoted cell proliferation, invasive ability and HCC tumor growth by targeting miR-1258 and miR-622 and upregulating MAPK1 mRNA expression.
The present research was major in investigating the regulation association among hsa_circ_0101432 (has_circ_RPPH1), miR-1258, miR-622 and MAPK1 in hepatocellular carcinoma (HCC), and we explored the mechanism underlying pathogenesis of HCC. Microarray analysis was employed to detect hsa_circ_0101432 expression in HCC. Hsa_circ_0101432 was verified as a circRNA by testing divergent primers and RNase R. And qRT-PCR was performed to determine the expression of hsa_circ_0101432, miR-1258, miR-622 and MAPK1 mRNA. Furthermore, miRanda predicted that mRNAs targeted miR-1258 and miR-622. CCK-8 assay, colony formation assay, flow cytometry as well as transwell assay were performed to detect cell viability, proliferation, apoptosis and invasive ability, respectively. Xenograft in nude mice was applied to observe tumor growth in vivo. Up-regulated hsa_circ_0101432 and down-regulated miR-1258 and miR-622 were detected in HCC while Hsa_circ_0101432 enhanced expression of MAPK1 mRNA by targeting miR-1258 and miR-622. Knocking down hsa_circ_0101432 or overexpressing miR-1258 and miR-622 inhibited proliferation and invasive ability of HCC cell and promoted cell apoptosis. Hsa_circ_0101432 was confirmed to promote tumor growth via inhibiting miR-1258 and miR-622 expression and promoting MAPK1 mRNA expression by in vivo experiment. Hsa_circ_0101432 inhibited HCC cell apoptosis, promoted cell proliferation, invasive ability and HCC tumor growth by targeting miR-1258 and miR-622 and upregulating MAPK1 mRNA expression.
Regarded as one of the most malignant and common cancer, hepatocellular carcinoma (HCC) is the fifth leading cancer and the second preeminent cause of cancer-related deaths in the world [1]. Despite the critical factors which play important roles in HCC incidence and development are found, HCC patients have not substantially gotten an enhanced survival rate over the past decades [2]. As HCC is notoriously refractory for standard system therapy, surgery, radiotherapy and chemotherapy still have a deficiency for patients’ diagnosis of advanced stages, while patients of the early stages of HCC can be successfully cured [3].The positron emission tomography (PET) scan is the newest imaging modality used in detecting HCC tumor foci [4]. As both HCC cells and healthy hepatocytes keep high metabolic activity and expend significant amounts of glucose, it brought difficulties in detecting liver tumor foci by PET under physiological conditions [5,6]. Therefore, the identification of the pathogenic mechanisms and novel targets is promptly needed for HCC.Recently, people have paid a lot of attention to circular RNAs (circRNAs), a type of endogenous non-coding RNAs (ncRNAs) that covalently join the 3’ and 5’ ends together and form circular loops [7]. They are important in a variety of biological processes, such as cell development, proliferation, apoptosis, cancer metastasis and invasiveness [8,9]. According to the forecast, they are competitively combined with miRNA binding sites, which could vary miRNA expression. For example, Yu et al. found that circRNA Cdr1as participated in the regulation network of HCC through targeting miR-7 [10]. The development of HCC is a complex process that involves the accumulation of gene regulation alteration at multiple levels, and ceRNAs (competing endogenous RNAs) are identified to be influenced by molecules such as transcriptional factors. Lin et al. performed an integrated analysis of differentially expressed circRNAs, miRNAs and mRNAs in HCC and discovered the circRNA-miRNA-mRNA regulatory network of hsa_circ_0078279, hsa_circ_0007456 and hsa_circ_0004913 in HCC [11]. Fu et al. explored the hsa_circ_0005986/miR-129-5p/NOTCH1 axis to find that hsa_circ_0005986 could affect the cell cycle and cell proliferation of HCC via the G0/G1 phase transition regulation [3]. These researches illustrate why miRNA–circRNA interaction is regarded as one of the best therapeutic directions [12]. Hsa_circ_0101432 belongs to the family of circRNAs and targets miR-1258 and miR-622 simultaneously, but the exact role of hsa_circ_ 0101432 in HCC remains to be confirmed.MicroRNAs (miRNAs), small RNA molecules composed of 19–23 nucleotide acids, are able to regulate their target genes directly by binding with their 3ʹ-untranslated regions [13]. The dysregulated expression of miRNAs has been correlated with many human diseases, including HCC. It was proved that miR-1258 had inhibitory effects on cell growth and proliferation in HCC. MiR-1258 could also suppress the progression of HCC by targeting CDC28 protein kinase regulatory subunit 1B [14]. Furthermore, several evidence indicated that miR-622 was frequently downregulated in gastric cancer [15], pancreatic adenocarcinoma and ampullary adenocarcinoma [16]. Song et al. investigated the abnormal expression and prognostic significance of miR-520a-3p in HCC, and found that miR-520a-3p suppressed the growth and induced apoptosis of HCC cell lines MHHC-97H and Hep3B [17]. Liu et al. indicated that the coordinated expression of EZH2/miR-622/CXCR4 axis might be a prediction of worse prognostic in patients suffered HCC [18]. Thus, the relation of miR-1258 and miR-622 is considered to be an ideal direction of therapy in HCC.Mitogen-Activated Protein Kinase 1 (MAPK1), the downstream signal of MAPK, is a protein kinase that consists of serine-threonine kinases [19]. MAPK1 constitutes an essential signal transduction cascade that is pivotal in cell growth, differentiation, proliferation, apoptosis, and migration [20]. The MAPK signaling pathway includes some key signaling components and phosphorylation events which play a pivotal role in tumorigenesis [21] and MAPK has been reported to change the signaling pathway of human cancer. Zou et al. identified that MAPK1 mutation might be involved in the tumorigenesis of ovarian mixed germ cell tumors [22]. In addition, the report of Kong et al. showed that lncRNA XIST regulated expression of MAPK1 to promote HCC progression [23]. All of these researches indicate that MAPK1 can be a potential therapeutic target to treat HCC.In this study, we probed the expressions of hsa_circ_ 0101432, miR-1258, miR-622 and MAPK1 in HCC tissues by bioinformatics assay. Meanwhile, it was verified that miR-1258 and miR-622 were the common target miRNAs of hsa_circ_0101432 and MAPK1 in vitro. Hsa_circ_0101432 was proved to promote the development of HCC by regulating expression levels of miR-1258, miR-622 and MAPK1.
Materials and methods
Tissue sample collection
Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital provided us with 43 pairs of HCC tissues and matched normal liver tissues, and clinical characteristics of HCC patients are provided in Supplementary Table 1. And all of the patients did not receive any chemotherapy or radiotherapy before surgery. We used a histopathological evaluation to diagnose HCC. Tissue samples were snap frozen in liquid nitrogen and stored at −80°C for further use. To carry on this study, we gained the approval of the Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital.
Microarray analysis
Gene expression data of GSE78520, GSE94508 and GSE97332 were obtained from the Biotechnology Information (NCBI) Gene Expression Omnibus (GEO). GSE78520 of HCC samples from three donors, including three adjacent normal tissues and three liver cancer tissues. GSE94508 contained 10 human samples derived from HCC tissues and paracancerous tissues. GSE97332 included seven normal hepatic tissues and seven HCC tumor tissues. GPL19978 platform was used to analyze three gene chips. Screening for differentially expressed genes was used in the Limma package, with the screening criteria |log2(FC)|>1, P < 0.05. The target miRNAs of hsa_circ_0101432 were predicted by https://circinteractome.nia.nih.gov/.
Cell culture
Normal liver cell line (HL-7702) and four human HCC cell lines (Huh-7, SK-HEP-1, HepG2 and HLE) were obtained from BeNa Culture Collection (Beijing, China). HL-7702 cells, SK-HEP-1 cells and HLE cells were maintained in RPMI-1640 medium (Sigma, St. Louis, MO, USA) with 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA) while Huh-7 cells and HepG2 cells were cultured in High Glucose Dulbecco’s modified Eagle’s medium (DMEM-H) (Sigma, St. Louis, MO, USA) with 10% FBS. All cells were cultured at 37°C with 5% CO2.
Cell transfection
Cells in good condition were set on six-well plates (1 × 106). Transfection was performed by following the instructions on Lipofectamine® 2000 (Life Technologies, Gaithersburg, MD, USA). Discard the medium solution, add the prepared transfection mixture to the plate, and then incubated the cells at 37 ℃. It was divided into nine groups of cells: 1. NC group; 2. si-circ-1 group; 3. si-circ-2 group; 4. miR-1258 mimics group; 5. miR-1258 inhibitor group; 6. miR-622 mimics group; 7. miR-622 inhibitor group; 8. si-circ+miR-1258 inhibitor group; 9. si-circ+miR-622 inhibitor group. Sequences of hsa_circ_0101432 siRNAs, miRNAs mimics and inhibitor are shown in Table 1.
Table 1.
Sequence of siRNA, mimics and inhibitor.
Name
Sequence 5’→3’
hsa_circ_0101432
Si-1
5’- CAGGAGATGCCTGCGTCCTGT −3
Si-2
5’- AGATGCCTGCGTCCTGTCACT −3’
miR-1258
mimics
5’- AGUUAGGAUUAGGUCGUGGAA −3’
inhibitor
5’- UCAAUCCUAAUCCAGCACCUU −3’
miR-1296
mimics
5’- GAGUGGGGCUUCGACCCUAACC −3’
inhibitor
5’- CUCACCCCGAAGCUGGGAUUGG −3’
miR-622
mimics
5’- ACAGUCUGCUGAGGUUGGAGC −3’
inhibitor
5’- UGUCAGACGACUCCAACCUCG −3’
miR-326
mimics
5’- CCUCUGGGCCCUUCCUCCAG −3’
inhibitor
5’- GGAGACCCGGGAAGGAGGUC −3’
Sequence of siRNA, mimics and inhibitor.
QRT-PCR
Total RNA was extracted and quantified by TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) as well as NanoDrop 2000 (Thermo Fisher Scientific Inc., USA). RNA was transcribed into cDNA by using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). QRT-PCR was conducted by THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka, Japan). U6 and β-actin were used as internal quality controls. 2−∆∆Ct method was used to determine comparative quantification. The sequences of primer were provided in Table 2. All experiments were duplicated three times.
CircRNAs could be amplified by both divergent primers and convergent primers while lncRNAs were only amplified by convergent primers. Hsa_circ_0101432 and hsa_circ_0101432 genomic DNA (gDNA) were amplified by THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka, Japan) with convergent primers or divergent primers. Total RNA (5 μg) was kept in 3 U/μg of RNase R (Epicentre Biotechnologies, Madison, WI, USA) for 15 min at 37°C. Two RNase R digestion reactions were performed according to previously published methods. To detect cDNA and gDNA PCR products, we use TE buffer (Thermo Scientific, Waltham, MA, USA) in the agarose gel. All experiments were duplicated three times.
RNA pull-down assay
The Huh-7 cells were transfected in 50 nM biotinylated probes of the miR-1258 and miR-622 for 48 h. Then, cells were washed with ice-cold PBS, and were harvested and incubated in a lysis buffer (Sigma, St. Louis, MO, USA) on ice for 10 min. After that, we centrifugated the lysates. Fifty μL of the sample was aliquoted as input, and the remaining lysates were incubated with M-280 streptavidin magnetic beads (Sigma, St. Louis, MO, USA) coated with RNase-free BSA and yeast tRNA (Sigma, St. Louis, MO, USA). The beads were incubated at 4°C for 3 h and then washed thoroughly with buffer. The bound RNAs were isolated and then qRT-PCR was performed to detect RNA levels. All experiments were duplicated three times.
Dual luciferase reporter gene assay
Wild-type and mutated-type of MAPK1-3`UTR sequences were inserted into pmirGLO vectors in order to construct pGL3-MAPK1-3`UTR-WT and pGL3-MAPK1-3`UTR-MUT. MiRNA mimics (miR-1258 mimics or miR-622 mimics) and reporters were co-transfected by Lipofectamine® 2000 (Life Technologies, Gaithersburg, MD, USA). After transfection 24–48 h, the luciferase reporter activities were determined by the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, United States). All experiments were duplicated three times.
Cell proliferation assay
After transfection, Huh-7 and HepG2 cells (1.0104/well) were seeded in 96-well plates for 0 h, 24 h, 48 h and 72 h, and then 10 μL of CCK-8 solution (Dojindo, Kumamoto, Japan) was joined into each well at the specified time points. The absorbance of each well was detected at a wavelength of 450 nm by Microplate Reader (Bio-Rad, Hercules, CA, USA). All experiments were duplicated three times.
Colony formation assay
Cells were digested by trypsin and 500 cells were seeded in six-well plates at 37°C for 2 weeks. The supernatant medium changed per 3 days. The cells were mixed with 4% formaldehyde and stained by 0.1% crystal violet for 1 h. The number of colonies which were >50 cells were counted by Image J software. All experiments were duplicated three times.
Flow cytometry assay (FCM)
Si-circ-1, si-circ-2, miR-1258 and miR-622 mimics and inhibitors or NC oligonucleotides were transfected into Huh-7 cells. After transfection48 h, cells were harvested and washed by using PBS, and then resuspended in binding buffer. Cells were incubated in propidium iodide (PI) and Annexin V-fluresceinisot hiocyanate (FITC) in the dark at room temperature for 15 min. The ratio of cells undergoing apoptosis was calculated by a FACS Calibur (BD Biosciences, San Jose, CA, USA). All experiments were duplicated three times.
Transwell assay
Huh-7 invasive ability was assayed by using Transwell Matrigel invasive ability Chambers (BD Biosciences, San Jose, CA, USA). After 24 h transfection, the cells were seeded in serum-free DMEM-H on the upper wells of 24-well Transwell Matrigel chambers. DMEM-H medium with 10% FBS was served as chemoattractant filling the lower chamber. The non-invading cells and Metrigel matrix were wiped by cotton swabs. The invasive cells were mixed in methanol, stained with 0.1% crystal violet, and counted at 200 times magnification by an inverted microscope (Thermo Fisher Scientific, Waltham, MA, USA). Each sample from a total of five random fields was calculated. All experiments were duplicated three times.
Western blot
BCA Kit (Sigma-Aldrich, St. Louis, MO, USA) detected the protein concentration. After separating proteins by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), the protein was transferred to a polyvinylidene fluoride membrane (PVDF, Millipore, Billerica, MA, USA) and blocked by TBST containing 5% skim milk. Primary antibodies MAPK1 (1:500, ab32081, Abcam, Cambridge, MA, USA) and β-actin (1:500, ab8227, Abcam, Cambridge, MA, USA) were incubated at 4°C overnight, and then the membrane was incubated in the secondary antibody (goat anti-rabbit IgG labeled with horseradish peroxidase, 1:5000, Abcam, MA, USA) for 1 h. The blots were measured through an ECL system (Life Technologies, Gaithersburg, MD, USA), and the densitometric analysis was performed via the Image J software. All experiments were duplicated three times.
Xenograft in nude mice
BALB/c nude mice were obtained from Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital and assigned to one of five groups randomly: NC, si-circ-1 group, si-circ-2 group, agomir miR-1258 group, and agomir miR-622 group transfected by miR-622 mimics. There were five nude mice per group. One hundred μL (1 × 107 cells/mL) lentivirus-infected Huh-7 cells mixture was subcutaneously injected into the right flank of nude mice. Tumor volume was measured by caliper every 7 days. After 4 weeks, mice were sacrificed to get the tumor xenograft tissues and weighed the tissues. All animal assays were conducted in accordance with the ethical guidelines for laboratory animal use and approved by the Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital.
Statistical analysis
All of the statistical data were analyzed by GraphPad Prism 6.0 software (GraphPad Software Inc., USA). The results were presented by the mean + SD from three independent experiments. Student t-test and one-way ANOVA were performed to analyze whether the comparison between two or more groups was statistically significant. P < 0.05 was regarded as statistically significant.
Results
Hsa_Circ_0101432 was up-regulated in HCC tumor tissues
Previously, the expression of circRNA was analyzed in GSE78520, GSE94508 and GSE97332. In heat map, CircRNA presented differentially expressed in HCC tissues matched non-tumor tissue, |log2(FC)|>1, P < 0.05 (219 differentially expressed circRNAs in GSE78520 (n = 6), 240 differentially expressed circRNAs in GSE94508 (n = 10) and 713 differentially expressed circRNAs in GSE97332 (n = 14)). Ten circRNAs were significantly expressed in all the three chips. (Figure 1a). In 3 chips, 10 circRNAs were up-regulated in HCC tissues and displayed in the heat map compared to matched non-tumor tissues analyzed by circRNAs Arraystar chips (Figure 1b-d). The 10 intersection circRNAs are showed in Supplementary Table 2. Our attention was caught by hsa_circ_0101432, because it was one of the differentially expressed circRNAs that were up-regulated in HCC tumor tissues samples among the three gene chips.
Figure 1.
Hsa-circ_0101432 was up-regulated in hepatocellular carcinoma tumor tissues. (a) 10 circRNAs were significantly expressed in three Chips(GSE78520, GSE94508, GSE97332). (b-d) The heat map showed the upregulated circRNAs in HCC tissues as compared to that in the matched non-tumor tissues analyzed by circRNAs Arraystar Chip.
Hsa-circ_0101432 was up-regulated in hepatocellular carcinoma tumor tissues. (a) 10 circRNAs were significantly expressed in three Chips(GSE78520, GSE94508, GSE97332). (b-d) The heat map showed the upregulated circRNAs in HCC tissues as compared to that in the matched non-tumor tissues analyzed by circRNAs Arraystar Chip.
Hsa_circ_0101432 was verified as a circRNA
We used convergent primers and divergent primers to amplify hsa_circ_0101432 to further validate the structure of hsa_circ_0101432 (Figure 2a). Since it could be amplified by divergent primers but divergent primers cannot amplify linear DNA theoretically, hsa_circ_0101432 might be a circRNA but not a lncRNA (Figure 2b). By adding RNase R, the luminance of hsa_circ_0101432 was basically the same, whereas linear RNA was degraded (Figure 2c). RNase R could degrade linear RNAs rather than circRNAs (Figure 2d). Hsa_circ_0101432 was a circRNA verified by these results. It was further verified hsa_circ_0101432 was overexpressed in tumor tissues and HCC cell lines compared with non-tumor tissues and normal hepatocyte cell line (Figure 2e-f). Huh-7 and HepG2 cell lines were selected for the following experiment duo to the expressions of hsa_circ_0101432, which were much higher than those of other HCC cell lines (Figure 2f). The expressions of hsa_circ_0101432 in Huh-7 and HepG2 cells were reduced when cells were transfected in hsa_circ_0101432 silence RNAs, si-circ-1 and si-circ-2 (Figure 2g-h).
Figure 2.
The experiments were to verify that hsa_circ_0101432 was circRNA. (a) Both convergent primers and divergent primers were used to amplify circRNA. (b) Divergent primers can amplify the circRNA but cannot amplify the genomic DNA. (c) The luminance of circRNA was basically the same in RNase R+ group and RNase R- group, while linear RNA was degraded by RNase R. (d) Linear RNA can be degraded by RNase R while circRNAs can’t be degraded. (e-f) The qRT-PCR results showed that hsa_circ_0101432 was a significantly high expression in HCC tissues and cell lines compared with the matched non-tumor tissues or normal hepatocyte cell line. (g-h) The hsa_circ_0101432 expression was detected by qRT-PCR in HCC cell lines (Huh-7 and HepG2). Similar results were obtained in three independent experiments. * P < 0.05, compared with NC group.
The experiments were to verify that hsa_circ_0101432 was circRNA. (a) Both convergent primers and divergent primers were used to amplify circRNA. (b) Divergent primers can amplify the circRNA but cannot amplify the genomic DNA. (c) The luminance of circRNA was basically the same in RNase R+ group and RNase R- group, while linear RNA was degraded by RNase R. (d) Linear RNA can be degraded by RNase R while circRNAs can’t be degraded. (e-f) The qRT-PCR results showed that hsa_circ_0101432 was a significantly high expression in HCC tissues and cell lines compared with the matched non-tumor tissues or normal hepatocyte cell line. (g-h) The hsa_circ_0101432 expression was detected by qRT-PCR in HCC cell lines (Huh-7 and HepG2). Similar results were obtained in three independent experiments. * P < 0.05, compared with NC group.
Hsa_circ_0101432 downregulated expressions of miR-622 and miR-1258 in HCC cells
The target miRNAs of hsa_circ_0101432 were predicted by bioinformation that targeted miR-1258, miR-326, miR-622 and miR-1296 (Figure 3a). Expressions of miR-1258, miR-326, miR-622 and miR-1296 in HCC tissues and matched non-tumor tissues were detected by qRT-PCR and miR-1258 as well as miR-622 was significantly down-regulated in HCC tissues (Figure 3b). Negative correlation of miR-1258 and hsa_circ_0101432 expression as well as negative correlation of miR-622 and hsa_circ_0101432 expression was presented by spearman’s rank correlation coefficient (Figure 4a-b). To investigate whether the decrease in miR-1258 and miR-622 expression was caused by overexpression of hsa_circ_0101432, we compulsively overexpressed hsa_circ_0101432 in vitro and found the expression of miR-1258 and miR-622 was inhibited (Supplementary Figure 1A-B). Pull down assay verified the target relation between hsa_circ_0101432 and miR-1258 and between hsa_circ_0101432 and miR-622 (Figure 4c). The expressions of miR-1258 and miR-622 in Huh-7 and HepG2 cells were increased when transfected with si-circ-1 and si-circ-2 (Figure 4d-e). In conclusion, hsa_circ_0101432 could bind miR-1258 and miR-622, and inhibit their expression in HCC cells.
Figure 3.
Deregulated miRNAs in HCC patients. (a) Hsa_circ_0101432 shared binding sites with miR-1258, miR-326, miR-622 and miR-1296 by Circular RNA Interactome (https://circinteractome.nia.nih.gov/). (b) MiR-1258 and miR-622 were distinctly downregulated in HCC tissues compared to that in the matched non-tumor tissues. *P < 0.05, ns: no significant difference, compared with matched non-tumor tissues.
Figure 4.
Hsa_circ_0101432 bound miR-1258 and miR-622 in HCC cells. (a) There was a negative correlation between miR-1268 and hsa_circ_0101432 expression level. Spearman’s rank correlation coefficient rho = −0.8206 (P < 0.0001). (b) There was a negative correlation between miR-622 and hsa_circ_0101432 expression level. Spearman’s rank correlation coefficient rho = −0.7768 (P < 0.0001). (c) Biotinylated miRNA pull-down assay was used to confirm the binding between hsa_circ_0101432/miR-1258 and hsa_circ_0101432/miR-622. The bond hsa_circ_0101432 expression level was detected by qRT-PCR. (d-e) MiR-1258 and miR-622 expressions were upregulated by hsa_circ_0101432 inhibition in Huh-7 cells and HepG2 cells. Similar results were obtained in three independent experiments. *P < 0.05, compared with the Input group or the NC group.
Deregulated miRNAs in HCC patients. (a) Hsa_circ_0101432 shared binding sites with miR-1258, miR-326, miR-622 and miR-1296 by Circular RNA Interactome (https://circinteractome.nia.nih.gov/). (b) MiR-1258 and miR-622 were distinctly downregulated in HCC tissues compared to that in the matched non-tumor tissues. *P < 0.05, ns: no significant difference, compared with matched non-tumor tissues.Hsa_circ_0101432 bound miR-1258 and miR-622 in HCC cells. (a) There was a negative correlation between miR-1268 and hsa_circ_0101432 expression level. Spearman’s rank correlation coefficient rho = −0.8206 (P < 0.0001). (b) There was a negative correlation between miR-622 and hsa_circ_0101432 expression level. Spearman’s rank correlation coefficient rho = −0.7768 (P < 0.0001). (c) Biotinylated miRNA pull-down assay was used to confirm the binding between hsa_circ_0101432/miR-1258 and hsa_circ_0101432/miR-622. The bond hsa_circ_0101432 expression level was detected by qRT-PCR. (d-e) MiR-1258 and miR-622 expressions were upregulated by hsa_circ_0101432 inhibition in Huh-7 cells and HepG2 cells. Similar results were obtained in three independent experiments. *P < 0.05, compared with the Input group or the NC group.
MAPK1 was a direct target both of miR-1258 and miR-622
mRNAs related to HCC and targeted miR-1258 and miR-622 were analyzed by DigSee and miRanda, and then narrowed down to three intersection genes (Figure 5a-b). Dual luciferase reporter assays confirmed that the luciferase activity of the MAPK1-WT was inhibited by miR-1258 or miR-622 mimics, while the luciferase activity of the MAPK1-MUT remained unchanged (Figure 5c-d). The results of biotinylated miRNA pull-down assay indicated that miR-1258 and miR-622 could directly bind to MAPK1 mRNA (Figure 5e). MiR-1258 and miR-622 mimics or inhibitors were transfected into Huh-7 and HepG2 cell lines, respectively. The expression of miR-1258 and miR-622 was promoted by mimics and inhibited by mimics (Figure 6a-b). But it was confirmed that miR-1258 or miR-622 could not regulate hsa_circ_0101432 expression in HCC cells (Supplementary Figure 2A-B). Expression of MAPK1 mRNA was downregulated by miR-1258 and miR-622 mimics but upregulated by inhibitors of miR-1258 and miR-622 (Figure 6c-d). These results revealed that miR-1258 and miR-622 could target MAPK1 and decrease its expression.
Figure 5.
MAPK1 was a direct target both of miR-1258 and miR-622. (a) MRNAs associated with HCC as well as binding both miR-1258 and miR-622, were predicted by DigSee and miRanda. (b) The targeted mRNAs were narrowed down to three using Venny. (c-d) MiR-1258 and miR-622 significantly inhibited the luciferase activity of the MAPK1 wild type 3’-UTR but not that of the mutant. (e) Biotinylated miRNA pull-down assay was used to confirm the binding between miR-1258/MAPK1 and miR-622/MAPK1. The bond MAPK1 expression level was detected by qRT-PCR. Similar results were obtained in three independent experiments. *P < 0.05, compared with NC group.
Figure 6.
MiR-1258 and miR-622could regulated MAPK1 expression. (a) The expressions of miR-1258 were examined through qRT-PCR in Huh-7 and HepG2 cell lines. (b) The expressions of miR-622 were decreased by miR-622 inhibitor and increased by miR-622 mimics. (c-d) MiR-1258 and miR-622 mimics could upregulate MAPK1 expression level in vitro while the miR-1258 and miR-622 inhibitor had the opposite effects. Similar results were obtained in three independent experiments. *P < 0.05, compared with NC group.
MAPK1 was a direct target both of miR-1258 and miR-622. (a) MRNAs associated with HCC as well as binding both miR-1258 and miR-622, were predicted by DigSee and miRanda. (b) The targeted mRNAs were narrowed down to three using Venny. (c-d) MiR-1258 and miR-622 significantly inhibited the luciferase activity of the MAPK1 wild type 3’-UTR but not that of the mutant. (e) Biotinylated miRNA pull-down assay was used to confirm the binding between miR-1258/MAPK1 and miR-622/MAPK1. The bond MAPK1 expression level was detected by qRT-PCR. Similar results were obtained in three independent experiments. *P < 0.05, compared with NC group.MiR-1258 and miR-622could regulated MAPK1 expression. (a) The expressions of miR-1258 were examined through qRT-PCR in Huh-7 and HepG2 cell lines. (b) The expressions of miR-622 were decreased by miR-622 inhibitor and increased by miR-622 mimics. (c-d) MiR-1258 and miR-622 mimics could upregulate MAPK1 expression level in vitro while the miR-1258 and miR-622 inhibitor had the opposite effects. Similar results were obtained in three independent experiments. *P < 0.05, compared with NC group.
Silencing hsa_circ_0101432 or transfection of miR-1258 and miR-622 suppressed HCC progression in vitro
MAPK1 mRNA expression was inhibited when hsa_circ_0101432 was silenced in Huh-7 and HepG2 cells (Figure 7a-b). Furthermore, CCK-8 assay, clone formation assay, flow cytometry assay and transwell assay were conducted to reveal the roles of hsa_circ_0101432, miR-1258 and miR-622 in proliferation, apoptosis and invasive ability of HCC cells. Cell proliferation was inhibited by si-circ-1, si-circ-2, miR-1258 and miR-622 mimics (Figure 7c-d). Clone cells were also reduced through transforming has_circ_0101432 siRNAs, miR-1258 and miR-622 mimics to Huh-7 cells (Figure 7e). Cell apoptosis ratios in si-circ-1 group, si-circ-2 group, miR-1258 mimics group and miR-622 mimics group were remarkably higher than those in NC group, si-circ+miR-1258 inhibitor group and si-circ+miR-622 inhibitor group (Figure 8a). On the contrary, hsa_circ_0101432 siRNAs, miR-1258 mimics or miR-622 mimics inhibited cell invasive ability (Figure 8b). It could be deduced that knockdown expression of hsa_circ_0101432 or overexpression of miR-1258 and miR-622 could inhibit cells proliferation, invasive ability and promote cell apoptosis of HCC.
Figure 7.
Hsa_circ_0101432 inhibition, miR-1258 and miR-622 mimics suppressed HCC cell proliferation and colony cloning. (a-b) Hsa_circ_0101432 was silenced by its siRNAs in Huh-7 and HepG2 cells. The mRNA expression level of MAPK1 was measured by qRT-PCR. (c-d) Hsa_circ_0101432 knockdown and miR-1258, miR-622 overexpression inhibited proliferation. (e) The number of clone cells was reduced through transforming si-circRNAs, miR-1258 mimics and miR-622 mimics to Huh-7 cells. Similar results were obtained in three independent experiments. *P < 0.05, compared with NC group.
Figure 8.
Hsa_circ_0101432 inhibition, miR-1258 and miR-622 mimics promoted cell apoptosis and suppressed cell invasion. (a) The apoptosis ratios of Huh-7 cells were measured by FCM assay. (b) The invasion of Huh-7 cells was measured by transwell assay. Similar results were obtained in three independent experiments. *P < 0.05, compared with the NC group.
Hsa_circ_0101432 inhibition, miR-1258 and miR-622 mimics suppressed HCC cell proliferation and colony cloning. (a-b) Hsa_circ_0101432 was silenced by its siRNAs in Huh-7 and HepG2 cells. The mRNA expression level of MAPK1 was measured by qRT-PCR. (c-d) Hsa_circ_0101432 knockdown and miR-1258, miR-622 overexpression inhibited proliferation. (e) The number of clone cells was reduced through transforming si-circRNAs, miR-1258 mimics and miR-622 mimics to Huh-7 cells. Similar results were obtained in three independent experiments. *P < 0.05, compared with NC group.Hsa_circ_0101432 inhibition, miR-1258 and miR-622 mimics promoted cell apoptosis and suppressed cell invasion. (a) The apoptosis ratios of Huh-7 cells were measured by FCM assay. (b) The invasion of Huh-7 cells was measured by transwell assay. Similar results were obtained in three independent experiments. *P < 0.05, compared with the NC group.
The reduction of hsa_circ_0101432 inhibited tumor growth in vivo
After injecting Huh-7 cells stably transfected by negative control, si-circ, miR-1258 mimics and miR-622 mimics for 4 weeks, the nude mice were sacrificed to harvest tumor tissues (Figure 9a). The tumor weight was lighter and tumor volume got smaller in si-circ-1 group, si-circ-2 group, agomir miR-1258 group and agomir miR-622 group than those in the NC group (Figure 9a-b). siRNAs of hsa_circ_0101432 inhibited hsa_circ_0101432 expression while miR-1258 and miR-622 agomirs had no effect on hsa_circ_0101432 expression (Figure 9c). In the tumor tissues of si-circ-1 group, si-circ-2 group, agomir miR-1258 group and agomir miR-622 group, expressions of MAPK1 mRNA were reduced but those of miR-1258 and miR-622 were increased (Figure 9d-f). Western blot also verified that protein expression of MAPK1 was inhibited by hsa_circ_0101432 siRNAs, miR-1258 and miR-622 mimics (Figure 9f). To sum up, HCC tumor growth could be repressed through silencing hsa_circ_0101432.
Figure 9.
Hsa_circ_0101432 overexpression promoted tumor growth in vivo. (a) The nude mice were sacrificed after four weeks and there were the solid tumors and weight of these tumor tissues. (b) Tumor volume of nude mice was measured every 7 days. (c-f) The qRT-PCR was done to detect hsa_circ_0101432, miR-1258, miR-622 and MAPK1 mRNA expression levels. (f) MAPK1 protein expression level was measured by Western Blot. *P < 0.05, compared with NC group.
Hsa_circ_0101432 overexpression promoted tumor growth in vivo. (a) The nude mice were sacrificed after four weeks and there were the solid tumors and weight of these tumor tissues. (b) Tumor volume of nude mice was measured every 7 days. (c-f) The qRT-PCR was done to detect hsa_circ_0101432, miR-1258, miR-622 and MAPK1 mRNA expression levels. (f) MAPK1 protein expression level was measured by Western Blot. *P < 0.05, compared with NC group.
Discussion
In this study, has_circ_0101432 and its target miRNAs were selected by the dysregulated microarray analysis and common database, and at the same time, miR-1258 as well as miR-622 was screened out for further study. MAPK1 was selected as the research gene in HCC by STRING and Venny 2.1.0. Has_circ_0101432 and MAPK1 mRNA were confirmed to be overexpressed in HCC cell lines and tissue samples by qRT-PCR. In vitro, the results demonstrated that has_circ_0101432 not only promoted cell proliferation and invasion ability of HCC, but also suppressed its apoptosis. Furthermore, it was also verified in vivo that has_circ_0101432 promoted the process of HCC by adsorbing miR-1258 and miR-622.In the present study, hsa_circ_0101432 was overexpressed. What is more, it accelerated cell proliferation, colony formation and cell invasive ability while inhibited cell apoptosis by targeting miR-1258 and miR-622 in cell lines and tissue samples of HCC. Although hsa_circ_0101432 was barely studied in the past, growing evidence clarified the functions of different circRNAs in HCC [24]. Consistently with our study, Li et al. confirmed that hsa_circ_0005075 was overexpressed in tissue samples and cell lines of HCC, which increased numbers of proliferative, migration and invasive ability of SMMC-7721 cells through inhibiting miR-431 [25]. In the study of Jiang et al., expression of hsa_circ_0000673 was remarkably high in HCC tissues. Knockout hsa_circ_0000673 could significantly inhibit cells proliferation and invasive ability of HCC and tumor growth, which was confirmed by the result of in vivo [26]. On the contrary, downregulation of some circRNAs predicted a poor prognosis. Zhang et al. demonstrated that hsa_circ_0001649 suppressed cells proliferation, migration and invasive capability of HCC whereas it promoted the apoptosis of HCC cells [27].Moreover, cell experiment results indicated that knocking down the miR-1258 and miR-622 would lead to the enhancement of proliferation, colony formation and invasiveness in HCC cells and the decline of apoptosis ratio via upregulation of MAPK1. Other studies received the same relationship between the miRNA and MAPK1 mRNA. MiR-22 affected cancers of the bladder epithelial and snails by inhibiting MAPK1/Slug/vimentin feedback loop-mesenchymal transition [28]. Hu et al. shed light on the role of miR-585 in targeting MAPK1 and inhibiting gastric cancer cell proliferation and migration [29]. Furthermore, Chang et al. applied a series of assays to witness that miR-143 might suppress the proliferation, migration and invasive ability of Endometrial cancer (EC) cells while promote the EC cells apoptosis by decreasing MAPK1 [30].MAPK1 was regarded as a tumor promoter because of its role in tumorigenesis [19]. In study of Zou et al., MAPK1 mutation was associated with the tumorigenesis of ovarian mixed germ cell tumors [22]. In addition, downregulation of MAPK1 by miR-378 displayed a remarkable reduction in prostate cancer tumor growth [31]. As for HCC, Kong et al. elucidated that miR-194-5p targeted and suppressed the expression of MAPK1 to inhibit tumor progression [23]. These researches provided a mighty reference for the role of our study of MAPK1 in HCC.However, some limitations were inevitable in our research. For example, in the current study, we just investigated the functions of hsa_circ_0101432, miR-1258 and miR-622 in HCC, while the signaling pathway related MAPK1 in HCC should be taken into account, which can expand the information and understanding of molecule mechanisms. Because HCC was known to be resistant to conventional therapies [32], influence of si-circ_0101432, miR-1258 and miR-622 is still needed to recheck.In summary, our finding acknowledged the overexpression of hsa_circ_0101432 in HCC. Additionally, hsa_circ_0101432 enhanced the expression of MAPK1 through sponging miR-1258 and miR-622, eventually promoted HCC progression. Experiments in vitro indicated that silencing hsa_circ_0101432 or transfection of miR-1258 and miR-622 mimics suppressed cell proliferation, colony cloning as well as invasive ability of HCC and promoted cell apoptosis, while in vivo experiments demonstrated that the reduction of hsa_circ_0101432 inhibited HCC tumor growth. Our results may provide us with new diagnostic and therapeutic targets of HCC in clinical practice.
Authors: Nicolai A Schultz; Jens Werner; Hanni Willenbrock; Anne Roslind; Nathalia Giese; Thomas Horn; Morten Wøjdemann; Julia S Johansen Journal: Mod Pathol Date: 2012-08-10 Impact factor: 7.842
Authors: Yun Teng; Brandie N Radde; Lacey M Litchfield; Margarita M Ivanova; Russell A Prough; Barbara J Clark; Mark A Doll; David W Hein; Carolyn M Klinge Journal: J Biol Chem Date: 2015-05-11 Impact factor: 5.157