Literature DB >> 31088970

IKKβ slows Huntington's disease progression in R6/1 mice.

Joseph Ochaba1, Gianna Fote2, Marketta Kachemov1, Soe Thein3, Sylvia Y Yeung3, Alice L Lau3, Sarah Hernandez1,4, Ryan G Lim2,4, Malcolm Casale1, Michael J Neel5, Edwin S Monuki5, Jack Reidling6, David E Housman7,8, Leslie M Thompson1,2,3,4,6, Joan S Steffan9,6.   

Abstract

Neuroinflammation is an important contributor to neuronal pathology and death in neurodegenerative diseases and neuronal injury. Therapeutic interventions blocking the activity of the inflammatory kinase IKKβ, a key regulator of neuroinflammatory pathways, is protective in several animal models of neurodegenerative disease and neuronal injury. In Huntington's disease (HD), however, significant questions exist as to the impact of blocking or diminishing the activity of IKKβ on HD pathology given its potential role in Huntingtin (HTT) degradation. In cell culture, IKKβ phosphorylates HTT serine (S) 13 and activates HTT degradation, a process that becomes impaired with polyQ expansion. To investigate the in vivo relationship of IKKβ to HTT S13 phosphorylation and HD progression, we crossed conditional tamoxifen-inducible IKKβ knockout mice with R6/1 HD mice. Behavioral assays in these mice showed a significant worsening of HD pathological phenotypes. The increased behavioral pathology correlated with reduced levels of endogenous mouse full-length phospho-S13 HTT, supporting the importance of IKKβ in the phosphorylation of HTT S13 in vivo. Notably, many striatal autophagy genes were up-regulated in HD vs. control mice; however, IKKβ knockout partially reduced this up-regulation in HD, increased striatal neurodegeneration, and enhanced an activated microglial response. We propose that IKKβ is protective in striatal neurons early in HD progression via phosphorylation of HTT S13. As IKKβ is also required for up-regulation of some autophagy genes and HTT is a scaffold for selective autophagy, IKKβ may influence autophagy through multiple mechanisms to maintain healthy striatal function, thereby reducing neuronal degeneration to slow HD onset.
Copyright © 2019 the Author(s). Published by PNAS.

Entities:  

Keywords:  Huntington’s disease; IκB kinase; autophagy; huntingtin; neurodegeneration

Year:  2019        PMID: 31088970      PMCID: PMC6561205          DOI: 10.1073/pnas.1814246116

Source DB:  PubMed          Journal:  Proc Natl Acad Sci U S A        ISSN: 0027-8424            Impact factor:   11.205


The development of effective treatments for neurodegenerative diseases critically depends on an understanding of the sources of pathology. In Huntington’s disease (HD), the genetically based primary cause of pathology is expansion of a CAG repeat encoding polyglutamine (polyQ) within the huntingtin (HTT) protein (1). While the physical properties of the polyQ repeat are a key element in HD pathology, polyQ expansion can also have an important impact on the functional properties of HTT itself. We previously found that phosphorylation of HTT at serines (S) 13 and 16 can activate HTT clearance in cells (2), reduce aggregate accumulation and block HD progression in HD mice (3). This phosphorylation is impaired by polyQ expansion (2), suggesting that this posttranslational modification may be critical to HD pathogenesis. We further showed that the inflammatory IκB kinase complex (IKK) activates phosphorylation of HTT S13 and S16 and enhances HTT clearance (2). IKK is a cytokine-induced serine kinase that controls the activation of NF-κB, a ubiquitous transcription factor closely associated with inflammation (4). While inflammation has been implicated in neurodestructive outcomes in late stages of HD, Alzheimer’s disease (AD), and Parkinson’s disease (PD), immunoactivities and inflammatory processes may also be neuroprotective early in disease progression (5, 6). IKK is activated by acute cellular stress and has previously been shown to contribute to the induction of autophagy (7–9). To prevent continuous activation of IKK, autophagic degradation of IKK itself occurs through a negative feedback loop (10, 11). As autophagy declines with aging (12), an accumulation of IKK over time can cause its excessive activation and harmful responses such as tumorigenesis and inflammation (13). IKK induces expression of several autophagy-related genes independent of its activation of NF-κB and has been proposed to play a more direct role in autophagy regulation through the phosphorylation of autophagy proteins (8, 9). The IKK kinase complex is composed of three subunits, α, β, and γ; α and β are homologous catalytic subunits and γ is a regulatory subunit. IKKα and IKKβ can directly phosphorylate HTT S13 and activate phosphorylation of S16 (2). In turn, phosphorylation at these residues increases HTT clearance in cells by the proteasome and lysosome and reduces mutant HTT exon 1 protein-mediated cellular toxicity (2). Extending these studies, we showed that mimicking S13 and S16 phosphorylation (S13,16D) in the context of full-length mutant HTT expression in vivo in BACHD mice completely blocked HD progression and aggregate formation (3), supporting a possible direct association between phosphorylation of HTT and mutant HTT clearance. IKK is activated in cell culture and mouse models of HD chronically expressing mutant HTT (14), potentially reflecting an initial compensatory effect that may help phosphorylate HTT. These data are consistent with the innate immune activation that is observed in presymptomatic HD patients at least a decade before overt neurological manifestation of disease (15). Over time, IKK activation and HTT phosphorylation would be predicted to be less efficient in inducing HTT degradation because of reduced function of the proteasome and lysosome with aging (16) and might contribute to the chronic inflammation associated with neuronal cell death paralleling other hallmarks of HD pathogenesis (2, 5, 6). In this work we tested the relationship of IKKβ to HD pathogenesis. We determined that HD behavioral phenotypes are further impaired in R6/1 HD mice upon IKKβ knockout, paralleling striatal neurodegeneration and an activated microglial response. We found that the kinase IKKβ is responsible in vivo for phosphorylation of HTT S13, the regulation of striatal WT full-length HTT abundance in nontransgenic (NT) control and R6/1 (HD) mice, and the activation of transcription of several autophagy genes, potentially linking inflammatory signal transduction pathways to the induction of HTT’s autophagic scaffold function and autophagy in general. Thus, we find that IKKβ is required in vivo to slow the early stages of HD progression in R6/1 mice and suggest that the impact of IKKβ expression early in HD disease progression is due to IKKβ in vivo phosphorylation of HTT S13 and to the effect of IKKβ expression on autophagy.

Results

Generation of R6/1 HD Mice with Conditional Tamoxifen-Inducible IKKβ Knockout.

The R6/1 mouse line is a widely employed HD model that expresses a mutant human HTT exon 1 transgene (17) and demonstrates a progressive decline in motor abilities and cognitive and social behaviors starting around 12 to 14 wk of age (18–21) accompanied by striatal atrophy and ventricular enlargement (17, 18, 22). To investigate the in vivo relationship of IKKβ to HTT S13 phosphorylation and HD progression, we created conditional tamoxifen-inducible IKKβ knockout mice. Transgenic mice with loxP-flanked alleles of IKKβ were crossed with mice expressing the tamoxifen-inducible Cre recombinase under control of the Wfs1, the Wolfram syndrome 1 homolog (human) promoter/enhancer regions (23, 24). Wfs1 promotes expression in neurons and astrocytes in several brain regions (25, 26). Efficient conditional IKKβ knockout was achieved in adult tissue including striatum and liver, which were evaluated at the completion of the study at 16 wk of age. Cre+, loxP-flanked alleles of IKKβ mice were crossed with R6/1 HD mice and IKKβ knockdown was induced with tamoxifen vs. vehicle (oil) administered at week 10, at a time that mice do not have demonstrable phenotypes, in R6/1 (HD) vs. NT WT controls. In this study, 9/10 of the female NT mice did not survive 1 wk past tamoxifen injection, and therefore only male mice were used for this work ().

IKKβ Knockout Exacerbates Behavioral Phenotypes in the R6/1 Mouse Model of HD.

R6/1 mice begin losing weight and show a decline in behavioral tests beginning between 12 and 14 wk (20, 21), and our results are consistent with those findings. No treatment effect on weight or grip strength was observed for tamoxifen-induced IKKβ knockout in either R6/1 (HD) mice or NT WT controls (), and tamoxifen-induced IKKβ knockout did not affect pole test or rotarod performance in the NT controls (Fig. 1). Behavioral assessments demonstrated significantly impaired pole test descending times (60% slower) following tamoxifen-induced IKKβ knockout in HD mice at 12 wk of age compared with oil-treated HD controls (Fig. 1). However, the increase in impairment was not significant at the 16-wk time point. HD mice with tamoxifen-induced IKKβ knockout exhibited significantly impaired time (27% and 23% less time) on rotating rod before fall compared with oil-treated HD controls on weeks 13 and 15, respectively (Fig. 1). The impairment of rotarod and pole test tasks was not due to a toxicity of tamoxifen treatment independent of IKKβ knockout, as a separate cohort of tamoxifen-treated standard R6/1 HD mice, without the Cre or floxed alleles of IKKβ, did not demonstrate further impairment in these pole test or rotarod tasks (). Taken together, these results demonstrate that tamoxifen-induced IKKβ knockout exacerbates neurological phenotypes of R6/1 HD mice beyond the effect of mHTT transgene expression alone. There were no significant differences across the battery of behavior assessments with IKKβ knockout in NT control mice, supporting a selective role for IKKβ in the disease setting.
Fig. 1.

Effects of IKKβ knockout on behavior in male R6/1 mice. Pole test (8, 12, and 16 wk) and rotarod (8, 13, and 15 wk) are shown for tamoxifen (TAM)- vs. oil-treated R6/1 (HD) and NT controls (n = NT-Oil, 12; NT-TAM, 12; HD-Oil, 9; HD-TAM, 12 at week 8, and NT-Oil, 12; NT-TAM, 11; HD-Oil: 9, HD-TAM, 10 following injections). HD mice performed significantly worse on 12-wk pole test (A) and on weeks 13 and 15 rotarod (B) with TAM-induced IKKβ knockout than oil-treated HD control mice. No significant effect was observed in NT control mice with TAM-induced IKKβ knockout. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 values represent means ± SEM. Statistical significance was determined by one-way ANOVA with Bonferroni posttesting.

Effects of IKKβ knockout on behavior in male R6/1 mice. Pole test (8, 12, and 16 wk) and rotarod (8, 13, and 15 wk) are shown for tamoxifen (TAM)- vs. oil-treated R6/1 (HD) and NT controls (n = NT-Oil, 12; NT-TAM, 12; HD-Oil, 9; HD-TAM, 12 at week 8, and NT-Oil, 12; NT-TAM, 11; HD-Oil: 9, HD-TAM, 10 following injections). HD mice performed significantly worse on 12-wk pole test (A) and on weeks 13 and 15 rotarod (B) with TAM-induced IKKβ knockout than oil-treated HD control mice. No significant effect was observed in NT control mice with TAM-induced IKKβ knockout. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 values represent means ± SEM. Statistical significance was determined by one-way ANOVA with Bonferroni posttesting.

IKKβ Is Required for Phosphorylation of HTT S13 in Vivo.

We hypothesized that the increased pathology observed in the IKKβ knockout HD mice may be the consequence of failure of HTT phosphorylation at amino acid S13 in this setting. We had previously found that IKKβ can directly phosphorylate HTT S13 using in vitro kinase assays, and that HTT S13 phosphorylation is increased with overexpression of IKKβ or induction of IKKβ with TNF-α or IL-1β treatment in cell culture, corresponding to an activation of HTT clearance (2). We now designed studies to evaluate whether IKKβ is a relevant HTT S13 kinase in vivo and whether it regulates HTT levels. After behavioral testing ending at week 16, IKKβ knockout and control mice were killed, and liver and striatal tissue were collected for Western analysis to measure levels of IKKβ, S13 phosphorylated full-length HTT, total full-length HTT, and transgenic mutant HTT exon 1 protein. S13 phosphorylation is quantitated using an immunoprecipitation (IP) method that does not show nonspecific binding of HTT to the IP beads (), and total full-length HTT and transgenic mutant HTT exon 1 protein are each quantitated using whole-cell lysates. We evaluated protein levels in striatum of tamoxifen- vs. oil-treated NT control and HD mice, all expressing the tamoxifen-inducible Cre with the floxed alleles of IKKβ. Consistent with the hypothesis that reduced IKKβ levels impacted the phosphorylation at S13 and degradation of full-length HTT, tamoxifen treatment significantly reduced IKKβ and increased levels of full-length HTT in whole striatal cell extract and reduced relative levels of immunoprecipitated full-length S13 phosphorylated HTT in both NT and HD striatum (Fig. 2).
Fig. 2.

Levels of S13-phosphorylated HTT are reduced while total full-length (∼350 kDa) mouse HTT abundance is increased with IKKβ knockout in striatum, demonstrating that IKKβ is a relevant striatal HTT S13 kinase in vivo. Male R6/1 (HD) and NT WT controls, both containing the tamoxifen-inducible Cre and floxed alleles of IKKβ, were treated with tamoxifen or oil vehicle control during week 10 and killed at week 16. IKKβ normalized to loading control α-tubulin was significantly reduced in 16-wk striatum of HD and NT mice with tamoxifen treatment over oil control in whole-cell lysate (A–C). Anti-HTT phosphoserine 13 (pS13) antibody was used to immunoprecipitate phosphorylated full-length mouse HTT which was then detected by Western blot with anti-total HTT antibody. Levels of pS13-HTT were significantly reduced relative to total HTT with IKKβ knockout in HD and NT controls, while levels of total HTT normalized to α-tubulin were significantly increased (A–C). Western images (A and B) were quantitated using Scion software (C). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 values represent means ± SEM. Statistical significance was determined by paired t test.

Levels of S13-phosphorylated HTT are reduced while total full-length (∼350 kDa) mouse HTT abundance is increased with IKKβ knockout in striatum, demonstrating that IKKβ is a relevant striatal HTT S13 kinase in vivo. Male R6/1 (HD) and NT WT controls, both containing the tamoxifen-inducible Cre and floxed alleles of IKKβ, were treated with tamoxifen or oil vehicle control during week 10 and killed at week 16. IKKβ normalized to loading control α-tubulin was significantly reduced in 16-wk striatum of HD and NT mice with tamoxifen treatment over oil control in whole-cell lysate (A–C). Anti-HTT phosphoserine 13 (pS13) antibody was used to immunoprecipitate phosphorylated full-length mouse HTT which was then detected by Western blot with anti-total HTT antibody. Levels of pS13-HTT were significantly reduced relative to total HTT with IKKβ knockout in HD and NT controls, while levels of total HTT normalized to α-tubulin were significantly increased (A–C). Western images (A and B) were quantitated using Scion software (C). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 values represent means ± SEM. Statistical significance was determined by paired t test. Liver dysfunction has been observed in manifest and premanifest HD patients and in HD mouse models (27, 28); we therefore chose to also examine IKKβ knockout liver tissue in our HD and NT control mice. Similar to striatum, IKKβ was significantly reduced in liver homogenates from these animals following tamoxifen treatment in both HD and NT control liver, which tracked with reduced relative levels of S13 phosphorylated HTT (Fig. 3), demonstrating the involvement of IKKβ in the phosphorylation of HTT S13 in liver in vivo. However, levels of full-length mouse HTT were not significantly altered in liver with IKKβ knockout, unlike the significant increase in total full-length HTT we observed in the striatum of the IKKβ knockout mice.
Fig. 3.

IKKβ is required for efficient S13 phosphorylation of ∼350-kDa full-length mouse HTT in liver. Male R6/1 (HD) and NT WT controls, both containing the tamoxifen-inducible Cre and floxed alleles of IKKβ, were treated with tamoxifen or oil vehicle control at week 10 and tissue was taken at week 16 at the completion of the study. IKKβ normalized to loading control ERK1/2 was significantly reduced in liver of HD and NT mice with tamoxifen treatment over oil control in whole-cell lysate (A–C). Anti-HTT phosphoserine 13 (pS13) antibody was used to immunoprecipitate phosphorylated full-length mouse HTT which was then detected by Western blot with anti-total HTT antibody. Levels of pS13-HTT were significantly reduced relative to total HTT with IKKβ knockout in HD and NT controls, while levels of total HTT normalized to ERK1/2 were not affected (A–C). Western images (A and B) were quantitated using Scion software (C). *P < 0.05, ****P < 0.0001 values represent means ± SEM. Statistical significance was determined by paired t test.

IKKβ is required for efficient S13 phosphorylation of ∼350-kDa full-length mouse HTT in liver. Male R6/1 (HD) and NT WT controls, both containing the tamoxifen-inducible Cre and floxed alleles of IKKβ, were treated with tamoxifen or oil vehicle control at week 10 and tissue was taken at week 16 at the completion of the study. IKKβ normalized to loading control ERK1/2 was significantly reduced in liver of HD and NT mice with tamoxifen treatment over oil control in whole-cell lysate (A–C). Anti-HTT phosphoserine 13 (pS13) antibody was used to immunoprecipitate phosphorylated full-length mouse HTT which was then detected by Western blot with anti-total HTT antibody. Levels of pS13-HTT were significantly reduced relative to total HTT with IKKβ knockout in HD and NT controls, while levels of total HTT normalized to ERK1/2 were not affected (A–C). Western images (A and B) were quantitated using Scion software (C). *P < 0.05, ****P < 0.0001 values represent means ± SEM. Statistical significance was determined by paired t test. In both striatum and in liver, levels of transgenic mutant HTT exon 1 protein were evaluated using immunofluorescence analysis to determine numbers of HTT aggregates and by Western analysis to specifically detect human mutant HTT exon 1 protein high-molecular-weight species with anti-HTT MAB5492, which does not detect endogenous full-length mouse HTT. No significant changes in HTT aggregate numbers or transgenic human mutant HTT exon 1 protein levels were observed with IKKβ knockout in either striatum or liver (). We did observe an accumulation of lipid droplets in HD liver with IKKβ knockout and higher liver IKKβ protein levels in oil-treated HD vs. NT controls () consistent with increased liver stress in R6/1 induced by expression of transgenic human mutant HTT exon 1 protein. We find that in both striatum and liver, knockout of IKKβ reduces levels of S13-phosphorylated full-length HTT in NT and HD mice, demonstrating IKKβ is a relevant kinase for HTT S13 in vivo, but that levels of transgenic mutant HTT exon 1 protein and aggregate numbers were unaffected by IKKβ knockout in striatum and liver. This is consistent with our previous findings that IKKβ does not efficiently phosphorylate mutant HTT exon 1 protein with expanded polyglutamine repeats in cell culture (2). Liver IKKβ knockout (Fig. 3) was much more extensive than that in striatum (Fig. 2). The Wfs1 promoter we used to drive the tamoxifen-inducible Cre expression needed for IKKβ knockout expresses well in medium spiny neurons and astrocytes of the striatum, but not in microglia () (29). The residual levels of IKKβ detected by Western analysis in striatum in tamoxifen-treated mice may reflect IKKβ expression in microglia and may explain why the IKKβ knockout was less efficient in striatum than in liver. Using qPCR analysis, we did not observe any great alteration in levels of IKKβ expression in cortex or cerebellum with tamoxifen treatment, so these tissues were not further examined ().

IKKβ Regulates Expression of Autophagy-Related Genes in Vivo.

A link has been found between the activation of the IKK complex and the induction of autophagy by an NF-κB–independent mechanism, which may at least partially be the result of increased autophagy gene expression (7, 8). To determine whether IKKβ knockout in male striatum and liver might modulate expression of autophagy genes in HD vs. NT control mice, we selected 20 genes encoding proteins with known autophagy functions, in addition to IKKβ itself, to evaluate by qRT-PCR analysis using RNA prepared from frozen striatal and liver tissue collected at the end of the study at week 16 (). In striatum, we observed a significant increase in expression of 13 out of 20 tested autophagy genes in HD vs. NT controls, showing that expression of transgenic human mutant HTT exon 1 protein independent of IKKβ knockout may globally increase striatal autophagy gene expression (), consistent with previously published RNA-sequencing data showing up-regulated transcription of HTT, Atg14, Atg7, and p62 in R6/1 vs. NT control mice (30). Of the 13 up-regulated autophagy genes, 2 were significantly reduced in HD striatum with tamoxifen-induced IKKβ knockout, Atg14 and GABARAPL1, suggesting IKKβ expression may activate transcription of these autophagy genes in HD striatum. In contrast with striatum, we did not observe the global up-regulation of autophagy genes in oil-treated HD vs. NT liver tissue independent of tamoxifen-induced IKKβ knockout. In fact, we saw a significant down-regulation of mAtg13, LC3A, LAMP-2A, and LAMP-2C in oil-treated HD liver vs. oil-treated NT control liver. Tamoxifen-induced IKKβ knockout significantly reduced expression of several liver autophagy genes in both HD and NT controls (): HTT, Atg14, GABARAPL1, Atg16L, Atg9A, and TFEB were significantly down-regulated in HD IKKβ knockout liver, and HTT, mAtg13, Atg14, LC3A, GABARAPL1, p62, and LAMP-2A were significantly down-regulated in NT IKKβ knockout liver. This transcriptional analysis may suggest that IKKβ has a greater impact on the basal expression of autophagy genes in liver (independent of mutant HTT exon 1 protein expression), whereas in striatum IKKβ knockout diminishes the stress-induced up-regulation of Atg14 and GABARAPL1 caused by mutant HTT exon 1 protein expression but has no effect on basal autophagy gene expression in NT controls.

IKKβ Knockout and Mutant HTT Exon 1 Protein Expression Impact Levels of Autophagy Proteins in Vivo.

Mutant HTT exon 1 protein expression can cause a compensatory activation of autophagy in vivo but can also ultimately block autophagy, resulting in accumulation of several autophagy proteins and autophagic cargo (31–34). In striatum, expression of mutant HTT exon 1 protein results in increased levels of the LC3 protein, a mammalian Atg8 whose lipidation or accumulation is commonly assayed as an indicator of autophagic flux (31, 35). We examined levels of LC3 protein in 16-wk striatal and liver soluble fractions (Fig. 4) and only detected unlipidated LC3 I by Western analysis in striatum, while detecting both LC3 I and lipidated LC3 II in liver, similar to others who have examined LC3 in brain vs. liver soluble fractions (35). In R6/1 HD striatum, with or without IKKβ knockout, LC3 I protein accumulates in the soluble fraction, suggestive of a blockage of autophagic flux, while in liver no differences are observed in LC3 I or II, suggestive of functional basal autophagy. Interestingly, we saw a significant increase in striatal LC3 I levels in NT controls with IKKβ knockout, demonstrating that a loss of IKKβ activity in striatum may block autophagic flux independent of mutant HTT exon 1 protein expression. We conclude that mutant HTT exon 1 protein and IKKβ knockout may both independently contribute to LC3-dependent autophagy blockage in striatum. At 16 wk, levels of LC3 I were high in HD striatum, and IKKβ knockout did not further increase these levels; similarly, as mutant HTT exon 1 protein is cleared by autophagy, this may suggest why IKKβ knockout did not further alter levels of aggregates in HD striatum (). In liver tissue, LC3 I and II proteins were detected and were unchanged with IKKβ knockout or with mutant HTT exon 1 protein expression (Fig. 4), consistent with active autophagic clearance of mutant HTT exon 1 protein reflected by low levels of aggregates (), highlighting a difference in autophagy between striatum and liver. We previously found in cell culture that lysosomal membrane protein LAMP-2A overexpression could reduce levels of HTT exon 1 protein (2). We therefore examined levels of LAMP-2A protein, which were unchanged at 16 wk in striatum but were significantly increased in HD vs. NT controls in liver. This may suggest that increased LAMP-2A–mediated autophagy may help to reduce levels of mutant HTT exon 1 protein in liver cells capable of proliferation, but not in postmitotic neurons, keeping liver aggregate levels lower than those observed in striatum ().
Fig. 4.

IKKβ knockout and mutant HTT exon 1 protein expression impact levels of autophagy proteins in vivo. R6/1 (HD) or NT WT control male mice containing the tamoxifen-inducible Cre and floxed alleles of IKKβ were treated with tamoxifen or oil vehicle control for 1 wk starting at 10 wk to knock out IKKβ in striatum and liver. At the termination of the study at 16 wk, Western analysis of NT and HD soluble fractions was used to examine levels of autophagy proteins LC3 and LAMP-2A relative to loading controls α-tubulin (striatum) or ERK1/2 (liver). LC3 I was detected in striatum, while LC3 I and II were observed in liver. LC3 I was quantitated for both tissues and was found in striatum, but not in liver, to be significantly increased with IKKβ knockout or with transgene expression. LAMP-2A levels were unchanged in striatum but were significantly increased in HD mouse liver. Western images, shown, were quantitated; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 values represent means ± SEM. Statistical significance was determined by one-way ANOVA with Bonferroni posttesting.

IKKβ knockout and mutant HTT exon 1 protein expression impact levels of autophagy proteins in vivo. R6/1 (HD) or NT WT control male mice containing the tamoxifen-inducible Cre and floxed alleles of IKKβ were treated with tamoxifen or oil vehicle control for 1 wk starting at 10 wk to knock out IKKβ in striatum and liver. At the termination of the study at 16 wk, Western analysis of NT and HD soluble fractions was used to examine levels of autophagy proteins LC3 and LAMP-2A relative to loading controls α-tubulin (striatum) or ERK1/2 (liver). LC3 I was detected in striatum, while LC3 I and II were observed in liver. LC3 I was quantitated for both tissues and was found in striatum, but not in liver, to be significantly increased with IKKβ knockout or with transgene expression. LAMP-2A levels were unchanged in striatum but were significantly increased in HD mouse liver. Western images, shown, were quantitated; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 values represent means ± SEM. Statistical significance was determined by one-way ANOVA with Bonferroni posttesting.

IKKβ Knockout Increases Neuronal Degeneration and Microglial Activation.

Since striatal neurodegeneration is a hallmark of HD (1), we asked whether overt striatal degeneration was impacted by IKKβ knockout in R6/1 HD mice using Fluoro-Jade B staining, a polyanionic fluorescein derivative which sensitively and specifically binds to degenerating neurons. We quantitated Fluoro-Jade B-positive cells in brain sections from oil vs. tamoxifen-treated HD and NT control mice (Fig. 5). As expected, Fluoro-Jade B-positive striatal cells were robustly increased (∼50 fold) in oil-treated HD mice vs. NT controls, depicting the neurodegeneration in the striatum of R6/1 HD mice. With tamoxifen-induced IKKβ knockout, HD mice showed an overall enhancement of the Fluoro-Jade B signal (approximately twofold), consistent with an IKKβ knockout-mediated increase in striatal neurodegeneration in R6/1 HD mice.
Fig. 5.

IKKβ knockout increases neurodegeneration and microglial activation in striatum. Male R6/1 (HD) mice containing the tamoxifen-inducible Cre and floxed alleles of IKKβ were treated with tamoxifen or oil vehicle control for 1 wk starting at 10 wk. At the termination of the study at 16 wk, consecutive coronal brain sections containing striatum were stained against Fluoro-Jade B, a neuronal death marker (A) or Iba1, a microglia marker (B). Images (20×) show that R6/1 tamoxifen-treated mice had significant increases in both Fluoro-Jade B- (A) and Iba-1– (B) positive cells in the striatum compared with R6/1 (HD) oil-treated mice (representative images shown). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 values represent means ± SEM. Cells were counted using Bitplane’s Imaris microscopy image analysis software and number of microglia per field of vision (FOV) graphed. Statistical comparisons of results were performed by performing one-way ANOVA analysis followed by Bonferroni’s multiple comparison tests. n = 4 per treatment. (Scale bars, 100 μm.)

IKKβ knockout increases neurodegeneration and microglial activation in striatum. Male R6/1 (HD) mice containing the tamoxifen-inducible Cre and floxed alleles of IKKβ were treated with tamoxifen or oil vehicle control for 1 wk starting at 10 wk. At the termination of the study at 16 wk, consecutive coronal brain sections containing striatum were stained against Fluoro-Jade B, a neuronal death marker (A) or Iba1, a microglia marker (B). Images (20×) show that R6/1 tamoxifen-treated mice had significant increases in both Fluoro-Jade B- (A) and Iba-1– (B) positive cells in the striatum compared with R6/1 (HD) oil-treated mice (representative images shown). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 values represent means ± SEM. Cells were counted using Bitplane’s Imaris microscopy image analysis software and number of microglia per field of vision (FOV) graphed. Statistical comparisons of results were performed by performing one-way ANOVA analysis followed by Bonferroni’s multiple comparison tests. n = 4 per treatment. (Scale bars, 100 μm.) Microglia are the resident macrophages of the central nervous system that respond to brain insults including neurodegenerative disease (36). Microglia in striatum are increased and activated in response to HD-associated neurodegeneration and may play both protective and pathogenic roles in disease progression (1, 36). Upon activation of microglia, antiionized calcium binding adaptor molecule 1 (Iba1), a marker for microglia in mouse tissue, is up-regulated allowing the discrimination between surveying and activated microglia (37). In both HD and NT control mice, tamoxifen-induced IKKβ knockout resulted in significantly elevated relative steady-state levels of striatal Iba1, demonstrating that even in the context of healthy control striatum a reduction in neuronal IKKβ resulted in a significant activated microglial response (Fig. 5). Astrocytes are star-shaped glial cells in the central nervous system that express glial fibrillary acidic protein (GFAP), a type of astrocyte-enriched intermediate filament protein, and respond to all forms of injury, trauma, and infection in the brain. Astrocyte dysfunction has previously been found to accompany and contribute to neuronal deficits in HD model mice (38). We examined levels of GFAP by immunohistochemistry in striatum in NT and HD mice with and without IKKβ knockout and noted that staining of GFAP was greatly enhanced by IKKβ knockout in NT controls to similar levels as observed in HD mice. IKKβ knockout did not further enhance staining of GFAP beyond the HD effect (). The increase in GFAP-positive astrocytes in control NT IKKβ knockout mice may reflect striatal neuronal stress due to a loss of IKKβ function.

Discussion

We previously showed that IKKβ directly phosphorylates HTT S13 in vitro and in cell culture and that this phosphorylation is impaired with expansion of the HTT polyQ repeat in cells (2). Further, it was shown that mimicking this phosphorylation in mutant HTT exon 1 protein was protective in an acute striatal slice culture model of HD as well as in the context of full-length mutant HTT in BACHD mice (2, 3). The current study was initiated to evaluate whether IKKβ is a relevant kinase for HTT S13 in vivo and to examine whether this IKKβ-mediated phosphorylation is consistent with a neuroprotective function in HD progression in vivo. We now report that IKKβ knockout in both liver and striatum in male R6/1 mutant (HD) mice and in NT WT controls reduces phosphorylation of WT full-length mouse HTT S13, demonstrating that it is a relevant S13 kinase in vivo. In the current study, IKKβ knockout in R6/1 worsened the HD behavioral phenotype in these mice at specific time points but did not affect NT behavior, consistent with the predicted delay in R6/1 progression from IKKβ-mediated full-length HTT S13 phosphorylation as we observed in BACHD using phosphomimetic full-length mutant HTT (3). Interestingly, exacerbation of phenotypes appears to be modest and transient for the pole task, only showing significance at the 12-wk time point but not at the 16-wk time point. We speculate that this may be due to changes in phosphorylation of HTT S13 at various time points, to variations in IKKβ regulation of some autophagy genes over time, or by progressive inhibition of autophagy by transgenic mutant HTT exon 1 protein expression with aging, but more studies will be required to clarify these results. In the current study, we find histologically that IKKβ knockout increases overt neuronal degeneration and microglial activation in R6/1 striatum, suggesting that IKKβ may be essential for striatal health in mice expressing mutant HTT exon 1 protein in vivo. In 16-wk-old male R6/1 HD mice, levels of transgenic mutant HTT exon 1 protein and aggregates were unchanged in striatum and liver with IKKβ knockout. Using cell culture, we previously found that WT HTT fragment clearance was increased by S13 phosphorylation and IKKβ overexpression. In contrast, mutant HTT fragment clearance was not greatly altered upon IKKβ overexpression and mutant HTT S13 phosphorylation was reduced compared with WT fragment (2). Therefore, we did not expect transgenic mutant HTT exon 1 protein levels to be reduced with IKKβ knockout in vivo, which proved to be the case. This is in contrast to the reduction in aggregation we observed when mimicking constitutive phosphorylation of HTT S13 and S16 in full-length mutant HTT in BACHD mice where numbers of aggregates were vastly reduced (3). HTT neuronal aggregate appearance and disease onset are observed much earlier in R6/1 than in BACHD (22), which may reflect a more rapid impairment of neuronal proteostasis and lysosomal function in the R6/1 model due to mutant HTT exon 1 protein expression vs. the mutant full-length HTT expression in BACHD. S13 phosphorylation in the context of polyQ expansion is inefficient (2), and in the current study in R6/1 we saw no evidence of transgenic mutant exon 1 protein phosphorylation in vivo, in contrast to the endogenous full-length WT HTT which required IKKβ for efficient phosphorylation. In R6/1 HD and NT control striatum, levels of full-length WT HTT increased and HTT S13 phosphorylation was reduced with IKKβ knockout suggestive of a reduced flux of WT full-length mouse HTT, but in liver WT full-length HTT levels were unchanged with IKKβ knockout despite a reduction in its S13 phosphorylation. Given that liver also has far fewer mutant HTT exon 1 protein aggregates than striatum, proteosomal and lysosomal protein clearance mechanisms for degradation of both WT full-length endogenous mouse HTT and transgenic mutant HTT exon 1 protein may be different and/or more efficient in liver than in striatum, thus resulting in reduced mutant HTT-mediated toxicity in liver compared with striatum. IKKβ-mediated phosphorylation of WT full-length mouse HTT S13 may therefore be more important for the health of the striatum than the liver and other tissues to maintain normal HTT function and proper proteostasis. We previously showed that HTT interacts with the mammalian Atg8 autophagy protein LC3 (39). We observed a significant LC3 protein accumulation in striatum, but not in liver, upon IKKβ knockout or with mutant HTT exon 1 protein expression, consistent with the hypothesis that IKKβ may regulate an LC3-mediated type of autophagy important for striatum but not for liver in R6/1 HD mice. In cell culture, we previously showed that overexpression of the lysosomal membrane protein LAMP-2A resulted in clearance of HTT exon 1 protein (2). In liver, but not in striatum, we saw increased levels of LAMP-2A protein in R6/1 HD mice, suggesting that activated LAMP-2A–mediated, LC3-independent autophagy may clear mutant HTT exon 1 protein and full-length WT HTT in liver but not in striatum, reducing aggregate numbers and contributing to liver health in HD. Recently it was elucidated that incomplete transcription of the mutant HTT gene results in expression of toxic mutant HTT exon 1 protein in HD knock-in mouse models and in patients (40, 41). Further, mutant HTT exon 1 protein expression can activate the IKK complex (14), and IKKβ can induce expression of several autophagy genes and up-regulate autophagy by an NF-Kβ–independent mechanism (7, 8). Mutant HTT exon 1 protein is an autophagic substrate and its expression has been found by several groups to induce autophagy that activates its clearance (32–34). Our laboratory and another have independently demonstrated that at least one of HTT’s normal functions is that of a scaffold for selective autophagy (39, 42), a function that we propose may be induced by IKKβ-mediated phosphorylation of HTT S13. HTT may be degraded through its own selective autophagic scaffold function, a function that may be impaired by expansion of the polyQ repeat, resulting in the observed accumulation of mutant HTT exon 1 protein and autophagic substrates in inclusions of diseased neurons (43). Therefore, clearance of this toxic mutant exon 1 protein fragment may occur indirectly through IKK activation and be one mechanism of slowing HD progression in striatum. In the R6/1 HD mouse model, however, striatal transgenic mutant exon 1 protein is expressed at such high levels compared with those found in HD knock-in or patient striatum that IKKβ knockout ultimately does not impact its striatal accumulation, or that of LC3, suggesting that autophagic flux is blocked in striatum at 16 wk in R6/1, and at this late stage attempted activation of autophagy may be futile. Transcriptional analysis shows that IKKβ may activate expression of several basal autophagy genes in NT WT liver. As striatum severely degenerates in HD but liver is less impacted, an increase in autophagy gene expression in striatum may represent a compensatory activation in response to the cellular stress caused by the chronic expression of mutant HTT, a response that may not be required in the liver. This is consistent with the hypothesis that mutant exon 1 protein clearance is more efficient in the liver and may potentially be mediated by the observed increase in liver LAMP-2A protein levels. Our data also suggest that early expression of IKKβ may prolong striatal health in HD partially through the activation of stress-induced autophagy that may be required for degradation of mutant HTT exon 1 protein in striatum in early stages of disease. Compensatory activation of IKKβ may therefore slow disease progression as long as lysosomal function is intact (2, 7). We suggest that autophagic balance regulates cell survival vs. neurodegeneration in HD and propose the following hypothetical model (Fig. 6). In premanifest HD, mutant HTT exon 1 protein is expressed due to incomplete transcription of the mutant HTT gene (40, 41). This creates a cellular stress that activates the IKK complex (14) to increase autophagy gene (7, 8) and HTT expression (44) and activates phosphorylation of HTT S13 (2), to induce autophagy important for clearance of mutant HTT exon 1 protein (32–34) and a mitigation of the cellular stress, allowing proteostasis to exist in a healthy balance (Fig. 6). In manifest HD, lysosomal function and autophagy become impaired with aging in association with polyQ expansion of HTT and reduced HTT protein levels (31, 45), resulting in reduced full-length HTT phosphorylation, and mutant HTT exon 1 protein and other autophagy cargos accumulate and aggregate, or may be expelled from the cell for prion-like propagation to neighboring cells (46–48). The ensuing cellular stress causes a robust microglial activation (49) and inflammatory pathway induction and accumulation of IKKβ that can no longer activate autophagy (13), resulting in cellular dysfunction and neurodegeneration (Fig. 6). Therapeutics that improve lysosomal and autophagic function in young individuals may keep mutant HTT exon 1 protein levels reduced and slow HD progression (Fig. 6). However, if the lysosome is unable to degrade autophagic cargo, inhibition of autophagy may then be neuroprotective and reduce inflammation (50–52).
Fig. 6.

A model for the progression of HD pathogenesis dependent on the autophagic balance of the patient. In premanifest HD (A), mutant HTT exon 1 protein is expressed in striatum due to incomplete transcription of the mutant HTT gene, and accumulation of mutant HTT exon 1 protein (mHTTex1p) causes a cellular stress, which activates the IKK complex. IKKβ activates autophagy gene expression and increases phosphorylation of HTT S13 to induce HTT’s role as an autophagic scaffold protein. This results in autophagic clearance of mHTTex1p, ultimately reducing inflammation, and the cell survives. In manifest HD (B), levels of HTT and other autophagy proteins have declined with age and the ability of the lysosome to degrade autophagic cargos is reduced. With polyQ expansion, mutant HTT is less well phosphorylated reducing its function as an autophagic scaffold. mHTTex1p expressed from incomplete transcription of the mutant HTT gene accumulates and is not cleared by the lysosome, causing an up-regulation of IKK that is unable to further activate autophagy. This results in a robust microglial activation, massive inflammatory pathway activation, cellular dysfunction, and neurodegeneration. Therapies to treat HD need to be designed with the autophagic balance of the patient in mind (C). Early therapies to activate autophagy and IKKβ to degrade mHttex1p and reduce cellular stress may be protective as long as lysosomal function is still intact, but later therapies to inhibit autophagy and block IKKβ may be useful if the aging lysosome can no longer degrade autophagic cargo.

A model for the progression of HD pathogenesis dependent on the autophagic balance of the patient. In premanifest HD (A), mutant HTT exon 1 protein is expressed in striatum due to incomplete transcription of the mutant HTT gene, and accumulation of mutant HTT exon 1 protein (mHTTex1p) causes a cellular stress, which activates the IKK complex. IKKβ activates autophagy gene expression and increases phosphorylation of HTT S13 to induce HTT’s role as an autophagic scaffold protein. This results in autophagic clearance of mHTTex1p, ultimately reducing inflammation, and the cell survives. In manifest HD (B), levels of HTT and other autophagy proteins have declined with age and the ability of the lysosome to degrade autophagic cargos is reduced. With polyQ expansion, mutant HTT is less well phosphorylated reducing its function as an autophagic scaffold. mHTTex1p expressed from incomplete transcription of the mutant HTT gene accumulates and is not cleared by the lysosome, causing an up-regulation of IKK that is unable to further activate autophagy. This results in a robust microglial activation, massive inflammatory pathway activation, cellular dysfunction, and neurodegeneration. Therapies to treat HD need to be designed with the autophagic balance of the patient in mind (C). Early therapies to activate autophagy and IKKβ to degrade mHttex1p and reduce cellular stress may be protective as long as lysosomal function is still intact, but later therapies to inhibit autophagy and block IKKβ may be useful if the aging lysosome can no longer degrade autophagic cargo. The development of therapeutic approaches to treat neurodegenerative diseases involving an imbalance in proteostasis, including AD, PD, ALS, HD, and other polyQ-repeat diseases, by correcting proteostatic imbalance is an attractive avenue for therapeutic development for these diseases. However, the results presented here provide a note of caution. We suggest that therapies for these diseases may need to be developed based on whether the patient’s lysosomal function is still intact, as early and late therapies may be very different between the two stages. A challenge which must be met, we believe, is an assessment of the status of the autophagic balance of each patient at the time therapy is initiated and the possibility that a “one-size-fits-all” therapeutic strategy may have to be replaced by a strategy which reflects the assessment of the autophagic balance of the patient at the time therapy is initiated and a modulation of therapeutic approach in relation to changes in the autophagic balance of the patient over time.

Materials and Methods

Experimental Animals.

All experiments were carried out in strict accordance with the Guide for the Care and Use of Laboratory Animals (53) and an approved animal research protocol by the Institutional Animal Care and Use Committee at the University of California, Irvine, an American Association for Accreditation of Laboratory Animal Care-accredited institution, as previously published in our laboratory (54). All efforts were made to minimize research animal suffering throughout the duration of the study. A transgenic mouse model with lox-P flanked alleles of IKKβ (23) was used for this study. Wfs1-Tg3-CreERT2 and R6/1 mice were obtained from Jackson Laboratories (Research Resource Identifiers IMSR_JAX: 009103 and 006471, respectively). Mice were cross-bred to generate Wfs-CreERT2/+;IKKβflox/flox mice+/− the R6/1 transgene. All mice were in C57BL/6 background. Mice were mix-housed under a 12-h light/dark cycle in groups of up to five animals per cage with food and water administered for ad libitum consumption. We performed CAG repeat sizing of R6/1 tail snips and a subset of striatal tissue punches (Laragen). The average transgenic CAG repeat number from R6/1 mice in this study was 132. PCR on tail samples was used to genotype for IKKβ floxed alleles (sense oligo: 5′-GTTCAGAGGTCCAGTCCATTATC-3′, antisense oligo: 5′-TAGCCTGCAAGAGACAATACG-3′). To justify experimental group and trial sizes, we used G Power analysis based on published results (54–58) and our previous experience and for HD mouse model studies. Based on these analyses, we used n = 10 per group for behavioral studies and n = 4 for biochemistry Mice were killed by pentobarbital overdose and perfused with 0.01 M PBS. Liver was collected, striatum and cortex were dissected out of the left hemisphere, and tissues were flash-frozen for RNA or protein isolation as described below. One piece of liver and the other halves of brain were postfixed in 4% paraformaldehyde, cryoprotected in 30% sucrose, and cut at 40 μm on a sliding vibratome for immunohistochemistry.

Tamoxifen Protocol.

To acutely delete IKKβ we used a published protocol (59). Tamoxifen (T5648; Sigma) was suspended at a concentration of 20 mg/mL, in a mixture of 98% sunflower oil (700011-932; VWR) and 2% ethanol. Tamoxifen (200 μg/g) or sunflower oil control were injected intraperitoneally once per day for 5 d into 10-wk-old mice. Mice were dosed with tamoxifen at a volume based on weight (i.e., 180 μL of concentration 20 μg/μL for an 18-g mouse). Higher levels were tested and did not provide greater deletion efficiency. During the study, 9/10 of the NT-tamoxifen females, 3/9 of the HD-tamoxifen females, 1/12 of the NT-tamoxifen males, and 2/12 of the HD-tamoxifen males died following tamoxifen treatment. No death was observed with oil treatment in any of the groups. Because of the enhanced lethality of tamoxifen/IKKβ knockout particularly in NT females, our analysis was carried out exclusively with male mice.

Behavioral Timeline and Assessment.

All behavioral assessments were performed as previously described (54, 60). Specifically, body weights were measured weekly at 8 to 15 wk of age. The latency to fall from the rod was recorded over three trials then averaged and analyzed for significance. A pole test was used to examine the ability for mice to descend a vertical pole (1 cm in diameter, 60 cm high) at 8, 12, and 16 wk of age. Mice were habituated to the task 1 d before testing. Mice were tested in this assay by placing them facing down on the vertical pole and total time to descend until reaching the base was measured. This task was performed four times with 30-s rest periods provided between trials. Using the total time to descend from placement on the pole as the starting point, four trials were averaged and analyzed for statistical significance. For grip strength measurements, we used an IITC Life Science digital force transducer instrument to measure forelimb grip force, which gives readings in 1-g increments. Using this instrument, each mouse was lowered toward a wire mesh by the tail and the peak force applied on a digital display grip strength meter was measured. Mice were gently pulled back until they released their grip from the mesh. Five consecutive trials were measured, with the four strongest pulls averaged and analyzed for statistical significance.

Tissue Lysis, IP, Western Analysis, and Antibodies.

Whole male mouse striatum or liver tissue, taken at the end of the study at 16 wk, was dounced 20 times on ice in modified RIPA buffer (50 mM Tris⋅HCl, pH 7.4, 1% Nonidet P-40, 0.25% Na-doxycholate, 150 mM NaCl, and 1 mM EDTA) containing a complete protease/phosphatase-inhibitor pellet (Thermo), 1 μg/mL leupeptin and aprotenin, phosphatase inhibitors 2 and 3 (Sigma-Aldrich), and 1 mM PMSF. Homogenate lysates were centrifuged at 16.1 × g for 15 min at 4 °C. Protein concentration was determined on the supernatant by Bradford assay. IP was done as previously described (3), summarized as follows: 500 μg of supernatant was incubated ± 1 μL pS13 antibody for 1 h on ice in a total volume of 30 μL. Thirty microliters of Protein-G Dynabeads (Invitrogen) were preequilibrated and washed in 100 mM phosphate buffer (pH 5.0), and the buffer was removed using a magnetic rack. The beads were resuspended in the supernatant/antibody mixture and rocked for 45 min at 4 °C. They were then washed using a magnetic rack three times in 200 μL of 100 mM phosphate buffer (pH 5.0). The beads were resuspended in 25 μL of loading buffer (Invitrogen), incubated at 70° C for 10 min, and run on 3 to 8% Tris-acetate gels (Invitrogen). These gels were blotted to PVDF (Millipore), blocked with SuperBlock BlockingBuffer (ThermoScientific), and subjected to Western analysis using PICO reagent (Thermo) exposed to film for images. Protein quantification was performed by Scion Image analysis software. Band densities from whole-cell lysates were normalized to α-tubulin for striatum and ERK1/2 for liver. Antibodies used were anti-HTT phosphoserine 13 pS13 (2) 1:1,000, anti-HTT VB3130 (N17 epitope) to detect full-length ∼350 kDa mouse WT HTT levels (Viva Bioscience) 1:1,000, anti-α-tubulin (Sigma-Aldrich) 1:5,000, anti-ERK1/2 (Cell Signaling) 1:1,000, and anti-IKKβ (Abcam 10AG2) 1:500. Anti-LC3 antibody (MBL) was used at 1:1,000 and anti-LAMP-2A antibody (Zymed) at 1:500. Whole-cell supernatant was run at concentrations 30 μg per lane for striatum and 50 μg per lane for liver and subjected to Western analysis.

Analysis of Transgenic Mutant HTT Exon 1 Protein Levels by Western Analysis.

For Western analysis, striatal tissue was the same as that used for the above IP studies. Liver tissue was dounced 30 times in lysis buffer (10 mM Tris, pH 7.4, 1% Triton X-100, 150 mM NaCl, 10% glycerol, 20 mM N-ethylmaleimide, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM Na3VO4, 1 μg/mL leupeptin, 1 μg/mL aprotinin, and 20 mM NaF), allowed to rest on ice for 1 h, then centrifuged at 15,000 × g at 4 °C for 20 min and the resulting supernatant was quantitated by Lowry assay. Thirty micrograms per lane of striatal and liver soluble whole-cell extracts were run on 4 to 12% Bis-Tris MidiGels (Invitrogen) using Mops running buffer and transferred onto 0.45-μm nitrocellulose membranes. We detected transgenic human mutant HTT exon 1 protein smears in the soluble fraction by Western analysis using anti-human HTT MAB5492 (Millipore) at 1:1,000, which does not recognize endogenous mouse HTT, quantitated using Scion Image analysis software, and performed statistical analyses with GraphPad Prism 6, version 6.01. This liver tissue lysis protocol and gel system was also used to compare levels of IKKβ in oil-treated R6/1 (HD) vs. NT animals using anti-IKKβ (10AG2; Abcam) 1:500. Loading controls for striatum and liver were measured using anti–α-tubulin (Sigma-Aldrich) at 1:5,000 and anti-ERK1/2 (Cell Signaling) at 1:1,000, respectively.

Quantitation of Mutant HTT Aggregates in Striatum.

Half-brain coronal sections, 40 μm each, four sections per 16-wk-old male mouse, were used for quantitation. Sections were picked from bregma 1.34, every 12 sections, to bregma −0.1, from male R6/1 mice containing the Cre and floxed alleles of IKKβ (HD) and treated with tamoxifin or oil vehicle control, four mice per treatment group. Fluorescent immunolabeling was done with anti-HTT clone mEM48 (MAB5374; Millipore) to label transgenic human mutant HTT exon 1 protein aggregates and TO-PRO-3 Iodide stain (T3605; Thermo Fisher Scientific) to label nuclei. Images were captured using Leica confocal microscope (DM2500) and Leica camera TCS SPE (Leica Microsystems Inc.). Images were taken at 40×, with z-volume set at 25 to 30 μm at 1 μm per step. Three striatal areas, upper, middle and lower, were imaged with consistent settings for laser intensity, exposure time, and gain through all images. Imaris x64 quantitation software (Bitplane Scientific Software) was used to evaluate the number of aggregates in each area normalized to the number of nuclei, calculated as the percent of cells expressing aggregates.

Quantitation of Mutant HTT Aggregates in Liver.

Paraffin-embedded liver sections, 40 μm per section, from male 16-wk-old R6/1 mice containing the Cre and floxed alleles of IKKβ (HD), treated with tamoxifin (n = 5) or oil vehicle control (n = 4), were used. One section per mouse was analyzed. Fluorescent aggregate immunolabeling was done with anti-HTT MW8 (AB528297; Developmental Studies Hybridoma Bank) (recommendation from Jeffrey Carroll for liver HTT, Western Washington University, Bellingham, WA) and TO-PRO-3 Iodide stain (T3605; Thermo Fisher Scientific) was used to label nuclei. Images were captured using Leica confocal microscope (DM2500) and Leica camera TCS SPE (Leica Microsystems Inc.). All images were taken at 20×, two areas per section, with consistent settings for laser intensity, exposure time, and gain through all images. In each area, the number of aggregates was counted by eye without normalization, as aggregate numbers were very low and visible per field.

Quantitation of Liver Lipid Droplets.

Bodipy 493/503 (D3922; Thermo Fisher) was used to stain neutral lipids in paraformaldehyde-fixed 40-μm male liver slices. Bodipy 493/503 was stored as stock of 1 mg/mL in DMSO. Three PBS washes of tissue were followed by staining with bodipy diluted to 10 μg/mL in PBS for 30 min at room temperature. This was followed by 1-min incubation in 1:5,000 Hoechst reagent to stain nuclei, followed by three PBS washes and mounting of tissue using fluoromount. Z-stack images were taken using a confocal microscope and surface area and volume of lipids determined using Imaris x64 quantitation software (Bitplane Scientific Software). The analysis was done on 16-wk-old male mouse liver using two images per liver section, three sections per animal, four animals per group. Quantification was performed using Imaris image software to calculate surface area of lipid droplets and cell number for normalization. Cell number was quantified using DAPI staining.

Analysis of Microglia in Striatum.

For immunohistochemical assessments, 40-μm sections of postfixed half-brains from four 16-wk-old male mice per treatment group were processed for immunohistochemistry and imaged via confocal microscopy. The following primary antibody was used: anti-Iba1 (27030; Wako Pure Chemicals Industries). Alexa fluorescent-conjugated secondary antibody was used (A21428; Thermo Fisher Scientific). Coronally sectioned stained tissue was processed and mounted on slides with Fluoromount-G (SouthernBiotech). Images were captured using Leica confocal microscope (DM2500) and Leica camera TCS SPE (Leica Microsystems Inc.). Five comparable representative images per treatment group were taken at 10×, 20×, and 63× z stack, with consistent settings for laser intensity, exposure time and gain through all images. Automatic analyses and cell quantitation from acquired images was processed using Imaris x64 quantitation software (Bitplane Scientific Software).

Fluoro-Jade B Analysis of Neurodegeneration in Striatum.

Analysis was done using four male postfixed half-brains for each treatment group, with five 40-μm representative sections prepared from each. Stack images (20×) were obtained using confocal microscopy at comparable sections for each animal. Images were captured using Leica confocal microscope (DM2500) and Leica camera TCS SPE (Leica Microsystems Inc.). Striatal sections were mounted on Shandon Polysine slides (Thermo Scientific), allowed to dry completely, and immersed in a series of washes: (i) 3 min in 80% ethanol, (ii) 2 min in 70% ethanol, (iii) 2 min in a 1:200 dilution of acetic acid to MilliQ water, (iv) 10 min gently rocking in 0.06% KMnO4 solution, (v) 2 min in a 1:200 dilution of acetic acid to MilliQ water, (vi) 15 min gently rocking in 0.0004% Fluoro-Jade B (AG310; Millipore Sigma) solution, and (vii) three sequential 1-min rinses in a 1:200 dilution of acetic acid to MilliQ water. Slides were allowed to dry, immersed in three sequential 1-min washes with 100% xylene, allowed to dry again, and coverslipped with DPX mounting medium (Electron Microscopy Sciences).

GFAP Free-Floating Immunohistochemistry Protocol.

Sections were incubated in 1% hydrogen peroxide in Tris-buffered saline (TBS; 0.05 M Tris, 145 mM NaCl, pH 7.6) for 30 min followed by three washes in TBS. After incubation in 15% (vol/vol) normal goat serum (S-1000; Vector Laboratories) in TBST (TBS with 0.3% Triton X-100) for 30 min, sections were then incubated in GFAP primary antibody (1:400 dilution, Z033429-2; Dako) in 10% (vol/vol) normal goat serum in TBST overnight. After three washes in TBS, sections were incubated with biotinylated secondary antibody (1:1,000 dilution, BA-1000; Vector Laboratories) in 10% (vol/vol) normal goat serum in TBST for 2 h. Sections were then washed three times in TBS and stained using Vectastain Elite ABC HRP Kit (PK-6101; Vector Laboratories) (1:1,000 dilution reagent A, 1:1,000 dilution reagent B) for 2 h. After two more washes in TBS, sections were then stained using DAB Peroxidase Substrate Kit (SK-4100; Vector Laboratories). After 1.5-min incubation in DAB substrate solution, sections were washes two times in ice-cold TBS, mounted on gelatin-coated slides, and coverslipped using Permount mounting medium (SP15-100; Fisher Scientific). Sections were viewed on an Olympus BX53 microscope, images with identical capture settings were acquired using a QImaging QIClick CCD camera and Q-Capture Pro-7 software, and brightness/contrast adjustments were made in parallel (via adjustment layer) in Photoshop.

RNA Extraction and qPCR.

Striatal and liver tissues were homogenized in TRIzol (Invitrogen) and total RNA was isolated using an RNEasy Mini kit (QIAGEN) with supplemental DNase treatment to remove residual DNA. Reverse transcription was performed using oligo dT primer sets and 1 μg total RNA using SuperScript III First-Strand Synthesis System (Invitrogen) as previously described (54). The qPCR was performed as previously described (61) and CT values for each gene of interest (GOI) were normalized against RPLPO to calculate dCT values. For statistical analysis ddCT values were used in a two-way ANOVA for each GOI. Post hoc analyses using Tukey’s honestly significant difference test with Bonferroni correction were used to test statistical significance between each group interaction contrast. Adjusted P values are reported. While the Wfs1 promoter can also affect cortex and cerebellum, we did not observe major qPCR changes in IKKβ expression in male cortex or cerebellum in either HD or NT mice with tamoxifen treatment. We therefore did not further evaluate these tissues. Primer sequences (5′–3′) used were as follows:

HTT.

Forward sequence: GCAGGGAAAGAGCTTGAGACAC Reverse sequence: CCTCATTCTCCTTGTGGCACTG

Beclin1.

Forward sequence: CAGCCTCTGAAACTGGACACGA Reverse sequence: CTCTCCTGAGTTAGCCTCTTCC

Atg5.

Forward sequence: CTTGCATCAAGTTCAGCTCTTCC Reverse sequence: AAGTGAGCCTCAACCGCATCCT

Atg7.

Forward sequence: CCTGTGAGCTTGGATCAAAGGC Reverse sequence: GAGCAAGGAGACCAGAACAGTG

LC3A.

Forward sequence: CTGCCTGTCCTGGATAAGACCA Reverse sequence: CTGGTTGACCAGCAGGAAGAAG

GABARAPL1.

Forward sequence: GTGGAGAAGGCTCCTAAAGCCA Reverse sequence: AGGTCTCAGGTGGATCCTCTTC

p62/SQSTM1.

Forward sequence: GCTCTTCGGAAGTCAGCAAACC Reverse sequence: GCAGTTTCCCGACTCCATCTGT

Atg16L.

Forward sequence: GGACACTCATCCTGCTTCTGGT Reverse sequence: GCTTCCCAAAGTTTCACCCTGC

mAtg13.

Forward sequence: AGAGACTGGTGATGCACATGCC Reverse sequence: CCGTCCTTCACTGCTGTTAGAC

IKKβ.

Forward sequence: GCAGACTGACATTGTGGACCTG Reverse sequence: ATCTCCTGGCTGTCACCTTCTG

RPL18A.

Forward sequence: GAAGGTGGAAGAGATTGCAGCTG Reverse sequence: TCTTGGTGGTGAAGCGTGGCTT

Atp5b.

Forward sequence: CTCTGACTGGTTTGACCGTTGC Reverse sequence: TGGTAGCCTACAGCAGAAGGGA

Atg9A.

Forward sequence: GTTAGCTGTGGAACACGTCCTC Reverse sequence: GCAAGAATCACTCGGAGCAGCT

Atg14.

Forward sequence: CAGCAAGCAGAAACTGACACGC Reverse sequence: GACCAAGTGCATCAGGTTCCTG

BNIP3.

Forward sequence: GCTCCAAGAGTTCTCACTGTGAC Reverse sequence: GTTTTTCTCGCCAAAGCTGTGGC

NIX (BNIP3L).

Forward sequence: GCATGAGGAAGAGTGGAGCCAT Reverse sequence: AAGGTGTGCTCAGTCGTTTTCCA

FIP200 (RB1CC1).

Forward sequence: GGAATCTCTGGTCAGGAAGTGC Reverse sequence: GTCCAAGGCATACAGCCGATCT

LAMP-2A.

Forward sequence: AGGTGCTTTCTGTGTCTAGAGCGT Reverse sequence: AGAATAAGTACTCCTCCCAGAGCTGC

LAMP-2B.

Forward sequence: ATGTGCTGCTGACTCTGACCTCAA Reverse sequence: TGGAAGCACGAGACTGGCTTGATT

LAMP-2C.

Forward sequence: ACCACCAATCTAAGAGCAGGACT Reverse sequence: GGTGCTGGTCTTTCAGGCTTGATT

TFEB.

Forward sequence: CCACCCCAGCCATCAACAC Reverse sequence: CAGACAGATACTCCCGAACCTT

TG2.

Forward sequence: GAAGGAACACGGCTGTCAGCAA Reverse sequence: GATGAGCAGGTTGCTGTTCCTGG

Atg10.

Forward sequence: GAGACCTTGACACCACATGCCA Reverse sequence: GCAGGTCTCGTCACTTCAGAATC

RPLPO.

Forward sequence: TGGTCATCCAGCAGGTGTTCGA Reverse sequence: ACAGACACTGGCAACATTGCGG
  60 in total

1.  Characterization of progressive motor deficits in mice transgenic for the human Huntington's disease mutation.

Authors:  R J Carter; L A Lione; T Humby; L Mangiarini; A Mahal; G P Bates; S B Dunnett; A J Morton
Journal:  J Neurosci       Date:  1999-04-15       Impact factor: 6.167

2.  Activation of the IkappaB kinase complex and nuclear factor-kappaB contributes to mutant huntingtin neurotoxicity.

Authors:  Ali Khoshnan; Jan Ko; Erin E Watkin; Lisa A Paige; Peter H Reinhart; Paul H Patterson
Journal:  J Neurosci       Date:  2004-09-15       Impact factor: 6.167

3.  HDAC6 and microtubules are required for autophagic degradation of aggregated huntingtin.

Authors:  Atsushi Iwata; Brigit E Riley; Jennifer A Johnston; Ron R Kopito
Journal:  J Biol Chem       Date:  2005-09-28       Impact factor: 5.157

4.  Early behavioral deficits in R6/2 mice suitable for use in preclinical drug testing.

Authors:  M A Hickey; K Gallant; G G Gross; M S Levine; Marie-Françoise Chesselet
Journal:  Neurobiol Dis       Date:  2005-10       Impact factor: 5.996

5.  Chronology of behavioral symptoms and neuropathological sequela in R6/2 Huntington's disease transgenic mice.

Authors:  Edward C Stack; James K Kubilus; Karen Smith; Kerry Cormier; Steven J Del Signore; Emmanuel Guelin; Hoon Ryu; Steven M Hersch; Robert J Ferrante
Journal:  J Comp Neurol       Date:  2005-10-03       Impact factor: 3.215

6.  Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease.

Authors:  Brinda Ravikumar; Coralie Vacher; Zdenek Berger; Janet E Davies; Shouqing Luo; Lourdes G Oroz; Francesco Scaravilli; Douglas F Easton; Rainer Duden; Cahir J O'Kane; David C Rubinsztein
Journal:  Nat Genet       Date:  2004-05-16       Impact factor: 38.330

7.  TNF-mediated inflammatory skin disease in mice with epidermis-specific deletion of IKK2.

Authors:  Manolis Pasparakis; Gilles Courtois; Martin Hafner; Marc Schmidt-Supprian; Arianna Nenci; Atiye Toksoy; Monika Krampert; Matthias Goebeler; Reinhard Gillitzer; Alain Israel; Thomas Krieg; Klaus Rajewsky; Ingo Haase
Journal:  Nature       Date:  2002-06-20       Impact factor: 49.962

8.  Molecular and behavioral analysis of the R6/1 Huntington's disease transgenic mouse.

Authors:  B Naver; C Stub; M Møller; K Fenger; A K Hansen; L Hasholt; S A Sørensen
Journal:  Neuroscience       Date:  2003       Impact factor: 3.590

9.  Standardization and statistical approaches to therapeutic trials in the R6/2 mouse.

Authors:  Emma Hockly; Benjamin Woodman; Amarbirpal Mahal; Cathryn M Lewis; Gillian Bates
Journal:  Brain Res Bull       Date:  2003-09-30       Impact factor: 4.077

10.  Autophagy-mediated clearance of huntingtin aggregates triggered by the insulin-signaling pathway.

Authors:  Ai Yamamoto; M Laura Cremona; James E Rothman
Journal:  J Cell Biol       Date:  2006-02-27       Impact factor: 10.539

View more
  9 in total

1.  IKKβ Alleviates Neuron Injury in Alzheimer's Disease via Regulating Autophagy and RIPK1-Mediated Necroptosis.

Authors:  Wei Wang; Xunhu Gu; Zhijuan Cheng; Xiaoqing Lu; Shuhua Xie; Xu Liu
Journal:  Mol Neurobiol       Date:  2022-01-27       Impact factor: 5.590

2.  Dual Antioxidant DH-217 Mitigated Cerebral Ischemia-Reperfusion Injury by Targeting IKKβ/Nrf2/HO-1 Signal Axis.

Authors:  Mengya Shen; Yuantie Zheng; Ge Li; Yinqi Chen; Lili Huang; Jianzhang Wu; Chenlv Hong
Journal:  Neurochem Res       Date:  2022-10-15       Impact factor: 4.414

3.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

Review 4.  How Do Post-Translational Modifications Influence the Pathomechanistic Landscape of Huntington's Disease? A Comprehensive Review.

Authors:  Beata Lontay; Andrea Kiss; László Virág; Krisztina Tar
Journal:  Int J Mol Sci       Date:  2020-06-16       Impact factor: 5.923

5.  IKKβ signaling mediates metabolic changes in the hypothalamus of a Huntington disease mouse model.

Authors:  Rana Soylu-Kucharz; Ali Khoshnan; Åsa Petersén
Journal:  iScience       Date:  2022-01-19

Review 6.  Protein Kinase CK2 and Its Potential Role as a Therapeutic Target in Huntington's Disease.

Authors:  Angel White; Anna McGlone; Rocio Gomez-Pastor
Journal:  Biomedicines       Date:  2022-08-15

7.  Effects of mutant huntingtin inactivation on Huntington disease-related behaviours in the BACHD mouse model.

Authors:  Rachel Y Cheong; Barbara Baldo; Muhammad U Sajjad; Deniz Kirik; Åsa Petersén
Journal:  Neuropathol Appl Neurobiol       Date:  2021-01-12       Impact factor: 8.090

8.  NF-κB disinhibition contributes to dendrite defects in fly models of neurodegenerative diseases.

Authors:  Myeong Hoon Han; Min Jee Kwon; Byung Su Ko; Do Young Hyeon; Davin Lee; Hyung-Jun Kim; Daehee Hwang; Sung Bae Lee
Journal:  J Cell Biol       Date:  2020-12-07       Impact factor: 10.539

9.  TBK1 phosphorylates mutant Huntingtin and suppresses its aggregation and toxicity in Huntington's disease models.

Authors:  Ramanath Narayana Hegde; Anass Chiki; Lara Petricca; Paola Martufi; Nicolas Arbez; Laurent Mouchiroud; Johan Auwerx; Christian Landles; Gillian P Bates; Malvindar K Singh-Bains; Mike Dragunow; Maurice A Curtis; Richard Lm Faull; Christopher A Ross; Andrea Caricasole; Hilal A Lashuel
Journal:  EMBO J       Date:  2020-08-05       Impact factor: 11.598

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.