Literature DB >> 31071970

Half-Wave Potentials and In Vitro Cytotoxic Evaluation of 3-Acylated 2,5-Bis(phenylamino)-1,4-benzoquinones on Cancer Cells.

Julio Benites1,2, Jaime A Valderrama3,4, Maryan Ramos5, Maudy Valenzuela6, Angélica Guerrero-Castilla7, Giulio G Muccioli8, Pedro Buc Calderon9,10.   

Abstract

A broad range of 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinones were synthesized and their voltammetric values, as well as in vitro cancer cell cytotoxicities, were assessed. The members of this series were prepared from acylbenzoquinones and phenylamines, in moderate to good yields (47-74%), through a procedure involving a sequence of two in situ regioselective oxidative amination reactions. The cyclic voltammograms of the aminoquinones exhibit two one-electron reduction waves to the corresponding radical-anion and dianion, and two quasi-reversible oxidation peaks. The first and second half-wave potential values (E1/2) of the members of the series were sensitive to the push-pull electronic effects of the substituents around the benzoquinone nucleus. The in vitro cytotoxic activities of the 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinones against human cancer cells (bladder and prostate) and non-tumor human embryonic kidney cells were measured using the MTT colorimetric method. The substitution of both aniline groups, by either methoxy (electron donating effect) or fluorine (electron withdrawal effect), decreased the cytotoxicity in the aminoquinones. Among the members of the unsubstituted phenylamino series, two of the 18 compounds showed interesting anti-cancer activities. A preliminary assay, looking for changes in the expression of selected genes, was performed. In this context, the two compounds increased TNF gene expression, suggesting an association with an inflammatory-like response.

Entities:  

Keywords:  acylated 2,5-bis(phenylamino)-1,4-benzoquinones; cancer cells; cytotoxicity; half-wave potential; oxidative amination

Mesh:

Substances:

Year:  2019        PMID: 31071970      PMCID: PMC6539005          DOI: 10.3390/molecules24091780

Source DB:  PubMed          Journal:  Molecules        ISSN: 1420-3049            Impact factor:   4.411


1. Introduction

The molecular frameworks of diverse naturally-occurring cytotoxic compounds, such as smenospongine [1], streptonigrin [2], and mansouramicyn C [3], contain the aminoquinoid moiety as their key structural component (Figure 1). In the field of synthetic cytotoxic aminoquinones, those derived from 1,4-naphthoquinone [4,5,6,7,8] and their heterocyclic analogues [9,10,11,12,13,14,15,16,17] have received considerable attention. However, the synthesis and cytotoxic evaluation of aminobenzoquinones has hitherto received little attention and was mainly focused on the 2,5-bis(arylamino)-1,4-benzoquinone derivatives as compounds A and B. The earlier findings of Verter and Rogers [18] reported that specific 2,5-bis(alkylamino)-3,6-dimethoxy-1,4-benzoquinones, prepared from polyporic acid, increased the survival of L1210-bearing mice by 50%. In addition, Sarcoma 180 accumulated slower in treated Swiss albino mice than in control animals [19]. Further studies, described by Mathew et al. [20], on 2,5-bis(phenylamino)benzoquinone A and the corresponding chlorine analogue B, demonstrated a good in vitro inhibitory activity against human colon adenocarcinoma proliferation. Compound B was also found to be active against the leukemia L1210 screening in vitro.
Figure 1

Examples of natural and synthetic antitumor active aminoquinones.

It is worth noting that synthetic 2,5-bis(arylamino)-1,4-benzoquinones containing acyl and alkoxycarbonyl substituents at C-3 have been used as precursor of benz- and naphthoisoxazolequinones [21,22,23]. Some of the members of these heterocycle series exhibit in vitro activity as radiosensitizers and cytotoxic properties. Here, we wish to report the synthesis of a broad variety of 3-acyl-2,5-bis(arylamino)-1,4-benzoquinones, in order to give information on their redox properties and in vitro cytotoxic activity on cancer cells.

2. Results and Discussion

The members of the series of 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinones (Scheme 1) were prepared from 1,4-benzoquinone and a set of aldehydes and phenylamines. The acylhydroquinone precursors 1a–q were synthesized by the solar Friedel Crafts photoacylation of quinone 1 with aldehydes, according to our previously-reported procedure [24]. The preparation of 3-acyl-2,5-bis (phenylamino)-1,4-benzoquinones 2a–q was accomplished through a sequence involving: (a) Oxidation of the acylhydroquinones 1a–q, to the respective acylquinones, with silver (I) oxide (2.5 equiv.) in dichloromethane (DCM) and (b) oxidative amination of the 2-acylquinones resulting in (b) with phenylamines (2 equiv.) in ethanol under aerobic conditions. This procedure provides the substituted benzoquinones 2a–q in the yield range 47–74% (Table 1), and is a modification of the procedure, described by Shäfer and Aguado in [25], for the synthesis of compound 2a and some of their substituted phenylamino analogs.
Scheme 1

General access to 3-acyl-2,5-diphenylamino-1,4-benzoquinones 2a–q.

Table 1

Yield and half-wave potential (EI,II ½) values of compounds 2a–q.

Product NºR1R2R3R4Yield (%) aClogP−EI 1/2 (mV)−EII 1/2 (mV)
2a CH3HHH640.145651170
2b C3H7HHH561.215701150
2c C5H11HHH572.055701090
2d C7H15HHH592.88590910
2e 3,4-(OMe)2PhHHH551.695601140
2f 3,4,5-(OMe)3PhHHH581.575601120
2g Furan-2-ylHHH560.56570870
2h Thiophen-2-ylHHH601.935001030
2i PhMeOMeOMeO741.19800950
2j 4-MeOPhMeOMeOMeO571.06740950
2k 3-OMe-4-HOPhMeOMeOMeO630.676101010
2l Furan-2-ylMeOMeOMeO67−0.20790930
2m Thiophen-2-ylMeOMeOMeO641.178501010
2n PhHFH472.265601040
4-MeOPhHFH622.13710860
2o 3-MeO-4-HOPhHFH521.74550920
2p Furan-2-ylHFH490.88680950
2q Thiophen-2-ylHFH552.24730980

a The products were isolated by column chromatography. Yields are based on acylhydroquinones 1a–q.

The structures of compounds 2a–q were established by 1H- and 13C-nuclear magnetic resonance (NMR), bi-dimensional nuclear magnetic resonance (2D-NMR), and high resolution mass spectroscopy (HRMS). Heteronuclear multiple bond correlation (HMBC) experiments of the members of the series, as those of the representative congeners 2b and 2p (Figure 2), allowed us to establish the location of the substituents around the benzoquinone nuclei.
Figure 2

Heteronuclear multiple bond correlations (HMBCs) of compounds 2b and 2p.

It is worth mentioning that inspection of minimal energy conformation of compounds 2b and 2p, performed by MM2 calculation (ChemBio3D 11.0, PerkinElmer, MA, USA), shows a co-planar orientation between the benzoquinone nucleus and the phenylamino substituent at C-5 (Supplementary Materials). Furthermore, it was also observed that rotation of the substituents linked to the 2,3-quinone double bond are strongly hindered (Figure 3).
Figure 3

Optimized 3D-structure of compounds 2b and 2p.

The members of the 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinone series 2a–q were evaluated for their half-wave potentials (EI 1/2 and EII 1/2). They were measured by cyclic voltammetry in acetonitrile at room temperature, using a platinum electrode and 0.1 M tetraethylamoniumtetrafluoroborate as the supporting electrolyte [26]. The voltammograms were run in the potential range from 0.0 to −2.0 V versus non-aqueous Ag/Ag+. The cathodic peaks related to the reduction of quinone, and the anodic one due to its re-oxidation, were observed for the compounds as well-defined quasi-reversible waves. The EI 1/2 values for the first one-electron, which is related with the formation of the semiquinone radical anion, fell within the range of −850 to −500 mV. The EI 1/2 values for the second one-electron transfer, corresponding to the dianion formation [27,28], were located within the range of −1170 to −860 mV (Table 1). Taking into account the notable differences of the E1/2 values for each of the one-electron transfer processes, it is evident that they are due to the push-pull electronic effects of the substituents located in the 1,4-benzoquinone nucleus. Table 1, regarding the EI 1/2 and EII 1/2 values of the unsubstituted phenylamino members 2a–h, indicates that the nature of the acyl substituents mainly affects the second half-wave potential (ΔEII 1/2 = 300 mV) over the first one (ΔEII 1/2 = 90 mV). The effect of the insertion of methoxy substituents into the 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinone scaffold, as in compounds 2i–2m, was related to a significant cathodic shift of the EI 1/2 when compared to EII 1/2. This fact could be attributed to the donor effect of the 3,4,5-trimethoxyphenyl group, which is transmitted to the quinonoid nucleus through the amino group. The effects on redox properties and lipophilia by either electron-donating or electron-withdrawing groups in the 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinone scaffold (compounds 2i–2m versus 2n–2q) were also examined. Table 1 shows that the methoxy group (as in compounds 2i–2m) led to increased values of EI 1/2 (−610 to −850 mV) but reduced values of ClogP (−0.2 to 1.19). Conversely, the fluorine group (as in compounds 2n–2q) led to decreased values of EI 1/2 (−550 to −730 mV) but enhanced values of ClogP (0.88 to 2.26). As compared to previous series, it should be noted that the EI 1/2 values of the unsubstituted phenylamino members 2a–h ranged between −500 and −590 mV. The 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinones 2a–q were evaluated for their in vitro cytotoxic activities against normal human embryonic kidney cells (HEK-293 cells) and two human cancer cell lines (T24 and DU-145 cells) in 72 h drug exposure assays. The cytotoxic activities of the new compounds were measured using conventional microculture tetrazolium reduction assays [29]. The cytotoxic activities are expressed in terms of IC50. Doxorubicin, a clinically used anti-cancer agent, was taken as a positive control. The cytotoxic activity data are summarized in Table 2.
Table 2

IC50 ± SEM (μM) values of 2a–q on T24 (bladder), DU-145 (prostate), and HEK-293 kidney cells.

QuinoneT24DU-145Mean valueHEK-293
2a >10096.0 ± 7.998.0>100
2b >10092.2 ± 8.796.1>100
2c 16.3 ± 1.745.2 ± 4.530.7>100
2d 34.0 ± 3.723.5 ± 2.128.7>100
2e 58.2 ± 7.147.7 ± 4.252.9>100
2f 51.8 ± 6.220.4 ± 2.136.185.8 ± 0.9
2g 40.2 ± 4.039.9 ± 3.640.061.7 ± 4.2
2h 75.6 ± 9.180.9 ± 9.778.2>100
2i >10092.9 ± 1.496.4>100
2j 85.3 ± 1.972.4 ± 2.678.856.9 ± 5.2
2k >10045.9 ± 3.272.928.3 ± 1.5
2l 47.1 ± 2.023.0 ± 2.335.033.0 ± 4.8
2m 63.2 ± 0.648.6 ± 3.055.930.7 ± 3.1
2n 74.5 ± 2.2>10087.2>100
>100>100100.0>100
2o >100>100100.0>100
2p >10090.0 ± 6.495.072.8 ± 7.0
2q >100>100100>100
DOX0.46 ± 0.080.93 ± 0.060.694.27 ± 0.34

Cells were seeded into 96-well plates at a density of 10,000 cells/well for 24 h and then incubated for 48 h, with or without the quinone derivatives. At the end of the incubation, aliquots of cell suspensions were taken and the MTT test was performed, as described in the Materials and Methods section. Results are expressed as mean values ± SEM (μM) (n = 3). DOX = Doxorubicin.

Regarding the cytotoxicity of aminoquinones, it should be noted that the DU-145 cells were more sensitive than T24 and HEK-293 cells. When comparing the IC50 values calculated for the most active aminoquinones in both cancer cell lines, their activity ranged from 16.3 to 51.80 µM. Such values were at least one order of magnitude higher than that obtained with doxorubicin (0.43 and 0.93 µM in T24 and DU-145 cells, respectively). The unsubstituted phenylamino members 2a–2h were largely more active than the compounds 2i–2q, showing that the substitution of both aniline groups—by either methoxy (electron donating effect) or fluorine (electron withdrawal effect)—decreased the cytotoxicity of the aminoquinones. Among the series 2a–2h, the compounds 2c (IC50 values of 16.3 and 45.2 µM in T24 and DU-145 cells, respectively) and 2d (IC50 values of 34.0 and 23.5 µM in T24 and DU-145 cells, respectively) were the most active; displaying, in addition, a highly selective effect, as HEK-293 cells were affected only at doses higher than 100 µM. Moreover, within the same series, compounds 2f and 2g showed similar cytotoxic activities to previous compounds, but with a much lower selectivity. Outside this series, compound 2l was also active, but without any selectivity as it affected both HEK-293 and cancer cells. Thus, it may be concluded that, among all the tested aminoquinones, congeners 2c and 2d displayed the best cytotoxic activities, exhibiting high selectivity and lipophilicity values. Therefore, they represent lead-molecules for further investigations in exploring both intracellular targets as well as their molecular mechanism of action. In order to gain information about potential molecular targets, a preliminary assay for gene expression was conducted. To this end, some genes were selected, regarding their key role in cell survival, for instance mTOR, TP53, TNF, and so on. Table 3 shows the relative expression levels of the genes implicated in anti-cancer effects in T24 cells after treatment with 2c and 2d.
Table 3

Relative expression levels of genes implicated in anti-cancer effects in T24 cells after treatment with compounds 2c and 2d.

Gene NameGene SymbolRelative Expression Levels in T24 Cells (μM)
Vehicle2c2d
Apoptosis regulator (BCL2), transcript variant alpha BCL2 1.00 ± 0.051.28 ± 0.150.80 ± 0.04
Mechanistic target of rapamycin kinase mTOR 1.00 ± 0.040.99 ± 0.130.95 ± 0.02
Glutathione S-transferase pi 1 GSTP1 1.00 ± 0.060.90 ± 0.081.21 ± 0.04 *
Glutathione-disulfide reductase GSR 1.00 ± 0.050.96 ± 0.051.07 ± 0.04
Cell division cycle 25A CDC25A 1.00 ± 0.061.54 ± 0.13 ***1.07 ± 0.03
Tumor protein p53 TP53 1.00 ± 0.041.06 ± 0.111.01 ± 0.04
v-Ha-ras Harvey rat sarcoma viral oncogene homolog HRAS 1.00 ± 0.061.07 ± 0.131.33 ± 0.06 *
Histone deacetylase 3 HDAC3 1.00 ± 0.061.03 ± 0.151.02 ± 0.05
Histone deacetylase 4 HDAC4 1.00 ± 0.051.08 ± 0.131.01 ± 0.02
Tumor necrosis factor TNF 1.00 ± 0.032.04 ± 0.11 ***1.44 ± 0.10 **

Cells were treated with 2c and 2d for 48 h. Total RNA was extracted for qPCR. The mRNA expression levels were evaluated and further normalized to B2M level and the quantification performed according to the Delta–Delta Ct method (2−∆∆Ct method) with respect to the vehicle-treated group (reference group). The values represent the mean ± SEM, with n = 5 for each group. Significant differences, in comparison with the vehicle-treated group: * p < 0.05; ** p < 0.01; and *** p < 0.001.

Compound 2c (and, to a lesser extent, 2d) enhanced the expression of the TNF gene. Prior to drawing a definitive conclusion, such an increase in gene expression should be further confirmed by measuring its protein levels and activity. Nevertheless, it should be emphasized that a local increase in TNF concentration is not only associated with an inflammatory response, but also with an immunogenic response able to activate tumor-specific cytotoxic T lymphocytes, which can seek out and destroy tumor cells and reduce tumor lesions [30]. In this context, the compounds 2c and 2d display a potential application in cancer immunotherapy that deserves to be further investigated.

3. Materials and Methods

3.1. General Information

All the solvents and reagents were purchased from different companies, such as Aldrich (St. Louis, MO, USA) and Merck (Darmstadt, Germany), and were used as supplied. Melting points (mp) were determined on a Stuart Scientific SMP3 (Staffordshire, UK) apparatus and are un-corrected. The IR spectra were recorded on an FT IR Bruker spectrophotometer, model Vector 22 (Bruker, Rheinstetten, Germany), using KBr disks, and the wave numbers are given in cm−1. 1H- and 13C-NMR spectra were recorded on a Bruker Avance-400 instrument (Bruker, Ettlingen, Germany) in CDCl3 or DMSO-d6 at 400 and 100 MHz, respectively. Chemical shifts are expressed in ppm downfield relative to tetramethylsilane, and the coupling constants (J) are reported in Hertz. Data for the 1H-NMR spectra are reported as follows: s = singlet, br s = broad singlet, d = doublet, m = multiplet, and the coupling constants (J) are in Hz. Bi-dimensional NMR techniques and distortion-less enhancement by polarisation transfer (DEPT) were used for the signal assignment. Chemical shifts are expressed in ppm downfield relative to tetramethylsilane, and the coupling constants (J) are reported in Hertz. The HRMS data for all final compounds were obtained using a LTQ-Orbitrap mass spectrometer (Thermo-Fisher Scientific, Waltham, MA, USA) with the analysis performed using an atmospheric-pressure chemical ionization (APCI) source, operated in positive mode. Silica gel Merck 60 (70–230 mesh, from Merck) was used for preparative column chromatography and thin layer chromatography (TLC) aluminum foil 60F254 was used for analytical thin layer chromatography. The acylbenzohydroquinones (1a–q) were prepared according to a previously-reported procedure [24].

3.2. Chemistry

Preparation of 3-Acyl-2,5-bis(phenylamino)-1,4-benzoquinones 2a–q, General Procedure.

Suspensions of the acylhydroquinones 1a–q (1 equiv.), Ag2O (2.0 equiv.) and MgSO4 anhydrous (300 mg) in dichloromethane (30 mL) were left with stirring for 30 min at room temperature (rt). The mixtures were filtered, the solids were washed with dichloromethane (3 × 25 mL), and the filtrates were evaporated under reduced pressure. The residues were dissolved in ethanol, the phenylamines (2 equiv.) were added to the solutions, and the mixtures were left with stirring at rt for 24 h. The solvents were removed under reduced pressure and the residues were column-chromatographed over silica gel (petroleum ether/EtOAc) to yield the corresponding pure 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinones 2a–q. 3-Acetyl-2,5-bis(phenylamino)-1,4-benzoquinone2a (64%); red solid; mp: 200–201 °C. 1H-NMR (DMSO-d6): δ 2.30 (s, 1H, Me), 5.80 (s, 1H, quinone), 7.22 (m, 4H, arom.), 7.36 (m, 4H, arom.), 7.45 (dd, 2H, J = 7.5, 7.7 Hz, arom.), 9.55 (s, 1H, 5-NHPh), 11.31 (br s, 1H, 2-NHPh). 13C-NMR (DMSO-d6): δ 31.9, 96.4, 109.1, 123.9 (3C), 124.2 (2C), 125.8, 126.2, 128.7 (2C), 129.3 (2C), 137.6, 139.2, 147.6, 178.3, 178.5, 199.3. HRMS (APCI): [M + H]+ calcd. for C20H16N2O3: 332.11609; found 332.11359. 3-Butiryl-2,5-bis(phenylamino)-1,4-benzoquinone2b (56%); red solid; mp: 115–116 °C. 1H-NMR (DMSO-d6): δ 0.78 (t, 3H, J = 7.4 Hz, -CH2-CH2-CH), 1.23 (m, 2H, -CH2-CH-CH3), 2.63 (t, 2H, J = 7.4 Hz, -CH-CH2-CH3), 5.81 (s, 1H, quinone), 7.15 (d, 2H, J = 7.4 Hz, H-arom.), 7.20 (t, 1H, J = 7.4 Hz, H-arom.), 7.25 (t, 1H, J = 7.3 Hz, H-arom.), 7.32 (t, 2H, J = 7.8 Hz, H-arom.), 7.38 (d, 2H, J = 7.4 Hz, H-arom.), 7.45 (t, 2H, J = 7.8 Hz, H-arom.), 9.51 (s, 1H, 5-NHPh), 10.85 (br s, 1H, 2-NHPh). 13C-NMR (DMSO-d6): δ 13.7, 16.6, 45.6, 96.0, 109.2, 123.9 (2C), 124.4 (2C), 125.8, 126.2, 128.7 (2C), 129.3 (3C), 137.6, 139.0, 147.5, 178.2, 178.8, 201.6. HRMS (APCI): [M + H]+ calcd. for C22H20N2O3: 360.14739; found 360.15469. 3-Hexanoyl-2,5-bis(phenylamino)-1,4-benzoquinone2c (57%); brown solid; mp: 140–141 °C. 1H-NMR (DMSO-d6): δ 0.83 (t, 3H, J = 7.1 Hz, -CH2-CH2-CH2-CH2-CH), 1.17 (m, 6H, -CH2-CH-CH3), 2.63 (t, 2H, J = 7.0 Hz, -CH-CH2-CH2-CH2-CH3), 5.80 (s, 1H, quinone), 7.14 (d, 2H, J = 7.4 Hz, H-arom.), 7.20 (t, 1H, J = 7.4 Hz, H-arom.), 7.25 (t, 1H, J = 7.3 Hz, H-arom.), 7.32 (t, 2H, J = 7.7 Hz, H-arom.), 7.38 (d, 2H, J = 7.4 Hz, H-arom.), 7.45 (t, 2H, J = 7.8 Hz, H-arom.), 9.51 (s, 1H, 5-NHPh), 10.79 (br s, 1H, 2-NHPh). 13C-NMR (DMSO-d6): δ 13.8, 22.0, 22.8, 30.8, 43.5, 95.9, 109.3, 123.9 (2C), 124.4 (2C), 125.8, 126.2, 128.8 (2C), 129.3 (3C), 137.6, 139.0, 147.5, 178.2, 178.8, 201.6. HRMS (APCI): [M + H]+ calcd. for C24H24N2O3: 388.17869; found 388.18599. 3-Octanoyl-2,5-bis(phenylamino)-1,4-benzoquinone2d (59%); brown solid; mp: 91–92 °C. 1H-NMR (DMSO-d6): δ 0.86 (t, 3H, J = 7.0 Hz, -(CH2)6C3, 1.23 (m, 10H, -CH2-(C2)5CH3), 2.63 (t, 2H, J = 6.5 Hz, -C2(CH2)5CH3), 5.81 (s, 1H, quinone), 7.14 (d, 2H, J = 7.5 Hz, H-arom.), 7.19 (t, 1H, J = 7.4 Hz, H-arom.), 7.25 (t, 1H, J = 7.2 Hz, H-arom.), 7.32 (t, 2H, J = 7.7 Hz, H-arom.), 7.38 (d, 2H, J = 7.4 Hz, H-arom.), 7.45 (t, 2H, J = 7.8 Hz, H-arom.), 9.51 (s, 1H, 5-NHPh), 10.81 (br s, 1H, 2-NHPh). 13C-NMR (DMSO-d6): δ 13.9, 22.0, 23.1, 28.5, 28.6, 31.1, 43.6, 95.9, 109.3, 123.8 (2C), 124.4 (2C), 125.8, 126.1, 128.7 (2C), 129.3 (3C), 137.6, 139.0, 147.5, 178.2, 178.8, 201.6. HRMS (APCI): [M + H]+ calcd. for C26H28N2O3: 416.20999; found 416.21710. 3-(3,4-Dimethoxybenzoyl)-2,5-bis(phenylamino)-1,4-benzoquinone2e (55%); gray solid; mp: 230.5–231.5 °C. 1H-NMR (DMSO-d6): δ 3.67 (s, 3H, OMe), 3.82 (s, 3H, OMe), 5.91 (s, 1H, quinone), 6.81 (t, 3H, J = 7.6 Hz, H-arom.), 6.94 (m, 4H, H-arom.), 7.26 (t, 2H, J = 7.2 Hz, H-arom.), 7.41 (d, 2H, J = 7.7 Hz, H-arom.), 7.46 (t, 2H, J = 7.4 Hz, H-arom.), 9.42 (s, 1H, 5-NHPh), 9.54 (br s, 1H, 2-NHPh). 13C-NMR (DMSO-d6): δ 55.3, 55.7, 95.3, 107.7, 109.9, 110.3, 123.8 (2C), 124.0, 125.7 (2C), 125.7, 126.0, 128.0 (2C), 129.3 (3C), 130.9, 137.7, 146.0, 147.3, 148.3, 152.8, 178.4, 179.3, 191.5. HRMS (APCI): [M + H]+ calcd. for C27H22N2O5: 454.15287; found 454.15964. 3-(3,4,5-Trimethoxybenzoyl)-2,5-bis(phenylamino)-1,4-benzoquinone2f (58%); brown solid; mp: 216.5–217.5 °C. 1H-NMR (CDCl3): δ 3.80 (s, 6H, OMe), 3.89 (s, 3H, OMe), 6.19 (s, 1H, quinone), 6.74 (s, 2H, H-arom.), 6.82 (m, 2H, H-arom.), 7.06 (m, 3H, H-arom.), 7.28 (m, 3H, H-arom.), 7.44 (t, 2H, J = 7.8 Hz, H-arom.), 8.23 (s, 1H, 5-NHPh), 8.48 (br s, 1H, 2-NHPh). 13C-NMR (CDCl3): δ 56.4 (2C), 61.0, 106.5 (2C), 123.1 (3C), 125.7 (2C), 126.6, 127.1, 129.0 (2C), 129.9 (3C), 133.1, 136.7, 136.9, 142.8, 146.0, 146.7, 152.9 (2C), 178.3, 179.3, 191.8. HRMS (APCI): [M + H]+ calcd. for C28H24N2O6: 484.16344; found 484.16364. 3-(Furan-2-carbonyl)-2,5-bis(phenylamino)-1,4-benzoquinone2g (56%); brown solid; mp: 141.5–142.5 °C. 1H-NMR (DMSO-d6): δ 5.89 (s, 1H, quinone), 6.88 (d, 2H, J = 7.4 Hz, H-arom.), 7.01 (m, 3H, H- arom), 7.09 (t, 1H, J = 4.3 Hz, H-arom.), 7.26 (t, 1H, J = 7.1 Hz, H-arom.), 7.41 (d, 2H, J = 7.7 Hz, H-arom.), 7.46 (t, 2H, J = 7.7 Hz, H-arom.), 7.58 (d, 1H, J= 3.5 Hz, H-arom.), 7.84 (d, 1H, J = 4.7 Hz, H-arom.), 9.45 (s, 1H, 5-NHPh), 9.65 (br s, 1H, 2-NHPh). 13C-NMR (DMSO-d6): δ 95.3, 107.7, 123.9 (2C), 125.6 (2C), 125.8, 126.2, 127.9, 128.0 (2C), 129.3 (2C), 133.9, 134.8, 137.5, 137.6, 145.2, 146.0, 147.4, 178.1, 179.0, 184.8. HRMS (APCI): [M + H]+ calcd. for C23H16N2O4: 384.11101; found 384.11164. 3-(Thiophen-2-carbonyl)-2,5-bis(phenylamino)-1,4-benzoquinone2h (60%); brown solid; mp: 245–246 °C. 1H-NMR (DMSO-d6): δ 5.88 (s, 1H, quinone), 6.57 (d, 1H, J = 3.3 Hz, H-arom.), 6.90 (m, 2H, H- arom), 7.00 (d, 1H, J = 3.2 Hz, H-arom.), 7.04 (d, 3H, J = 5.1 Hz, H-arom.), 7.26 (t, 1H, J = 7.1 Hz, H-arom.), 7.40 (d, 2H, J = 7.9 Hz, H-arom.), 7.46 (t, 2H, J = 7.5 Hz, H-arom.), 7.81 (s, 1H, H-arom.), 9.46 (s, 1H, 5-NHPh), 9.68 (br s, 1H, 2-NHPh). 13C-NMR (DMSO-d6): δ 95.3, 107.2, 112.5, 118.2, 123.9 (2C), 125.2 (2C), 125.8, 126.3, 128.1 (2C), 129.3 (2C), 137.6, 137.7, 146.2, 146.8, 147.4, 153.1, 178.1, 179.0, 180.0. HRMS (APCI): [M + H]+ calcd. for C23H16N2O3S: 400.08816; found 400.09555. 3-Benzoyl-2,5-bis-[(3,4,5-trimethoxyphenyl)amino]-1,4-benzoquinone2i (74%); brown solid; mp: 224–225 °C. 1H-NMR (CDCl3) δ: 3.54 (s, 3H, OMe), 3.76 (s, 3H, OMe), 3.80 (s, 3H, OMe), δ: 3.87 (s, 9H, 3 × OMe), 5.97 (s, 2H, H-arom.) 6.14 (s, 1H, quinone), 6.49 (s, 2H, H-arom.), 7.31 (m, 1H, H-arom.), 7.45 (m, 1H, H-arom.), 7.56 (d, 2H, J = 7.3 Hz, H-arom.), 8.16 (s, 1H, 5-NHPh), 8.42 (br s, 1H, 2-NHPh). 13C-NMR (CDCl3) δ: 55.8 (2C), 56.4 (2C), 60.9, 61.1, 95.9, 101.0 (2C), 102.9 (2C), 107.0, 128.4 (2C), 128.8 (2C), 132.3, 132.5, 133.0, 136.7, 136.9, 137.6, 145.9, 147.0, 153.2 (2C), 154.1 (2C), 178.2, 179.0, 192.9. HRMS (APCI): [M + H]+ calcd. for C31H30N2O9: 574.19513; found 574.20187. 3-(4-Methoxybenzoyl)-2,5-bis-[(3,4,5-trimethoxyphenyl)amino]-1,4-benzoquinone2j (57%); red solid; mp: 190–191 °C. 1H-NMR (CDCl3) δ: 3.57 (s, 6H, 2 × OMe), 3.77 (s, 3H, OMe), 3.82 (s, 3H, OMe), 3.87 (s, 9H, 3 × OMe), 5.99 (s, 2H, H-arom.), 6.11 (s, 1H, quinone), 6.49 (s, 2H, H-arom.), 6.77 (d, 2H, J = 8.8 Hz, H-arom.), 7.53 (d, 2H, J = 8.8 Hz, H-arom.), 8.16 (s, 1H, 5-NHPh), 8.37 (br s, 1H, 2-NHPh). 13C-NMR (CDCl3) δ: 55.6, 55.8 (2C), 56.4 (2C), 60.8, 61.1, 95.8, 101.0 (2C), 102.9 (2C), 107.3, 113.5 (2C), 131.0, 131.2 (2C), 132.4, 132.6, 136.7, 136.8, 145.6, 147.0, 153.0 (2C), 154.0 (2C), 163.5, 178.2, 179.2, 191.3. HRMS (APCI): [M + H]+ calcd. for C32H32N2O10: 604.20570; found 604.21238. 3-(4-Hydroxy-3-methoxybenzoyl)-2,5-bis-[(3,4,5-trimethoxyphenyl)amino]-1,4-benzoquinone2k (63%); brown solid; mp: 152–152 °C. IR (KBr) νmax cm–1: 3246 (N-H), 3245 (N-H), 1662 (C=O), 1649 (C=O), 1636 (C=O). 1H-NMR (CDCl3) δ: 3.61 (s, 6H, 2 × OMe), 3.75(s, 3H, OMe), 3.85(s, 3H, OMe), 3.88(s, 3H, OMe), 3.89 (s, 6H, 2 × OMe), 5.99 (s, 2H, H-arom.), 6.13 (s, 2H, quinone + OH), 6.50 (s, 2H, H-arom.), 6.81 (d, 1H, J = 8.2 Hz, H-arom.), 6.95 (d, 1H, J = 1.8 Hz, arom), 7.25 (dd, 1H, J = 8.2, 1.9 Hz, arom), 8.15 (s, 1H, 5-NHPh), 8.34 (br s, 1H, 2-NHPh). 13C-NMR (CDCl3) δ: 55.9 (2C), 56.2, 56.5 (2C), 61.0, 61.2, 95.8, 101.0 (2C), 103.1 (2C), 107.3, 109.3, 113.2, 125.2, 131.0, 132.4, 132.6, 136.7, 145.7, 146.8, 147.1, 150.6 (2C), 153.1 (2C), 154.1 (2C), 178.2, 179.2, 191.6. HRMS (APCI): [M + H]+ calcd. for C32H32N2O11: 620.20061; found 620.20726. 3-(Furan-2-carbonyl)-2,5-bis-[(3,4,5-trimethoxyphenyl)amino]-1,4-benzoquinone2l (67%); red solid; mp: 202–203 °C. 1H-NMR (CDCl3) δ: 3.66 (s, 6H, 2 × OMe), 3.78(s, 3H, OMe), 3.87 (s, 3H, OMe), 3.88 (s, 6H, 2xOMe), 6.12 (s, 1H, quinone), 6.17 (s, 2H, H-arom.), 6.44 (dd, 1H, J = 3.6, 1.6 Hz, H-arom.), 6.49 (s, 2H, H-arom.), 6.88 (dd, 1H, J = 3.6, 0.8 Hz, H-arom.), 7.47 (d, 1H, J = 1.6, 0.8 Hz, H-arom.), 8.11 (s, 1H, 5-NHPh), 8.47 (s, 1H, 2-NHPh). 13C-NMR (CDCl3) δ: 56.0 (2C), 56.4 (2C), 61.0, 61.1, 96.0, 100.9 (2C), 102.2 (2C), 106.7, 112.9, 117.4, 132.4, 132.5, 136.7, 137.1, 145.7, 146.1, 147.1, 153.4 (2C), 153.5, 154.1 (2C), 177.8, 178.9, 180.2. HRMS (APCI): [M + H]+ calcd. for C29H28N2O10: 564.17440; found 564.18120. 3-(Thiophen-2-carbonyl)-2,5-bis-[(3,4,5-trimethoxyphenyl)amino]-1,4-benzoquinone2m (64%); red solid; mp: 174.5–175.5 °C. 1H-NMR (CDCl3) δ: 3.62 (s, 6H, 2 × OMe), 3.79 (s, 3H, OMe), 3.87 (s, 3H, OMe), 3.88 (s, 6H, 2 × OMe), 6.09 (s, 2H, H-arom.), 6.12 (s, 1H, quinone), 6.49(s, 2H, H-arom.), 7.0 (dd, 1H, J = 4.9, 3.8 Hz, H-arom.), 7.43 (dd, 1H, J = 3.8, 1.2 Hz, H-arom.), 7.55 (dd, 1H, J = 4.9, 1.2 Hz, H-arom.), 8.15 (s, 1H, 5-NHPh), 8.44 (s, 1H, 2-NHPh). 13C-NMR (CDCl3) δ: 56.0 (2C), 56.4 (2C), 61.0, 61.2, 95.9, 101.0 (2C), 103.0 (2C), 107.5, 127.6, 132.2, 132.5, 133.2, 134.6, 136.7, 137.1, 145.6, 145.7, 147.0, 153.3 (2C), 154.1 (2C), 177.8, 178.9, 184.5. HRMS (APCI): [M + H]+ calcd. for C29H28N2O9S: 580.15155; found 580.15880. 3-Benzoyl-2,5-bis-[(4-fluorophenyl)amino]-1,4-benzoquinone2n (47%); brown solid; mp: 250–251 °C. 1H-NMR (CDCl3) δ: 6.02 (s, 1H, quinone), 6.68 (t, 2H, J = 8.5 Hz, H-arom.), 6.79 (dd, 2H, J = 8.7, 4.8 Hz, H-arom.), 7.14 (m, 2H, H-arom.), 7.24 (m, 2H, H-arom.), 7.33 (t, 2H, J = 7.6 Hz, H-arom.), 7.48 (t, 1H, J = 7.4 Hz, H-arom.), 7.54 (d, 1H, J = 1.4 Hz, H-arom.), 7.57 (m, 1H, H-arom.), 8.06 (s, 1H, 5-NHPh), 8.41 (br s, 1H, 2-NHPh). 13C-NMR (CDCl3) δ: 95.7, 107.5, 115.8, 116.1, 116.7 (2C), 117.1, 125.3, 125.4, 127.7, 127.8, 128.5 (2C), 128.8 (2C), 132.6, 132.7, 132.8, 132.9, 133.4, 137.6, 147.1, 178.4, 179.2, 193.1. HRMS (APCI): [M + H]+ calcd. for C25H16F2N2O3: 430.11290; found 430.11942. 3-(4-Methoxybenzoyl)-2,5-bis-[(4-fluorophenyl)amino]-1,4-benzoquinone2ñ (62%); brown solid; mp: 239–240 °C. 1H-NMR (CDCl3) δ: 3.86 (s, 3H, OMe), 6.00 (s, 1H, quinone), 6.70 (t, 2H, J = 8.5 Hz, H-arom.), 6.81 (dd, 4H, J = 8.8, 4.0 Hz, H-arom.), 7.13 (t, 2H, J = 8.5 Hz, H-arom.), 7.23 (m, 2H, H-arom.), 7.53 (d, 2H, J = 8.9 Hz, H-arom.), 8.09 (s, 1H, 5-NHPh), 8.33 (br s, 1H, 2-NHPh). 13C-RMN (CDCl3) δ: 55.5, 95.5, 107.7, 113.5 (3C), 115.5, 116.6, 116.9, 125.2, 125.3, 127.6, 127.7, 130.8, 131.2 (2C), 132.4, 132.5, 132.7, 132.7, 145.8, 147.0, 163.7, 178.3, 179.2, 191.4. HRMS (APCI): [M + H]+ calcd. for C26H18F2N2O4: 460.12346; found 460.13003. 3-(4-Hydroxy-3-methoxybenzoyl)-2,5-bis-[(4-fluorophenyl)amino]-1,4-benzoquinone2o (52%); brown solid; mp: 221–222 °C. 1H-NMR (CDCl3) δ: 3.85 (s, 3H, OMe), 6.01 (s, 1H, OH), 6.11 (s, 1H, quinone), 6.79 (m, 5H, H-arom.), 6.95 (m, 1H, H-arom.), 7.15 (m, 2H, H-arom.), 7.26 (m, 4H, H-arom.), 8.09 (s, 1H, 5-NHPh), 8.28 (s, 1H, 2-NHPh). 13C-NMR (CDCl3) δ: 56.1, 95.6, 107.8, 109.3, 113.6, 115.6, 115.9, 116.7, 117.0, 125.3, 125.4, 125.5, 128.1, 128.2, 130.9, 132.5, 132.6, 132.7, 132.8, 145.9, 146.8, 147.1, 150.8, 178.4, 179.3, 191.6. HRMS (APCI): [M + H]+ calcd. for C26H18F2N2O5: 476.11838; found 476.12468. 3-(Furan-2-carbonyl)-2,5-bis-[(4-fluorophenyl)amino]-1,4-benzoquinone2p (49%); brown solid; mp: 271.5–272.5 °C. 1H-NMR (DMSO-d6) δ: 5.78(s, 1H, quinone), 6.59 (m, 1H, arom.), 6.90 (m, 4H, H-arom.), 7.05 (d, 1H, J = 3.4 Hz, H-arom.), 7.30 (t, 2H, J = 8.8 Hz, H-arom.), 7.43 (dd, 4H, J = 9.0, 5.0 Hz, H-arom.), 7.85 (m, 1H, H-arom.), 9.50(s, 1H, 5-NHPh), 9.67 (s, 1H, 2-NHPh). 13C-NMR (DMSO-d6) δ: 95.1, 107.2, 112.6, 114.5, 115.0, 116.0, 116.3, 129.2, 126.3 (2C), 127.7, 127.9, 133.9 (2C), 134.0, 134.1, 146.6, 147.1, 147.7, 153.0, 178.1, 178.9, 180.1. HRMS (APCI): [M + H]+ calcd. for C23H14F2N2O4: 420.09216; found 420.09920. 3-(Thiophen-2-carbonyl)-2,5-bis-[(4-fluorophenyl)amino]-1,4-benzoquinone2q (55%); brown solid; mp: 278–279 °C. 1H-NMR (CDCl3) δ: 5.78(s, 1H, quinone), 6.86 (m, 4H, H-arom.), 7.10 (s, 1H, H-arom.), 7.36 (m, 4H, H-arom.), 7.60 (s, 1H, H-arom.), 7.89 (s, 1H, H-arom.), 9.48 (s, 1H, 5-NHPh), 9.63 (s, 1H, 2-NHPh). 13C-NMR (CDCl3) δ: 95.1, 107.7, 114.7, 115.0, 116.0, 116.3, 126.2, 126.3, 128.1 (2C), 128.2, 133.7, 133.8, 133.9, 134.0, 134.3, 135.2, 145.1, 146.3, 147.7, 178.1, 178.9, 185.0. HRMS (APCI): [M + H]+ calcd. for C23H14F2N2O3S: 436.06932; found 436.07638.

3.3. Biological Assays

3.3.1. Cell Lines and Cell Cultures

Human cancer cell lines T24 (bladder) and DU-145 (prostate), and non-tumor HEK-293 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cultures were maintained at a density of 1× 105 cells/mL and the medium was changed at 48- to 72-h intervals. They were cultured in high-glucose Dulbecco’s modified Eagle medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal calf serum, penicillin (100 U/mL), and streptomycin (100 μg/mL). All cultures were kept at 37 °C in 95% air/5% CO2 at 100% humidity. Phosphate-buffered saline (PBS) was purchased from Gibco. Cells were incubated at the indicated times at 37 °C, with or without quinones at various concentrations.

3.3.2. Cytotoxic Assays

The cytotoxicity of the quinones was assessed by following the reduction of MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) to formazan blue [31]. Cells were seeded into 96-well plates at a density of 10,000 cells/well for 24 h and then incubated for 48 h, with or without the quinone derivatives. Doxorubicin was used as the standard chemotherapeutic agent (positive control). Cells were then washed twice with warm PBS and incubated with MTT (0.5 mg/mL) for 2 hours at 37 °C. Blue formazan crystals were solubilized by adding 100 µL DMSO/well, and the optical density of the coloured solutions was subsequently read at 550 nm. Results are expressed as percentage of MTT reduction, compared to untreated control conditions. The IC50 values were calculated using the GraphPad Prism software (San Diego, CA, USA).

3.3.3. Quantitative real-time PCR (qPCR) Assay

The T24 cells were cultured as previously mentioned. They were seeded into 6-well plates (2 × 105 cells/well) and, after 24 h of incubation, they were treated for 48 h with 2c and 2d (at 32 and 68 µM, respectively). Afterwards, they were washed with phosphate-buffered saline. The cellular lysate was prepared with E.Z.N.A.® RNA-Lock Reagent (Omega Bio-tek, Norcross, GA, USA) to preserve and immediately stabilize the total RNA for the subsequent gene expression assays. The total RNA isolated from the cells using the E.Z.N.A.® HP Total RNA Isolation Kit (Omega Bio-tek) was reverse-transcribed to cDNA using the AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA) and 1000 ng of the RNA sample. The cDNA synthesized was employed for qPCR using Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies) in a Mx3000P qPCR System (Agilent Technologies), employing a 96-well plate with 20 μL of PCR reaction per well and 10 pmol each of forward and reverse gene-specific primers. Ten genes were analyzed (see Table 4). The relative gene expressions were determined using Beta-2-microglobulin (B2M) as housekeeping, and the delta-delta Ct method (2−ΔΔCt method) with regard to the vehicle-treated group (i.e., the reference group). Five biological replicates were used from each group (treated and reference group). The qPCR reactions were run by duplicates and negative controls contained no cDNA, as previously reported [32,33]. The GraphPad Prism software was used for statistical analyses of the relative gene expressions. The comparisons between means were performed using one-way analysis of variance (ANOVA) and Dunnett’s multiple comparisons test. All statistical analyses were performed with a significance level of p < 0.05.
Table 4

Quantitative real-time (qPCR) Primer Sequences.

Gene NameGene SymbolEntrez Gene IDForward (5′ → 3′)Reverse (5′ → 3′)Amplicon Size (pb)
Apoptosis
Apoptosis regulator (BCL2), transcript variant alpha BCL2 NM_000633.2ATGTGTGTGGAGAGCGTCAAGAGACAGCCAGGAGAAATCAA181
PI3 Kinases & Phosphatases
Mechanistic target of rapamycin kinase mTOR NM_004958.3TCCGAGAGATGAGTCAAGAGGCACCTTCCACTCCTATGAGGC141
Drug Metabolism/Oxidative Stress
Glutathione S-transferase pi 1 GSTP1 NM_000852.3 CATCTACACCAACTATGAGGCGAGCAGGGTCTCAAAAGGCTTC81
Glutathione-disulfide reductase GSR NM_000637.4CACTTGCGTGAATGTTGGATGTGGGATCACTCGTGAAGGCT242
Cell Cycle
Cell division cycle 25A CDC25A NM_001789.2TGGGCCATTGGACAGTAAAGTCCCAACAGCTTCTGAGGTA76
Tumor protein p53 TP53 NM_000546.5ACAGCTTTGAGGTGCGTGTTTCCCTTTCTTGCGGAGATTCTCT77
Ras Signaling
V-Ha-Ras Harvey rat sarcoma viral oncogene homolog HRAS NM_005343GACGTGCCTGTTGGACATCCTTCACCCGTTTGATCTGCTC166
Histone Deacetylases
Histone deacetylase 3 HDAC3 NM_003883.3TCTGGCTTCTGCTATGTCAACGCCCGGTCAGTGAGGTAGAAAG136
Histone deacetylase 4 HDAC4 NM_006037.3AGCGTCCGTTGGATGTCACCCTTCTCGTGCCACAAGTCT169
Inflammation
Tumor necrosis factor TNF NM_000594.3 AGAACTCACTGGGGCCTACAGCTCCGTGTCTCAAGGAAGT177
Housekeeping
Beta-2-microglobulin B2M NM_004048.2ATGAGTATGCCTGCCGTGTGAGGCATCTTCAAACCTCCATG97

4. Conclusions

In summary, we have synthesized of a number 3-acyl-2,5-bis(phenylamino)-1,4-benzoquinones and assessed their voltammetric values and cytotoxicities of cancer cells in vitro. The members of the series 2a–q were prepared from acylbenzoquinones and phenylamines, in moderate to good yields (47–74%). The first and second half-wave potential values (E 1/2) of the members of the series were sensitive to the push-pull electronic effects of the substituents around the benzoquinone nucleus, as shown by the cyclic voltammograms of the aminoquinones. The preliminary results of the biological evaluation of the compounds 2a–q showed interesting in vitro cytotoxic activity on cancer cells. In this context, there were two more active compounds which increased TNF gene expression, suggesting an association with an inflammatory-like response.
  26 in total

1.  Induction of the Cdk inhibitor p21 by LY83583 inhibits tumor cell proliferation in a p53-independent manner.

Authors:  Dimitri Lodygin; Antje Menssen; Heiko Hermeking
Journal:  J Clin Invest       Date:  2002-12       Impact factor: 14.808

2.  Antileukaemic activity of polyporic acid.

Authors:  J F BURTON; B F CAIN
Journal:  Nature       Date:  1959-10-24       Impact factor: 49.962

3.  Synthesis and cytotoxicity of new heterocyclic terpenylnaphthoquinones.

Authors:  José M Miguel del Corral; Maria Angeles Castro; Marina Gordaliza; Maria Luz Martín; Ana Maria Gamito; Carmen Cuevas; Arturo San Feliciano
Journal:  Bioorg Med Chem       Date:  2006-01-11       Impact factor: 3.641

4.  Effects of 6-arylamino-5,8-quinolinediones and 6-chloro-7-arylamino-5,8-isoquinolinediones on NAD(P)H: quinone oxidoreductase (NQO1) activity and their cytotoxic potential.

Authors:  C K Ryu; H J Jeong; S K Lee; H J You; K U Choi; J Y Shim; Y H Heo; C O Lee
Journal:  Arch Pharm Res       Date:  2001-10       Impact factor: 4.946

5.  An Experimental and Theoretical Study of the Substituent Effects on the Redox Properties of 2-[(R-phenyl)amine]-1,4-naphthalenediones in Acetonitrile.

Authors:  M. Aguilar-Martínez; G. Cuevas; M. Jiménez-Estrada; I. González; B. Lotina-Hennsen; N. Macías-Ruvalcaba
Journal:  J Org Chem       Date:  1999-05-14       Impact factor: 4.354

6.  Synthesis of novel aminoquinonoid analogues of diospyrin and evaluation of their inhibitory activity against murine and human cancer cells.

Authors:  Madhushree Das Sarma; Rina Ghosh; Amarendra Patra; Banasri Hazra
Journal:  Eur J Med Chem       Date:  2007-12-08       Impact factor: 6.514

7.  Synthesis and evaluation of a series of 3,5-disubstituted benzisoxazole-4,7-diones. Potent radiosensitizers in vitro.

Authors:  M J Suto; M A Stier; R T Winters; W R Turner; C D Pinter; W E Elliott; J S Sebolt-Leopold
Journal:  J Med Chem       Date:  1991-11       Impact factor: 7.446

8.  Mansouramycins A-D, cytotoxic isoquinolinequinones from a marine streptomycete.

Authors:  Usama W Hawas; Mohamed Shaaban; Khaled A Shaaban; Michael Speitling; Armin Maier; Gerhard Kelter; Heinz H Fiebig; Marinus Meiners; Elisabeth Helmke; Hartmut Laatsch
Journal:  J Nat Prod       Date:  2009-12       Impact factor: 4.050

9.  Studies on quinones. Part 45: novel 7-aminoisoquinoline-5,8-quinone derivatives with antitumor properties on cancer cell lines.

Authors:  Jaime A Valderrama; J Andrea Ibacache; Verónica Arancibia; Jaime Rodriguez; Cristina Theoduloz
Journal:  Bioorg Med Chem       Date:  2009-02-14       Impact factor: 3.641

10.  7-Chloro-6-piperidin-1-yl-quinoline-5,8-dione (PT-262), a novel synthetic compound induces lung carcinoma cell death associated with inhibiting ERK and CDC2 phosphorylation via a p53-independent pathway.

Authors:  Tzu-Sheng Hsu; Chinpiao Chen; Pei-Ting Lee; Shu-Jun Chiu; Huei-Fang Liu; Chih-Chien Tsai; Jui-I Chao
Journal:  Cancer Chemother Pharmacol       Date:  2008-01-10       Impact factor: 3.333

View more
  1 in total

1.  Green Synthesis and Electrochemical Properties of Mono- and Dimers Derived from Phenylaminoisoquinolinequinones.

Authors:  Juana Andrea Ibacache; Jaime A Valderrama; Judith Faúndes; Alex Danimann; Francisco J Recio; César A Zúñiga
Journal:  Molecules       Date:  2019-11-30       Impact factor: 4.411

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.