Literature DB >> 31056393

A Memory Circuit for Coping with Impending Adversity.

Yifat Eliezer1, Noa Deshe1, Lihi Hoch1, Shachar Iwanir1, Christian O Pritz1, Alon Zaslaver2.   

Abstract

Organisms' capacity to anticipate future conditions is key for survival. Associative memories are instrumental for learning from past experiences, yet little is known about the processes that follow memory retrieval and their potential advantage in preparing for impending developments. Here, using C. elegans nematodes, we demonstrate that odor-evoked retrieval of aversive memories induces rapid and protective stress responses, which increase animal survival prospects when facing imminent adversities. The underlying mechanism relies on two sensory neurons: one is necessary during the learning period, and the other is necessary and sufficient for memory retrieval. Downstream of memory reactivation, serotonin secreted from two head neurons mediates the systemic stress response. Thus, evoking stressful memories, stored within individual sensory neurons, allows animals to anticipate upcoming dire conditions and provides a head start to initiate rapid and protective responses that ultimately increase animal fitness.
Copyright © 2019 The Authors. Published by Elsevier Ltd.. All rights reserved.

Entities:  

Mesh:

Year:  2019        PMID: 31056393      PMCID: PMC6538972          DOI: 10.1016/j.cub.2019.03.059

Source DB:  PubMed          Journal:  Curr Biol        ISSN: 0960-9822            Impact factor:   10.834


Introduction

Living organisms often face complex environments that vary in time and space. This poses challenging demands for timely adjustments, particularly so when conditions worsen, or when rapid responses are required. To this end, anticipating mechanisms evolved to enable prediction of future scenarios based on prior experience [1, 2, 3, 4, 5]. In that respect, associative memories play a central role, since conditioned cues encountered in the past evoke memories and, by association, predict imminent developments [6]. The predictions that follow memory retrieval are predominantly studied in the context of instantaneous behavioral and neural responses. For example, the famous Pavlovian dogs started salivating as soon as they heard the sound of the bell, and present-day experimental paradigms show that mice startle or freeze when they perceive a tone or encounter an odor that was previously coupled with a foot electric shock [6, 7, 8]. Furthermore, memory retrieval induces gene expression programs and requires protein syntheses that are crucial for memory reconsolidation [9, 10]. However, little is known about the expression programs and the physiological processes taking place over longer timescales following memory retrieval, and their potential role in anticipating and coping with possible impending adversities. A growing effort is directed toward elucidating the neural ensemble that stores the memory, also known as the engram [11, 12]. Such ensembles are typically identified by tagging neurons that are active during the learning experience, often yielding a large set of cells. Interestingly, when labeling this set of neurons with Channelrhodopsin, a subsequent light activation is both necessary and sufficient for memory reactivation [13]. Nonetheless, understanding of memory formation and retrieval at the individual neuron level is still lacking. As learning and memory abilities are presumably universal across the animal kingdom, it is appealing to study such paradigms within animals with a compact nervous system where individual target neurons can be identified and tracked. In that respect, C. elegans nematodes offer a unique opportunity, as the wiring of their neural system, consisted of 302 neurons, has been fully mapped [14]. Moreover, C. elegans worms exhibit a range of learning and memory abilities, including associative memory, which can be studied at a single-neuron resolution [15, 16, 17, 18, 19, 20]. Here, we used C. elegans worms to show that the mere retrieval of aversive memories induces rapid, systemic, and protective responses, which confer a significant fitness advantage when facing subsequent adversities. Furthermore, we elucidated the core memory circuit that forms and stores this memory.

Results

Retrieval of Aversive Memories Induces a Rapid Nuclear Translocation of DAF-16/FOXO

To form an associative aversive memory, we starved L4 larvae in the presence (trained) or absence (mock trained) of the attractive odorant isoamyl alcohol (IAA), which served as the conditioned stimulus (Figure 1A). Animals were subsequently allowed to recover on food in the absence of IAA and then challenged with IAA for memory retrieval. The odorant cue induced a withdrawal response among forward-moving trained animals, while mock-trained animals essentially lingered around the odorant (Figure 1B; Videos S1 and S2). In addition, when presented with a choice between IAA and another attractive odorant, trained worms favored IAA significantly less than the other odorant (Figure S1). These behavioral responses demonstrated that the training paradigm induced genuine memory traces, and that conditionally trained animals developed measurable aversive responses to the otherwise attractive odorant IAA.
Figure 1

Reactivation of Aversive Memories Induces a Rapid Translocation of DAF-16/FOXO to Cells’ Nuclei

(A) The experimental design to form an associative aversive memory: animals were starved (unconditioned stimulus) either in the presence (trained) or in the absence (mock-trained) of an odorant (conditioned stimulus). The odorant was then washed off the animals. Following recovery on food, the animals were challenged with the odorant for memory retrieval and subsequently taken for either behavioral, gene expression, or fitness analyses.

(B) Behavioral analyses demonstrating that following training (starvation+IAA), animals withdrew when encountering the otherwise favorable odorant IAA. Mock-trained animals lingered around IAA (see also Videos S1 and S2). ∗∗∗p < 0.0005 (proportion test). Each data point is the mean ± SE of 3–4 independent experimental repeats, each scoring ∼50 animals.

(C) Odor-evoked memory retrieval induced a rapid (within 20 min) translocation of DAF-16/FOXO to gonad sheath cells’ nuclei (white arrowheads). To visualize protein spatial dynamics, we used a strain (TJ356) expressing the translational fusion daf-16::DAF-16::GFP [21]. Each of the four exemplary worms was imaged separately, cropped along its edges, and stacked one above the other.

(D and E) Density plots of number of cells with nuclear DAF-16/FOXO localization per worm within (D) 4 or (E) 24 h following recovery. Trained and mock-trained animals typically contain 0–3 cells with nuclear DAF-16 localization before the challenge. A significant increase in the number of DAF-16/FOXO nuclear localization per worm is observed following odor-evoked challenge of trained animals only, where 25%–35% of the worms showed more than five cells with nuclear DAF-16::GFP. In all subsequent analyses, we considered worms with nuclear DAF-16/FOXO if we could count at least six cells with nuclear localization (this minimum is denoted by the dotted vertical line). Each plot is based on analyses of ∼200 animals. ∗∗∗p < 0.0005, Kolmogorov-Smirnov test.

See also Figures S1 and S2 and Videos S1, S2, and S3.

Reactivation of Aversive Memories Induces a Rapid Translocation of DAF-16/FOXO to Cells’ Nuclei (A) The experimental design to form an associative aversive memory: animals were starved (unconditioned stimulus) either in the presence (trained) or in the absence (mock-trained) of an odorant (conditioned stimulus). The odorant was then washed off the animals. Following recovery on food, the animals were challenged with the odorant for memory retrieval and subsequently taken for either behavioral, gene expression, or fitness analyses. (B) Behavioral analyses demonstrating that following training (starvation+IAA), animals withdrew when encountering the otherwise favorable odorant IAA. Mock-trained animals lingered around IAA (see also Videos S1 and S2). ∗∗∗p < 0.0005 (proportion test). Each data point is the mean ± SE of 3–4 independent experimental repeats, each scoring ∼50 animals. (C) Odor-evoked memory retrieval induced a rapid (within 20 min) translocation of DAF-16/FOXO to gonad sheath cells’ nuclei (white arrowheads). To visualize protein spatial dynamics, we used a strain (TJ356) expressing the translational fusion daf-16::DAF-16::GFP [21]. Each of the four exemplary worms was imaged separately, cropped along its edges, and stacked one above the other. (D and E) Density plots of number of cells with nuclear DAF-16/FOXO localization per worm within (D) 4 or (E) 24 h following recovery. Trained and mock-trained animals typically contain 0–3 cells with nuclear DAF-16 localization before the challenge. A significant increase in the number of DAF-16/FOXO nuclear localization per worm is observed following odor-evoked challenge of trained animals only, where 25%–35% of the worms showed more than five cells with nuclear DAF-16::GFP. In all subsequent analyses, we considered worms with nuclear DAF-16/FOXO if we could count at least six cells with nuclear localization (this minimum is denoted by the dotted vertical line). Each plot is based on analyses of ∼200 animals. ∗∗∗p < 0.0005, Kolmogorov-Smirnov test. See also Figures S1 and S2 and Videos S1, S2, and S3.

Video S1. Trained Animals Withdraw When Encountering the Training Odor, Related to Figure 1

A stripe of IAA was spread in front of forward-moving animals. Animals starved in the presence of IAA (trained) withdrew when later presented with IAA. This exemplary video shows how the animal cannot pass through the spread stripe of IAA. The stripe was color coded in red (using power point) to specify its exact location.

Video S2. Mock-Trained Animals Linger around the Favorable Odor, Related to Figure 1

Mock-trained animals (starved in the absence of IAA) did not withdraw, but tended to linger along the favorable attractive odorant IAA. A stripe of IAA was spread in front of forward-moving animals. The stripe was color coded in red (using power point) to specify its exact location. We next asked whether mere retrieval of the aversive memory also induces a molecular stress response. For this, we quantified nuclear accumulation of the general stress-response transcription factor DAF-16/FOXO [21, 22]. Under favorable conditions, DAF-16/FOXO is found in its phosphorylated form in the cytoplasm; however, when facing stress, DAF-16/FOXO is rapidly dephosphorylated and translocates to the nucleus to regulate expression of multiple stress-response genes (Figures S2A and S2B). Remarkably, the mere re-exposure of trained-recovered animals to IAA induced a rapid (<20 min) translocation of DAF-16/FOXO to cells’ nuclei (Figures 1C–1E). Moreover, this fast translocation was evident primarily in the gonad sheath cells (Figure 1C). While each of the two gonads consists of 10 sheath cells, the number of cells undergoing this rapid nuclear translocation varied. We have therefore quantitatively analyzed the distribution of the number of cells with nuclear DAF-16/FOXO: before challenging the animals with IAA, both trained and mock-trained animals contained a minute number of cells with nuclear DAF-16/FOXO, typically 0–3 cells (Figures 1D and 1E). However, following exposure to IAA, a significant increase in the number of cells with nuclear localization was observed in the trained animals group (ranging from 5 to 12 cells), while no change was observed in the mock-trained animals. Based on these results, we conservatively scored animals as initiating an odor-evoked stress response, if we observed at least six cells with nuclear DAF-16/FOXO localization (Figures 1D and 1E). Moreover, the initiation of the stress response could be odor-evoked after 4, 24, and even 48 h of recovery (Figures 2A and 2B). Surprisingly, this memory became stable, as exposing trained animals to the odor in the presence of food did not lead to memory extinction when animals were challenged with the odor again 6 or 24 h later (Figure 2C). In support of the long-term stress memory, we found that crh-1 mutant animals, defective in the cyclic AMP-response element binding protein (CREB [23, 24]), failed to initiate the odor-evoked stress response (Figure 2D). In addition, animals trained during the L1/L2 larval stages failed to form the long-term memory (Figure S2C), suggesting that this is a classic learning and memory process rather than an imprinting phenomenon [19, 25]. Of note, additional attractive odorants could be used as the conditioned stimulus to form the odor-evoked stress response (Figure 2E). As IAA was the most potent conditioned stimulus, we proceeded with this odorant in the subsequent analyses.
Figure 2

The Stressful Memory Is Long Lasting and Cannot Be Readily Extinct

(A and B) The aversive memory could be odor-evoked even 48 h following training and recovery.

(A) For each time point, we scored trained and mock-trained animals, each group with and without IAA challenge. The non-challenged groups served to control for the overall stress in the population without evoking the stressful memory. Importantly, IAA by itself does not induce stress, as worms grown on food in the presence of IAA (for 24 h) were not stressed following the IAA challenge.

(B) To simplify presentation, from here on we present the data as the difference between the percentage of stressed worms in the challenged group (exposed to the odorant) and the percentage of stressed worms in the non-challenged group (not exposed to the odorant). The data in this panel depict the data shown in (A).

(C) Memory cannot be extinct by first exposing trained worms to IAA (while on food, 1 h) and then challenging these worms (re-exposing to IAA), either 6 or 24 h later.

(D) Mutants defective in crh-1, but not crh-2, do not undergo the odor-evoked stress induction.

(E) Various odorants could be used as the conditioned stimulus to form, and to subsequently evoke, the memory and induce translocation of DAF-16 to cells’ nuclei.

But, butanone; BA, benzaldehyde; DA, diacetyl. Asterisks denote significant difference (proportion test) between trained and mock-trained animals. ∗p < 0.05, ∗∗p < 0.005, ∗∗∗p < 0.0005. Each data point is the mean ± SE of 3–4 independent experimental repeats, each scoring ∼50 animals.

The Stressful Memory Is Long Lasting and Cannot Be Readily Extinct (A and B) The aversive memory could be odor-evoked even 48 h following training and recovery. (A) For each time point, we scored trained and mock-trained animals, each group with and without IAA challenge. The non-challenged groups served to control for the overall stress in the population without evoking the stressful memory. Importantly, IAA by itself does not induce stress, as worms grown on food in the presence of IAA (for 24 h) were not stressed following the IAA challenge. (B) To simplify presentation, from here on we present the data as the difference between the percentage of stressed worms in the challenged group (exposed to the odorant) and the percentage of stressed worms in the non-challenged group (not exposed to the odorant). The data in this panel depict the data shown in (A). (C) Memory cannot be extinct by first exposing trained worms to IAA (while on food, 1 h) and then challenging these worms (re-exposing to IAA), either 6 or 24 h later. (D) Mutants defective in crh-1, but not crh-2, do not undergo the odor-evoked stress induction. (E) Various odorants could be used as the conditioned stimulus to form, and to subsequently evoke, the memory and induce translocation of DAF-16 to cells’ nuclei. But, butanone; BA, benzaldehyde; DA, diacetyl. Asterisks denote significant difference (proportion test) between trained and mock-trained animals. ∗p < 0.05, ∗∗p < 0.005, ∗∗∗p < 0.0005. Each data point is the mean ± SE of 3–4 independent experimental repeats, each scoring ∼50 animals.

Evoking Aversive Memories Speeds Up Stress Response Programs that Confer a Fitness Advantage

The rapid odor-evoked nuclear translocation of DAF-16/FOXO commenced when the worms were on food, satiated, and free of stress (Figures 1 and 2). Under these conditions, the rapid nuclear accumulation was transient and was followed by an exit from the nucleus, presumably because the animals did not really experience a food shortage (Figure 3A). To mimic genuine progressively worsening conditions, we challenged the animals with IAA while depriving food, so that in addition to odor-evoking the stress memory, animals also experienced a gradual food shortening. In this paradigm, nuclear accumulation of DAF-16/FOXO was significantly faster in trained animals than in the mock-trained animals (Figures 3B and S3). Interestingly, the favorable odorant IAA by itself alleviated starvation-induced stress, as naive animals presented with IAA were actually slower to initiate the stress responses (Figure 3C). Thus, associating a positive odorant with starvation flipped its valence (see also Figure S4A), and a subsequent exposure (challenge) with the odorant induced a significantly faster nuclear accumulation of DAF-16/FOXO.
Figure 3

Odor-Evoked Aversive Memories Speed Up Stress Response Programs that Ultimately Confer Fitness Advantage When Confronting Subsequent Adversities

(A) Trained animals (starved in the presence of the conditioned stimulus IAA) were allowed to recover and then challenged with IAA while being on food. The odor-evoked aversive memory induced a rapid, but transient, DAF-16/FOXO nuclear translocation. A reduction was observed after 30 min post-induction. Mock-trained animals showed no stress upon exposure to the odorant. Asterisks denote significant difference between trained and mock-trained animals at the depicted time points (∗p < 0.05, ∗∗∗p < 0.0005, proportion test).

(B) When odor-evoking the aversive memory while animals were off-food, the immediate DAF-16/FOXO nuclear translocation continuously progressed without decaying. This stress response developed nearly three times faster in trained versus mock-trained animals (∼40% versus ∼15%, p < 0.005, linear regression test).

(C) In naive animals, the favorable odorant IAA actually alleviates stress, as naive animals were slower to initiate stress responses when starved for the first time in the presence of IAA (p < 0.005, linear regression test).

In (A)–(C), each data point is the mean ± SE of 3–4 independent experimental repeats, each scoring ∼50 animals.

(D) Expression of genes downstream of the DAF-16/FOXO transcription factor was significantly upregulated following odor-induced memory reactivation. Animals were trained as detailed in Figure 1A, and following 24 h of recovery, they were starved for 2 h in the presence of IAA, after which ∼1,000 animals were collected for RNA extraction and qPCR analyses (∗p < 0.05, paired t test); N = 4 independent experiments.

(E) Odor-evoked reactivation of aversive memories conferred a fitness advantage as survival rates of trained animals were significantly higher compared to mock-trained animals. Animals were trained to form the olfactory aversive memory as outlined in Figure 1A. Following recovery of 24 h, the worms were exposed to the conditioned stimulus IAA for 2 h and then immediately subjected to heat shock (37°C, 4 h). The animals were then allowed to recover for 24 h in 20°C on food, after which viability was scored. Each line represents a single independent experimental repeat (total N = 8), each with ∼100 animals scored for each of the groups (trained and mock trained). Asterisks denote significant difference between trained and mock-trained animals (∗∗∗p < 0.0005, proportion test).

See also Figures S3–S5.

Odor-Evoked Aversive Memories Speed Up Stress Response Programs that Ultimately Confer Fitness Advantage When Confronting Subsequent Adversities (A) Trained animals (starved in the presence of the conditioned stimulus IAA) were allowed to recover and then challenged with IAA while being on food. The odor-evoked aversive memory induced a rapid, but transient, DAF-16/FOXO nuclear translocation. A reduction was observed after 30 min post-induction. Mock-trained animals showed no stress upon exposure to the odorant. Asterisks denote significant difference between trained and mock-trained animals at the depicted time points (∗p < 0.05, ∗∗∗p < 0.0005, proportion test). (B) When odor-evoking the aversive memory while animals were off-food, the immediate DAF-16/FOXO nuclear translocation continuously progressed without decaying. This stress response developed nearly three times faster in trained versus mock-trained animals (∼40% versus ∼15%, p < 0.005, linear regression test). (C) In naive animals, the favorable odorant IAA actually alleviates stress, as naive animals were slower to initiate stress responses when starved for the first time in the presence of IAA (p < 0.005, linear regression test). In (A)–(C), each data point is the mean ± SE of 3–4 independent experimental repeats, each scoring ∼50 animals. (D) Expression of genes downstream of the DAF-16/FOXO transcription factor was significantly upregulated following odor-induced memory reactivation. Animals were trained as detailed in Figure 1A, and following 24 h of recovery, they were starved for 2 h in the presence of IAA, after which ∼1,000 animals were collected for RNA extraction and qPCR analyses (∗p < 0.05, paired t test); N = 4 independent experiments. (E) Odor-evoked reactivation of aversive memories conferred a fitness advantage as survival rates of trained animals were significantly higher compared to mock-trained animals. Animals were trained to form the olfactory aversive memory as outlined in Figure 1A. Following recovery of 24 h, the worms were exposed to the conditioned stimulus IAA for 2 h and then immediately subjected to heat shock (37°C, 4 h). The animals were then allowed to recover for 24 h in 20°C on food, after which viability was scored. Each line represents a single independent experimental repeat (total N = 8), each with ∼100 animals scored for each of the groups (trained and mock trained). Asterisks denote significant difference between trained and mock-trained animals (∗∗∗p < 0.0005, proportion test). See also Figures S3–S5. We next asked whether the odor-evoked rapid nuclear translocation of DAF-16/FOXO also speeds up transcriptional programs of the stress-response genes. For this, we focused on several known DAF-16/FOXO-dependent stress-response genes, namely, cpr-2, hsp-12.6, mtl-1, and sod-3 [26, 27]. Indeed, these genes were upregulated following the training starvation, in either the presence or absence of IAA (Figure S4B). Following a 24-h recovery period, the genes were further upregulated upon a second, 2-h starvation. Strikingly, mere exposure of trained animals to IAA during the second starvation induced significantly higher expression levels in two of the tested genes, when compared to mock-trained animals (Figure 3D). Together, these results indicate that odor-evoked memory retrieval speeds up and increases the expression of stress-response genes, thus inducing a rapid stress-response program. Does this memory-evoked rapid initiation of the stress response also confer a genuine protection? For example, if memory-evoked animals were to subsequently face a devastating stress, will they be more resilient and survive better? To quantify animal resilience, worms were subjected to severe heat shock as an immediate stressor (Figure 3E). Starvation by itself increased survival prospects when animals were subsequently subjected to a heat shock (Figure S5A); however, trained animals, in which memory was odor-evoked 2 h prior to the heat shock, were more resistant to the subsequent stress when compared to mock-trained animals, as evident by their significantly higher survival rates (Figure 3E). Notably, training itself did not increase survival chances as heat shock of trained and mock-trained animals that were not exposed to the odor had same survival chances (Figure S5B). Thus, the mere retrieval of past aversive memories initiates a rapid and protective stress-response program. This expedited response enables animals to prepare for the forthcoming adversities in advance, ultimately providing a significant fitness advantage.

Memory Formation Modulates the Response of Individual Sensory Neurons

The relatively compact nervous system of C. elegans offers a unique opportunity to identify the individual neurons that form and store associative memories. IAA is primarily sensed by the AWCON and AWCOFF chemosensory neurons [28, 29]. We therefore assayed the response of these neurons to IAA in four different groups of animals (see STAR Methods for details): trained (starved in the presence of IAA), mock-trained (starved in the absence of IAA), positively trained (exposed to IAA on food), and naive (never starved and never exposed to IAA). While AWCON strongly responded to IAA in all four tested groups, AWCOFF activity was markedly different (Figures 4A and 4B). Whereas mock-trained, positively trained, and naive animals showed only a moderate to no response at all, the AWCOFF neuron in trained animals displayed a significantly stronger response to IAA. In addition, as trained animals quickly withdrew when encountering IAA (Figure 1B; Videos S1 and S2), we hypothesized that the nociceptive polymodal neuron ASH [30] will also undergo functional changes following training. Indeed, when exposing animals to IAA, the ASH response was enhanced in trained animals only (Figure 4C). These results suggest that the three neurons, AWCON, AWCOFF, and ASH, may be part of a circuit that stores the odor-associated aversive memory.
Figure 4

Chemosensory Neurons Show Modulated Responses Following Memory Formation

(A–C) Calcium imaging of the chemosensory neurons (A) AWCON, (B) AWCOFF, and (C) ASH in response to IAA (10–3). For each neuron analyzed, we assayed four different groups of animals to include all possible controls: trained animals were starved in the presence of IAA; mock-trained animals were starved in the absence of IAA; positively (Pos.) trained animals were exposed to IAA in the presence of food; naive animals never experienced starvation and never encountered IAA prior to the challenge in this assay. Training sessions of all four groups took place in parallel, and animals were starved and/or exposed to IAA for the same duration. Shown are activity raster plots where t = 0 marks IAA switch OFF (A and B) or ON (C). Neural activity is in arbitrary units (indicated by color bar and reflects F/F0 fluorescent intensities) and is normalized to maximum intensity for each neuron across all of its four assayed groups. 8–12 animals were assayed for each of the groups, and each animal was tested 2–3 times. The response activity was defined as the difference between the mean activity during the 10 s after the switch and the mean activity during the 10 s prior to the switch (for the AWC neurons), and the difference between the 20 s after the switch and the 20 s prior to the switch in the case of ASH. ∗p < 0.05, t test.

Chemosensory Neurons Show Modulated Responses Following Memory Formation (A–C) Calcium imaging of the chemosensory neurons (A) AWCON, (B) AWCOFF, and (C) ASH in response to IAA (10–3). For each neuron analyzed, we assayed four different groups of animals to include all possible controls: trained animals were starved in the presence of IAA; mock-trained animals were starved in the absence of IAA; positively (Pos.) trained animals were exposed to IAA in the presence of food; naive animals never experienced starvation and never encountered IAA prior to the challenge in this assay. Training sessions of all four groups took place in parallel, and animals were starved and/or exposed to IAA for the same duration. Shown are activity raster plots where t = 0 marks IAA switch OFF (A and B) or ON (C). Neural activity is in arbitrary units (indicated by color bar and reflects F/F0 fluorescent intensities) and is normalized to maximum intensity for each neuron across all of its four assayed groups. 8–12 animals were assayed for each of the groups, and each animal was tested 2–3 times. The response activity was defined as the difference between the mean activity during the 10 s after the switch and the mean activity during the 10 s prior to the switch (for the AWC neurons), and the difference between the 20 s after the switch and the 20 s prior to the switch in the case of ASH. ∗p < 0.05, t test.

Memory Is Cell Specific Rather Than Stimulus Specific

Studies in mice showed that optogenetic activation of engram cells induces memory retrieval [11, 13]. We therefore generated transgenic animals, each exclusively expressing Channelrhodopsin in one of these sensory neurons, and subjected them to the same training and recovery protocol (Figure 1A). Remarkably, mere light activation of either AWCON or AWCOFF was sufficient to induce the stress response, as evident by the rapid translocation of DAF-16/FOXO to cells’ nuclei (Figure 5A). The first cells to show nuclear localization were the gonad sheath cells, similar to the translocation observed following odor-evoked memory retrieval (Figure 1C). In contrast, light activation of ASH did not elicit DAF-16/FOXO translocation (Figure 5A), suggesting that its modulated activity serves primarily to promote immediate withdrawal from IAA (Figure 1B), rather than participating in the longer timescale memory that leads to activation of stress-response programs. Of note, light illumination alone did not stress the worms, as mock-trained animals, starved in the absence of IAA, did not display a stress response (Figure 5A).
Figure 5

Memory Is Cell Specific: AWCON Is Required for Memory Formation, while AWCOFF Is Required and Sufficient for Memory Retrieval

(A) Light activation of either ChR2-expressing AWCON or AWCOFF (of trained animals only) sufficed to evoke the memory and to induce the stress response. Conversely, light activation of ASH did not induce the stress response.

(B) Benzaldehyde (BA) and butanone (But), primarily sensed by AWC neurons, but not diacetyl (DA), primarily sensed by the AWA neurons, induced the stress response in animals trained with IAA.

(C) Similarly, IAA induced the stress response in animals that were initially trained with benzaldehyde or butanone, but not with diacetyl.

(D) Activity of AWCON is necessary during memory formation. Inhibiting AWCON via the histamine-gated chloride channel (str-2::HisCl1) during the training period (memory formation), but not during the challenge (memory retrieval), impaired the odor-induced stress response.

(E) Activity of AWCOFF is necessary during memory retrieval. Inhibiting AWCOFF via the histamine-gated chloride channel (srsx-3::HisCl1) during the challenge (memory retrieval), but not during the training period (memory formation), impaired the odor-induced stress response.

(F) Inhibiting ASH via the histamine-gated chloride channel (sra-6::HisCl1), either during training or during the challenge, did not affect the odor-induced stress response. Averages are based on 3–4 independent experimental repeats, each with >50 animals. Asterisks above the average value denote significant difference between trained and mock-trained animals. Asterisks above a horizontal line connecting two conditions denote significant difference between these conditions. ∗∗p < 0.005, ∗∗∗p < 0.0005, proportion test.

See also Figure S6.

Memory Is Cell Specific: AWCON Is Required for Memory Formation, while AWCOFF Is Required and Sufficient for Memory Retrieval (A) Light activation of either ChR2-expressing AWCON or AWCOFF (of trained animals only) sufficed to evoke the memory and to induce the stress response. Conversely, light activation of ASH did not induce the stress response. (B) Benzaldehyde (BA) and butanone (But), primarily sensed by AWC neurons, but not diacetyl (DA), primarily sensed by the AWA neurons, induced the stress response in animals trained with IAA. (C) Similarly, IAA induced the stress response in animals that were initially trained with benzaldehyde or butanone, but not with diacetyl. (D) Activity of AWCON is necessary during memory formation. Inhibiting AWCON via the histamine-gated chloride channel (str-2::HisCl1) during the training period (memory formation), but not during the challenge (memory retrieval), impaired the odor-induced stress response. (E) Activity of AWCOFF is necessary during memory retrieval. Inhibiting AWCOFF via the histamine-gated chloride channel (srsx-3::HisCl1) during the challenge (memory retrieval), but not during the training period (memory formation), impaired the odor-induced stress response. (F) Inhibiting ASH via the histamine-gated chloride channel (sra-6::HisCl1), either during training or during the challenge, did not affect the odor-induced stress response. Averages are based on 3–4 independent experimental repeats, each with >50 animals. Asterisks above the average value denote significant difference between trained and mock-trained animals. Asterisks above a horizontal line connecting two conditions denote significant difference between these conditions. ∗∗p < 0.005, ∗∗∗p < 0.0005, proportion test. See also Figure S6. Induction of the stress response following light activation of AWCON or AWCOFF neurons, suggested that the memory is cell rather than cue specific. If this is the case, then other AWC-specific odorants may be interchangeably used to induce the same stress response. Indeed, training animals with IAA as the conditioned stimulus, and evoking the memory using either benzaldehyde or butanone (known AWC-target odorants [31]), induced stress responses comparable to those obtained using IAA or light activation alone (Figure 5B). Furthermore, these odorants can be used as the conditioned stimuli during training and IAA as the odor-evoking cue to retrieve the memory (Figure 5C). In contrast, the odorant diacetyl (sensed primarily by the AWA neurons [31]) failed to induce the stress response, whether it was used as the conditioned stimulus during training or as the memory-evoking cue (Figures 5B and 5C). These results indicate that memory is cell specific, and that either AWCON or AWCOFF suffice to evoke the memory to initiate the stress response.

AWCON Is Necessary for Memory Formation, while AWCOFF Is Necessary and Sufficient for Memory Retrieval

Next, we asked whether AWCON and AWCOFF neurons are also necessary for memory formation and retrieval, to eventually induce the stress response. For this, we generated animals expressing the inhibitory histamine-gated chloride channel (HisCl1 [32]) in either AWCON or AWCOFF cells. Feeding the worms with histamine, either during training or during odor challenge, led to inhibition of individual neurons during these critical periods of memory formation or retrieval, respectively. Interestingly, AWCON inhibition during training, but not during the challenge, significantly impaired subsequent odor-evoked stress responses (Figure 5D). Conversely, AWCOFF inhibition during the challenge, but not during training, completely abolished the stress response (Figure 5E). Thus, AWCON is necessary for the formation of the stressful memory but is dispensable for memory retrieval, while AWCOFF is necessary and sufficient for the retrieval of the stressful memory and the concomitant translocation of DAF-16/FOXO to cells’ nuclei. Consistent with the above results (Figure 4C), ASH inhibition, either during training or memory retrieval, did not affect the odor-evoked stress responses (Figure 5F). Notably, while both AWC neurons are critical for memory formation and retrieval to confer stress resistance (Figure S6C), they did not affect the aversive behavioral response of the animals (Figures S6A and S6B).

Serotonin Mediates the Rapid Systemic Spread of the Stress Response

Finally, we studied how the information elicited by memory retrieval spreads systemically to induce DAF-16/FOXO translocation to cells’ nuclei throughout the entire body. For this, we focused on the neuromodulator serotonin, which is known to mediate aversion and stress responses in nematodes as well as in other animals, including humans [15, 33, 34, 35, 36, 37, 38]. We found that animals, defective in either serotonin production or secretion, failed to exhibit odor-evoked stress responses (Figure 6A). Furthermore, exogenous application of serotonin, or optogenetic activation of the head-serotonergic neurons (either NSM or ADF), sufficed to induce the stress response in trained animals only (Figures 6B and S7). Importantly, exogenous application of serotonin to worms that were exposed to IAA on food did not induce the stress response (Figure S7). Neuropeptide secretion, which is closely associated with starvation through the insulin signaling pathway [27, 39, 40], was not involved in mediating the odor-evoked systemic stress response (Figure 6A). The serotonin-mediated stress response is downstream of AWCOFF, as exogenous application of serotonin induced the stress response even when inhibiting AWCOFF during memory retrieval (Figure 6C). Thus, serotonin plays a key role in mediating the rapid systemic stress response following reactivation of the stressful memory.
Figure 6

Serotonin Mediates the Rapid and Systemic Odor-Evoked Stress Response

(A) Animals defective in neuropeptide secretion (unc-31) learned and showed an odor-evoked stress response similarly to wild-type (WT) animals. Animals defective in serotonin production (tph-1), or serotonin secretion (expressing the tetanus toxin, TeTx, in all serotonergic neurons: ADF, NSM, and HSN), failed to induce the odor-evoked stress response.

(B) Exogenous application of serotonin or light activation of all the serotonergic neurons (tph-1::ChR2), as well as exclusive activation of either NSM (stph-1::ChR2) or ADF (srh-142:: ChR2), induced the systemic stress response in trained animals only. The (–) condition reflects control worms that were not challenged with serotonin.

(C) Serotonin-mediated stress response is downstream of AWCOFF-mediated memory retrieval. Inhibiting AWCOFF via the hisCl1 channel (srsx-3::HisCl1) during memory retrieval inhibited the subsequent induction of the stress response. However, application of exogenous serotonin while concomitantly inhibiting AWCOFF, induced the stress response, suggesting that serotonin acts downstream of AWCOFF. As in (B), serotonin by itself induced the stress response. In all panels, averages are based on 3–4 independent experimental repeats, each with >50 animals; ∗∗∗p < 0.0005, proportion test.

See also Figure S7.

Serotonin Mediates the Rapid and Systemic Odor-Evoked Stress Response (A) Animals defective in neuropeptide secretion (unc-31) learned and showed an odor-evoked stress response similarly to wild-type (WT) animals. Animals defective in serotonin production (tph-1), or serotonin secretion (expressing the tetanus toxin, TeTx, in all serotonergic neurons: ADF, NSM, and HSN), failed to induce the odor-evoked stress response. (B) Exogenous application of serotonin or light activation of all the serotonergic neurons (tph-1::ChR2), as well as exclusive activation of either NSM (stph-1::ChR2) or ADF (srh-142:: ChR2), induced the systemic stress response in trained animals only. The (–) condition reflects control worms that were not challenged with serotonin. (C) Serotonin-mediated stress response is downstream of AWCOFF-mediated memory retrieval. Inhibiting AWCOFF via the hisCl1 channel (srsx-3::HisCl1) during memory retrieval inhibited the subsequent induction of the stress response. However, application of exogenous serotonin while concomitantly inhibiting AWCOFF, induced the stress response, suggesting that serotonin acts downstream of AWCOFF. As in (B), serotonin by itself induced the stress response. In all panels, averages are based on 3–4 independent experimental repeats, each with >50 animals; ∗∗∗p < 0.0005, proportion test. See also Figure S7.

Discussion

In this study, we demonstrated that C. elegans animals can anticipate impending adversity following retrieval of an aversive memory. This anticipation is manifested by speeding up systemic stress-response programs that ultimately increase survival chances when facing subsequent dire conditions (Figures 2 and 3). Moreover, we revealed the mechanism underlying memory formation, retrieval, and the subsequent rapid systemic spread of the stress response (Figure 7): a single neuron, AWCON, serves as the primary sensor of the conditioned odor stimulus, where its activity is necessary during memory formation, but is dispensable later during memory retrieval. A second neuron, AWCOFF, is recruited to store the memory, and its activity is required and sufficient for memory retrieval; the activity of this neuron, however, is not required during memory formation. The odor-evoked memory retrieval induces serotonin release from the serotonergic head neurons (ADF and NSM), which in turn mediate the systemic stress response, as evident by the rapid translocation of DAF-16/FOXO to cells’ nuclei. Thus, retrieval of aversive memories enables animals to anticipate impending adversities by providing a head start to initiate systemic protective programs.
Figure 7

A Model for Memory Formation, Retrieval, and the Subsequent Speed Up in the Systemic Stress Response to Confer a Fitness Advantage

(A) AWCON is the primary sensor for IAA and its activity is required for memory formation when naive animals first encounter the odor coupled with starvation. Activity of AWCOFF is not required at this stage, but the memory is presumably “written” to this neuron (dashed arrow).

(B) During retrieval, when animals re-encounter the odor, AWCOFF is necessary and sufficient to initiate the odor-evoked stress response. At this stage, AWCON is dispensable.

(C) Odor-evoked memory reactivation induces release of serotonin from the serotonergic head neurons NSM and ADF.

(D) Serotonin secretion speeds up the systemic stress response as evident by the rapid translocation of DAF-16/FOXO to cells’ nuclei (indicated by the white arrowheads); thus, the mere retrieval of aversive memories induces rapid stress-response programs, that ultimately increase survival prospects when facing imminent adversities. The imaged worm is constructed from two concatenated images of the same worm.

A Model for Memory Formation, Retrieval, and the Subsequent Speed Up in the Systemic Stress Response to Confer a Fitness Advantage (A) AWCON is the primary sensor for IAA and its activity is required for memory formation when naive animals first encounter the odor coupled with starvation. Activity of AWCOFF is not required at this stage, but the memory is presumably “written” to this neuron (dashed arrow). (B) During retrieval, when animals re-encounter the odor, AWCOFF is necessary and sufficient to initiate the odor-evoked stress response. At this stage, AWCON is dispensable. (C) Odor-evoked memory reactivation induces release of serotonin from the serotonergic head neurons NSM and ADF. (D) Serotonin secretion speeds up the systemic stress response as evident by the rapid translocation of DAF-16/FOXO to cells’ nuclei (indicated by the white arrowheads); thus, the mere retrieval of aversive memories induces rapid stress-response programs, that ultimately increase survival prospects when facing imminent adversities. The imaged worm is constructed from two concatenated images of the same worm. Following the challenge with the conditioned odorant, the first cells observed with DAF-16/FOXO nuclear localization are the gonad sheath cells. It is possible that these cells constitute the primary responding tissue, rendering the worm in a primed state that awaits the actual stress (e.g., starvation) to propagate the systemic stress response. It is also possible that these cells serve as a “relay station” in a more complex inter-tissue communication process. An additional intriguing possibility is that the gonad sheath cells participate in the transmission of the stress memory to the progeny. While the gonad sheath cells are the first observable cells with DAF-16 nuclear localization, we presume that the later systemic response is the one that eventually confers the resistance. Indeed, starvation alone, without odor-evoking the memory, also initiates DAF-16 nuclear translocation, though at a significantly slower rate (Figures 3 and S3). Furthermore, DAF-16 translocation to nuclei of the gonad sheath cells is presumably only the primary event, which incurs an overall low energetic toll. The high energetic cost comes when starvation genuinely ensues and the stress response progresses systematically for the duration of the stress. Indeed, when we exposed the trained worms to the odor while on food, we observed a rapid transient response that peaked at ∼30 min but terminated after an hour (Figure 3A). Thus, in the event of an erroneous initiation of the stress response, possibly due to cross-activation between different odors, the energetic toll is presumably not too high. We found that in the compact neural network of C. elegans, activation of a single neuron sufficed for memory retrieval (Figure 5). Moreover, two independent observations indicate that this memory is cell specific rather than stimulus specific: (1) the stress response can be elicited by light-activating ChR2-expressing AWC neurons, thus bypassing the need to evoke the memory with the conditioned stimulus. (2) Different odorants that are sensed via the AWC neurons can be interchangeably used for memory formation and retrieval, further underscoring the notion that retrieval is not cue specific but neuron specific. Interestingly, it was shown that increased Gαq signaling in AWC neurons improved memory abilities, even in aged animals with deteriorating cognitive functions [41]. While memory retrieval and induction of the stress response could be initiated by activating either of the AWC neurons, additional neurons are likely to be participating in this process. Indeed, previous studies showed that interneurons are a site of action for both memory formation and retrieval [19, 20, 41, 42, 43]. That odor-evoked stress response is cell specific and not odor specific raises the possibility that a response may be erroneously induced by a cue that was not used as the conditioned stimulus, yet is sensed by the same neuron. As the chemosensory system of C. elegans animals is compact, consisting of 32 single neurons [14, 44], each neuron often responds to several different cues [29]. Thus, possible erroneous responses may be a compromise of network compactness. It is also plausible that, in nature, the cross-activating odorants (e.g., IAA, butanone, and benzaldehyde; Figures 5B and 5C) appear together such that worms often encounter them as a mixture. As a consequence, and to minimize possible cross-activations, the same neuron evolved to sense each of the individual cues that make up the complex mixed stimulus. While AWC neurons are activated upon removal of the odorant stimulus (Figure 4), it is actually the exposure to the odorant that leads to memory reactivation and initiation of the stress response (Figures 2, 3, and 5). We speculated that when exposing the worms to the stimulus inside the experimental plate, where worms are free to move, a gradient in the stimulus concentration is formed. As a consequence, the worms may sense increasing and decreasing concentrations of the stimulus as they get closer or further away from the center of the gradient, respectively [45]. Thus, when crawling in decreasing concentrations of the stimulus, the AWC neurons get activated, and this can explain how exposure to the stimulus activates the neurons to induce the stress response. Indeed, when imaging worm’s motion inside the experimental plate, we found that worms tended to aggregate in the center of the plate, indicating that a stimulus gradient was formed (Video S3).

Video S3. Worms Sense a Gradient When Trained to Associate Starvation with an Odor, Related to Figure 1

The video shows the experimental arena, where animals were exposed to the odorant IAA in the absence of food, to form an aversive memory. Bottom plate, nine drops of IAA (10−3) were applied on the inside face of a Petri-dish lid. Top plate was applied with nine drops of water as control. The worms on the NGM agar inside the dish were free to move. At the beginning of the experiment, the worms were placed on four equally-distant quadrants of the plate. The IAA forms a gradient, and hence, worms chemotax and aggregate at the center, indicating that AWC neurons are being activated in times that worms turn to move in decreasing gradients [S1, S2]. No aggregation is observed in the top plate with water drops. Previous olfactory learning studies in C. elegans focused primarily on the behavioral outcomes following memory retrieval. For example, pairing odorants with food or with starvation states enhanced or reduced attraction toward these odorants, respectively [18, 20, 43, 46, 47, 48]. In these paradigms, the insulin homolog insulin-like 1 (ins-1) played a key role in memory retrieval [20, 46, 47]. Herein, we coupled the odorant IAA with starvation and focused on the stress-response programs, rather than on the behavioral outputs. Our results suggest that neuropeptide secretion is not involved in the odor-evoked stress responses as unc-31 mutant animals initiated the stress response similarly to wild-type animals (Figure 6). Alternatively, it is possible that neuropeptides play a role predominantly in short-term memory paradigms, whereas in our study, we used a long-term memory paradigm. Indeed, odor-evoked stress responses were crh-1 dependent and could be retrieved even 48 h post-recovery (Figure 2). Moreover, our findings indicate that both AWC neurons are critical for the formation and retrieval of the stress memory. Interestingly, while trained animals are averse by the conditioned stimulus IAA (Figure 1B), this behavioral response is not likely to be mediated by the AWC neurons, as inhibiting these neurons, either during training or the challenge, did not alter the aversive response (Figures S6A and S6B). This suggests that additional neurons participate in memory formation that are responsible for mediating the aversive behavior. Odor-evoked retrieval of the aversive memory induced a rapid upregulation of stress-response genes that eventually increased survival prospects when faced with a subsequent stress (Figures 3D and 3E). A related olfactory conditioning of worms on pathogenic bacteria was shown to prime stress-response programs via HSF-1 to enhance expression of chaperones, which subsequently increased survival chances [49]. This rapid induction occurred only in the presence of the pathogenic bacteria. Remarkably, herein, a mere 2-h exposure to the conditioned odorant only sufficed to upregulate stress-response genes and to provide a fitness advantage. Specifically, we found a significant induction of two out of the four genes tested: hsp-12.6 and mtl-1. It is possible that we observed the enhanced expression in these genes only because the 2-h window from memory retrieval to gene expression analyses was too short to observe the induction of all four genes. A more intriguing possibility is that, while starvation during training induced a substantial and non-specific upregulation of many stress-response genes (Figure S4B), the odor-evoked stress response is fine-tuned to upregulate only a subset of the genes that are necessary for coping with the specific anticipated adversity. This possibility suggests that in addition to storing past events, memory traces may also code for the intricate programs needed to face with the explicit impending conditions. We demonstrated that serotonin mediates the systemic stress response following memory retrieval. Indeed, serotonin is a known key factor involved in stress and anxiety disorders in various animals, including humans [33, 34, 36, 38, 50]. Moreover, we found that light activation of the serotonergic neurons, or exogenous application of serotonin, sufficed to induce the stress response in trained animals only (Figure 6). This suggests that the aversive training renders the animals in a sensitive state, and conditions that hyper-activate the serotonergic neurons rapidly induce the stress response. Notably, only animals trained in the presence of the conditioned stimulus IAA entered this stress-prone state, whereas mock-trained animals, starved in the absence of IAA, were insensitive to serotonin. This implies that, in addition to AWCOFF, other neurons may be also recruited to integrate between the conditioned stimulus and the serotonergic signaling pathway. A similar neural deployment was found following hypoxia, where expression of the serotonin biosynthesis enzyme tph-1 substantially increased in the chemosensory neuron ASG to increase sensory acuity [51]. In summary, here we established that retrieval of stressful memories empowers animals with the valuable capacity to foresee future adversity and to prepare for it in advance. In addition, we delineated a core memory circuit that underlies this powerful ability, providing a mechanistic view for memory formation and retrieval.

STAR★Methods

Key Resources Table

Contact for Reagent And Resource Sharing

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Alon Zaslaver (alonzas@mail.huji.ac.il).

Experimental Model and Subject Details

C. elegans strains were maintained under standard conditions [54] on nematode growth medium agar plates, seeded with the OP50 E. coli strain, and grown in 20°C, unless otherwise indicated (for example, during training, or odor-evoking memory paradigms). The C. elegans Bristol isolate (N2) was used as the wild-type reference strain. A list of all other strains used in this study is available in the KEY resources table. To analyze the stress response, stress resistance, and other behavioral outputs, we used young adult (day 1-2) hermaphrodites.

Method Details

Training worms to associate an odor with starvation

We synchronized worm populations by bleaching gravid hermaphrodites using standard protocols [55], and seeded the eggs on NGM plates freshly-coated with OP50 bacteria. After ∼48 hours, when animals reached the L4 stage, we washed them off the plates with M9 buffer and repeated the wash three more times to discard bacterial residuals. We then transferred the washed animals to non-seeded (starvation) 50 mm NGM plates. These plates contained 2.5% agar to minimize worm burrowing into the agar. The worms were starved for 24 hours either in the presence of an odorant (trained animals) or in its absence (mock-trained animals). The odorant was added by applying 9 equally-distant drops (5 μL each) on the inside face of a plate lid, which was then used to cover the plate (see also Video S3). We used the following dilutions for the different odorants: 10−3 IAA, 10−3 diacetyl, 10−3 benzaldehyde, and 10−3 butanone. Following the association of the odors with starvation, we transferred the worms back to fresh OP50-seeded NGM plates for recovery (for either 4, 24 or 48 hours) before challenging them and quantifying the stress response. As a control, we also incubated well-fed worms (that remained on food) with IAA, and then transferred the animals to a fresh OP50-seeded NGM plate. After 24 hours without the odor, we challenged them with IAA (termed positively trained animals).

Quantifying stress response

To quantify induction of the stress response, we used worms expressing a translational fusion of the general stress response transcription factor DAF-16/FOXO: pdaf-16::DAF-16::GFP [21]. Following training (starvation+odor), we manually picked stressed animals based on the clear nuclear localization of DAF-16::GFP. After this 24 h training, > 97% of the animals had a systemic nuclear localization of DAF-16::GFP. Importantly, following the recovery period, and prior to challenging the animals with either odorants or by optogenetic means, we verified that worms had fully recovered from the starvation-induced stress. This was done by visualizing DAF-16::GFP spatial localization, verifying that it is smoothly distributed throughout the worm. The stress response following the challenge was scored as the change in percentage of stressed worms. A worm was identified as stressed, if we detected at least six cells with clear nuclear localization of the DAF-16::GFP protein (Figures 1D and 1E). Notably, each plate was blindly scored, and consisted of at least 50 animals that were manually scored under a fluorescent binocular (MVX10, Olympus) with a high-zoom magnification (X300). Importantly, each experiment (see all variations below) included four groups: trained and mock-trained groups, each divided into a group which was challenged (either with an odorant or optogenetically) and a group which was not challenged. The non-challenged groups served as a baseline control for the stress, and their scored values were subtracted from the challenged groups. Figure 2A shows an example of quantifying all four groups, and Figure 2B shows the quantification after the subtraction of the baseline group. From Figure 2B and on, we presented the results in this subtracted format: the mock-trained and the trained groups, where each group was already subtracted the values of the matching non-challenged (baseline) group. Notably, the stress scores of non-challenged groups (of either trained or mock-trained animals) was typically less than 5% (Figure 2A), and served as a control that the animals were not stressed due to various non-relevant reasons (e.g., worm handling, incubation etc.). Following subtraction of these low % levels of control groups, the overall change in % stress scores may become negative, but in fact, they reflect a ∼zero percent of stressed animals. In experiments which included subsequent light activation of ChR2, we recovered the animals from starvation on plates seeded with a concentrated drop of OP50, supplemented with ATR (100 μg/ml, Sigma). After the recovery period, blue light (488 nm) was delivered to the OP50 lawn for 20 minutes before scoring. The light source was the fluorescent binocular light source. Importantly, blue light itself was not stressful, as control animals that were trained and subsequently challenged with blue light in the absence of the cofactor ATR did not display nuclear DAF-16::GFP. In experiments which included neural inactivation via the histamine-gated chloride channel [32], we placed animals on plates spread with 10 mM histamine (Sigma). For inactivation during training, the worms were placed on starvation plates pre-spread with histamine only. The worms were then washed thoroughly (3 times) to verify removal of histamine before continuing with the experimental procedure. For inactivation during the challenge, the worms were placed on plates pre-seeded with OP50, mixed with 10 mM histamine. The worms absorbed the histamine for at least 40 minutes before applying the challenge. In experiments which included feeding the worms with serotonin, the worms were placed on plates pre-seeded with OP50 mixed with 10 mM serotonin creatinine sulfate (Sigma). The worms were first visualized and scored to verify DAF-16 did not translocate to nuclei due to animal transfer. The animals were then left to absorb the serotonin for 20 minutes after which we scored % of animals with nuclear localization of DAF-16. Importantly, for the tph-1(mg280) allele, we used the MT15434 strain which was backcrossed by the Horvitz lab to remove satellite mutations. When crossed with the DAF-16 translational fusion (zIs356), DAF-16 was normally distributed throughout the cytoplasm, and no nuclear localization was observed unless the animals were stressed.

Avoidance assays

We used WT N2 worms and trained them to form an associative aversive memory as described above. Following recovery, we picked individual trained animals, placed them on new unseeded plates, and allowed them to adjust for ∼2 minutes. When the worm initiated a long forward run, we spread a stripe of the odorant perpendicular and in front to its forward trajectory, using a single hair pre-dipped in the odorant solution (10−3). Worms that stopped next to the spread stripe and backed within three seconds were scored as ‘avoiding’; worms that only briefly stopped, or continued to crawl forward crossing the stripe were scored as ‘not avoiding’. Videos S1 and S2 demonstrate the experimental procedure and the typical observed behavior of trained and mock-trained animals.

Chemotaxis choice assays

For these assays we followed the protocols described in [56]. Briefly, we washed the worms twice with M9, and then once in chemotaxis medium (CTM). We then let the worms recover for 30 minutes, while preparing the assay chemotaxis plates (Figure S1A). ∼100 worms were then placed in the center of the plate and were allowed to crawl for 1 hour. We then counted the number of worms on each quarter of the plate, summing two opposite quarters together. Diacetyl preference was defined as the fraction of worms in the diacetyl quarters from the total number of worms in all quarters (Figure S1B).

Gene expression analysis using Real-Time PCR

Total RNA was extracted from ∼1000 worms. The worms were washed three times in M9 and one time in DEPC treated water, transferred into Sigma-Aldrich Tri-reagent and frozen in −80°C for at least 16 hours. Thawing was performed on ice with occasional vortexing. We then physically disrupted worms using 3 mm Nirosta beads and QIAGEN TissueLyser at a 50 oscillations/sec for 3 minutes. This was followed by a standard tri-reagent RNA purification protocol. RT-PCR was carried out using random primers, the iScript select kit (BioRad), and a Real-Time PCR machine (Applied Biosystems QuantStudio flex system). Gene expression level were normalized to actin (act-1) expression, and the fold-change relative to the basal expression levels of the gene following 24 hours of recovery from the starvation period was determined.

Fitness (survival) analysis

N2 WT worms were trained as indicated above. Following a recovery period of 24 hours, the worms were starved again in the presence of the training odorant for two hours. Worms were then transferred back to food and subjected to a 37°C heat shock for 4h. Since heat shock induces quiescence, it is difficult to assess mortality immediately after the heat shock. We therefore scored viability on the following day, when surviving animals were clearly motile, pumping, and responding to a touch with the pick. Animals not showing any of these features were scored as dead.

Neural activity measurements

The various GCaMP-expressing strains used herein were trained according to the procedure detailed above. To apply odorant stimuli in a precise on/off manner we used the ‘olfactory chip’ [57], and its operation was according to previous reports [28, 29, 57]. IAA (10−3) was used as the stimulant. We used an inverted epifluorescence microscope (ZX83, Olympus) and imaged at a magnification of x40 at a rate of 2 Hz. Custom-made MATLAB scripts were developed to analyze the Videos and extract neural activity. To plot the heat maps shown in Figure 3, we first subtracted the mean of the 10 s prior to the switch (−10 to 0) from the entire time-course activity. This filtered out possible stochastic activity just before switching between the conditions. The response activity was defined as the difference between the mean activity during the 10 s after the switch and the mean activity during the 10 s prior the switch (for the AWC neurons), and the difference between the 20 s after the switch and the 20 s prior to the switch in the case of ASH.

Quantification and Statistical Analysis

Statistical data regarding all experiments can be found in the figure legends of every experiment. All analyses were performed using the R statistical language in RStudio. To infer statistical significance when measuring the change in stress response between the different groups and conditions, we used a modified proportion test. In this statistical analysis, we considered two pairs of proportions , where each pair represents the proportion of stressed worms before (b) and after (a) the challenge of the two conditions (c1,c2) we compare (e.g., trained and mock trained). We tested whether the difference between the first condition proportions, namely , is likely to be sampled from the expected distribution of the difference between the second condition proportions, namely,. Formally, our null hypothesis is: Where is the total number of animals in this condition.
REAGENT or RESOURCESOURCEIDENTIFIER
Bacterial and Virus Strains

E. coli: OP50Caenorhabditis Genetics CenterRRID: WB-STRAIN:OP50

Chemicals, Peptides, and Recombinant Proteins

Histamine dihydrochlorideSigma-AldrichCAT#H7250
Serotonin creatinine sulfate monohydrateSigma-AldrichCAT#H7752
Isoamyl alcoholSigma-AldrichCAT# W205702
2-ButanoneSigma-AldrichCAT#360473
BenzaldehydeSigma-AldrichCAT#418099
Diacetyl (2,3-butanedione)Sigma-AldrichCAT# B85307
Tri-ReagentSigma-AldrichCAT#T9424
All trans-Retinal (ATR)Sigma-AldrichCAT#R2500

Critical Commercial Assays

Fast SYBR Green Master MixApplied BiosystemsCAT#4385610
iScript select kitBioRadCAT#1708891

Experimental Models: Organisms/Strains

C. elegans wild typeCaenorhabditis Genetics CenterRRID: WB-STRAIN:N2
TJ356: zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)][21]RRID: WB-STRAIN:TJ356
PS6374: pha-1(e2123ts); him-5 (e1490); syEx1240[str-2::GCaMP3+PHA-1][29]RRID: WB-STRAIN:PS6374
PS6253: pha-1(e2123ts); syEx1238[srsx-3::GCaMP3+ PHA-1][29]PS6253
PS6386: pha-1(e2123ts); syEx1246[sra-6::GCaMP3+ PHA-1][29]PS6386
ZAS53: lite-1(ce314); azrEx53[str-2::ChR2-cherry]This workZAS53
ZAS170: ZAS53 x TJ356This workZAS170
ZAS105: pha-1(e2123ts); lite-1(ce314); azrEx105[srsx-3::ChR2-cherry+ PHA-1]This workZAS105
ZAS234: ZAS105 x TJ356This workZAS234
ZAS46: pha-1(e2123ts); lite-1(ce314); azrEx46[sra-6::ChR2 + glr-3::GCaMP-3 + PHA-1]This workZAS46
ZAS279: pha-1(e2123ts); lite-1(ce314); azrEx279[str-2::HisCl1::SL2::NLS-mCherry + PHA-1]This workZAS279
ZAS271: ZAS279 x TJ356This workZAS271
ZAS253: pha-1(e2123ts); him-5(e1490); azrEx253[srsx-3::HisCl1::SL2::NLS-mCherry + PHA-1]This workZAS253
ZAS270: ZAS253 x TJ356This workZAS270
CX15206: (kyEx5104[pNP424 (sra-6::HisCl1::SL2::mCherry) + elt-2::mCherry])[32]CX15206
ZAS235: CX15206 x TJ356This workZAS235
ZAS205: tph-1(mg280); zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]This workZAS205
ZAS178: unc-31(e928); zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]This workZAS178
ZAS308: INV33009 (N2; Ex[ptph-1::TeTx-mCherry punc122::GFP] x TJ356[52]ZAS308
ZAS309: INV60006 (lite-1 (ce314); Ex[ptph-1::Chr2-mCherry punc-122::GFP]) x TJ356[52]ZAS309
INV60015: lite-1(ce314); somEx[stph-1::Chr2-mCherry unc-122::GFP]David BironINV60015
ZAS310: INV60015 x TJ356This workZAS310
INV60014: lite-1(ce314); somEx[srh-142::Chr2-mCherry, unc-122::GFP]David BironINV60014
ZAS311: INV60014 x TJ356This workZAS311
ZAS381: crh-1(tz2);zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]This workZAS381

Oligonucleotides

Primer act-1 fwd: GAGCACGGTATCGTCACCAA[53]N/A
Primer act-1 rev: TGTGATGCCAGATCTTCTCCAT[53]N/A
Primer hsp-12.6 fwd: TTCCAGTGATGGCTGACG[53]N/A
Primer hsp-12.6 rev: GGCTTCTAGGCCTACTTCG[53]N/A
Primer mtl-1 fwd: AGTGTGACTGCAAAAACAAGCAA[26]N/A
Primer mtl-1 rev: TCCACTGCATTCACATTTGTCTC[26]N/A
Primer cpr-2 fwd: CTGCGTAAACCTTCAAACTC[26]N/A
Primer cpr-2 rev: ATGCGGAGTTACCATAGTTC[26]N/A
Primer sod-3 fwd: CTAAGGATGGTGGAGAACCTTCA[53]N/A
Primer sod-3 rev: CGCGCTTAATAGTGTCCATCAG[53]N/A

Software and Algorithms

R Project for Statistical ComputingThe R FoundationRRID: SCR_001905
RStudio Version 1.1.419RStudio Team (2015)RRID: SCR_000432
MATLAB R2012bMathWorksRRID: SCR_001622
ImageJFijiRRID: SCR_003070
  55 in total

1.  Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans.

Authors:  Coleen T Murphy; Steven A McCarroll; Cornelia I Bargmann; Andrew Fraser; Ravi S Kamath; Julie Ahringer; Hao Li; Cynthia Kenyon
Journal:  Nature       Date:  2003-06-29       Impact factor: 49.962

2.  A CaMK cascade activates CRE-mediated transcription in neurons of Caenorhabditis elegans.

Authors:  Yoshishige Kimura; Ethan E Corcoran; Koh Eto; Keiko Gengyo-Ando; Masa-Aki Muramatsu; Ryoji Kobayashi; Jonathan H Freedman; Shohei Mitani; Masatoshi Hagiwara; Anthony R Means; Hiroshi Tokumitsu
Journal:  EMBO Rep       Date:  2002-09-13       Impact factor: 8.807

Review 3.  An elegant mind: learning and memory in Caenorhabditis elegans.

Authors:  Evan L Ardiel; Catharine H Rankin
Journal:  Learn Mem       Date:  2010-03-24       Impact factor: 2.460

Review 4.  Maintenance of C. elegans.

Authors:  Theresa Stiernagle
Journal:  WormBook       Date:  2006-02-11

Review 5.  Chemosensation in C. elegans.

Authors:  Cornelia I Bargmann
Journal:  WormBook       Date:  2006-10-25

6.  Neuronal serotonin release triggers the heat shock response in C. elegans in the absence of temperature increase.

Authors:  Marcus C Tatum; Felicia K Ooi; Madhusudana Rao Chikka; Laetitia Chauve; Luis A Martinez-Velazquez; Harry W M Steinbusch; Richard I Morimoto; Veena Prahlad
Journal:  Curr Biol       Date:  2014-12-31       Impact factor: 10.834

7.  In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents.

Authors:  Massimo A Hilliard; Alfonso J Apicella; Rex Kerr; Hiroshi Suzuki; Paolo Bazzicalupo; William R Schafer
Journal:  EMBO J       Date:  2004-12-02       Impact factor: 11.598

8.  Differential regulation of the heat shock factor 1 and DAF-16 by neuronal nhl-1 in the nematode C. elegans.

Authors:  Yuli Volovik; Lorna Moll; Filipa Carvalhal Marques; Moria Maman; Michal Bejerano-Sagie; Ehud Cohen
Journal:  Cell Rep       Date:  2014-12-11       Impact factor: 9.423

9.  Microfluidics for in vivo imaging of neuronal and behavioral activity in Caenorhabditis elegans.

Authors:  Nikos Chronis; Manuel Zimmer; Cornelia I Bargmann
Journal:  Nat Methods       Date:  2007-08-19       Impact factor: 28.547

Review 10.  Serotonin circuits and anxiety: what can invertebrates teach us?

Authors:  Kevin P Curran; Sreekanth H Chalasani
Journal:  Invert Neurosci       Date:  2012-08-24
View more
  4 in total

1.  Toxic stress-specific cytoprotective responses regulate learned behavioral decisions in C. elegans.

Authors:  Gábor Hajdú; Eszter Gecse; István Taisz; István Móra; Csaba Sőti
Journal:  BMC Biol       Date:  2021-02-09       Impact factor: 7.431

2.  C. elegans as a test system to study relevant compounds that contribute to the specific health-related effects of different cannabis varieties.

Authors:  Monique van Es-Remers; Jesus Arellano Spadaro; Eefje Poppelaars; Hye Kyong Kim; Marieke van Haaster; Marcel de Wit; Eva ILiopoulou; Marjolein Wildwater; Henrie Korthout
Journal:  J Cannabis Res       Date:  2022-10-03

3.  A cellular defense memory imprinted by early life toxic stress.

Authors:  Eszter Gecse; Beatrix Gilányi; Márton Csaba; Gábor Hajdú; Csaba Sőti
Journal:  Sci Rep       Date:  2019-12-12       Impact factor: 4.379

Review 4.  Biomolecular Basis of Cellular Consciousness via Subcellular Nanobrains.

Authors:  František Baluška; William B Miller; Arthur S Reber
Journal:  Int J Mol Sci       Date:  2021-03-03       Impact factor: 5.923

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.