Yoko Yamada1, Pauline Schaap2. 1. School of Life Sciences, University of Dundee, DD15EH, Dundee, UK. 2. School of Life Sciences, University of Dundee, DD15EH, Dundee, UK. Electronic address: p.schaap@dundee.ac.uk.
Abstract
Dictyostelium discoideum amoebas display colonial multicellularity where starving amoebas aggregate to form migrating slugs and fruiting bodies consisting of spores and three supporting cell types. To resolve the cell signalling mechanism that control sporulation, we use insertional mutagenesis of amoebas transformed with fusion constructs of spore genes and red fluorescent protein. We identified the defective gene in a mutant lacking spore gene expression as the autophagy gene Atg7. Directed knock-out of atg7 and of autophagy genes like atg5 and atg9 yielded a similar phenotype, with lack of viable spores and excessive differentiation of stalk cells. The atg7-, atg5- and atg9- cells were specifically defective in cAMP induction of prespore genes, but showed enhanced cAMP stimulation of prestalk genes at the same developmental stage. The lack of prespore gene induction in the autophagy mutants was not due to deleterious effects of loss of autophagy on known components of the cAMP pathway, such as cAMP receptors and their cAMP-induced phosphorylation and internalization, PKA and the transcription factors SpaA and GbfA, or to lack of NH3 production by proteolysis, which was previously suggested to stimulate the spore pathway. Our continued mutagenesis approach is the most likely to yield the intriguing link between autophagy and prespore gene induction.
Dictyostelium discoideum amoebas display colonial multicellularity where starving amoebas aggregate to form migrating slugs and fruiting bodies consisting of spores and three supporting cell types. To resolve the cell signalling mechanism that control sporulation, we use insertional mutagenesis of amoebas transformed with fusion constructs of spore genes and red fluorescent protein. We identified the defective gene in a mutant lacking spore gene expression as the autophagy gene Atg7. Directed knock-out of atg7 and of autophagy genes like atg5 and atg9 yielded a similar phenotype, with lack of viable spores and excessive differentiation of stalk cells. The atg7-, atg5- and atg9- cells were specifically defective in cAMP induction of prespore genes, but showed enhanced cAMP stimulation of prestalk genes at the same developmental stage. The lack of prespore gene induction in the autophagy mutants was not due to deleterious effects of loss of autophagy on known components of the cAMP pathway, such as cAMP receptors and their cAMP-induced phosphorylation and internalization, PKA and the transcription factors SpaA and GbfA, or to lack of NH3 production by proteolysis, which was previously suggested to stimulate the spore pathway. Our continued mutagenesis approach is the most likely to yield the intriguing link between autophagy and prespore gene induction.
Autophagy is an ancient survival strategy that allows eukaryotic cells to survive starvation by enclosing and digesting cytosolic components and organelles. A large number of genes required for autophagy were initially identified in yeast and many proved to be deeply conserved in animals, plants and other eukaryotes. At the structural level, autophagy initiates with the formation of crescent-shaped double-membraned structures called phagophores, which enclose cellular contents and fuse at their termini to form an autophagosome vesicle. The autophagosome subsequently fuses with a primary lysosome to form an autolysosome where both the inner membrane and captured cargo are degraded and the catabolites are fed back into the cell by integral membrane permeases. At the molecular level, autophagy initiates when amino acid starvation blocks phosphorylation of Atg13 by the Target of Rapamycin C1 (TORC1) kinase, which prevents Atg13 from forming a complex with Atgs 1, 17, 29 and 31 and to initiate a phagophore assembly site (PAS). The phosphatidylinositol 3-kinase (PtdIns3K) complex consisting of Vps34, Vps15, Atg6, Atg14 and Atg38 generates PIP3 at the PAS, which recruits Atg18 and Atg2 to the PAS and in turn Atg9, Atg8 and Atg12. The transmembrane protein Atg9 and its associates Atgs11, 23 and 27 direct membrane to the PAS to cause phagophore expansion. Two ubiquitin-like conjugation systems composed of Atgs 5, 7, 10, 12 and 16 and Atgs 3, 4, 7 and 8 further regulate vesicle expansion (Feng et al., 2014; Mizushima et al., 2011; Yin et al., 2016).Autophagy is also important for the multicellular life cycle of Dictyostelium amoebas, which survive starvation by aggregating to form fruiting bodies with dormant spores and dead stalk cells. Autolysosomes appear within 2 h of starvation and increase in number during aggregation. Thereafter, autolysomes become less prominent in the presumptive spore cells and more numerous in the prestalk cells, where they finally fuse to form the plant-like vacuole of the stalk cells (Schaap, 1983; Schaap et al., 1981; Uchikawa et al., 2011). As a genetic model D. discoideum is particularly suitable for identification of essential components of the autophagy pathway, and up to date the roles of many components were identified, such as Atgs 1 and 13 of the Atg1 complex, Vps34, Vps15 and Atg14 of the PtdIns3K complex, Atgs 2 and 18 of the PIP3 binding complex, Atg9 of the membrane trafficking system, Atgs 5, 7, 10, 12 and 16/tipD of one and Atgs 3, 4, 7 and 8 of the other ubiquitin-like conjugation complex, as well as a homolog of the mammalian autophagy gene Atg101, a member of the Atg1 complex (Calvo-Garrido et al., 2010; Mesquita et al., 2017). Studies in Dictyostelium identified a role for Vmp1 and Vps13A/tipC in autophagy (Muñoz-Braceras et al., 2015) and revealed novel autophagy genes such as the autophagy inhibitors areA and areB (Mesquita et al., 2015).Deletion of most of these genes prevent autophagosome formation and block autophagy mediated proteolysis. Lesions in atg1, atg13 and vmp1 yield the most severe phenotype with cells failing to aggregate upon starvation and, for atg1- and vmp1-cells, to differentiate into stalk cells in vitro. Deletions of other autophagy genes, such atgs 5, 7, 8, 9, 16/tipD, 101 and vps13A/tipC yield amoebas that can aggregate, but thereafter show delayed and abnormal development. Instead of one sorogen or slug, the aggregate gives rise to multiple small ones, which eventually turn into fruiting bodies with abnormal spores (Calvo-Garrido et al., 2010; Mesquita et al., 2017).We investigate the signalling pathways that control prespore and spore differentiation and use mutagenesis of amoebas transformed with an mRFP tagged spore coat gene to identify pathway components. We recovered a mutant defective in sporulation, but overproducing stalk cells. The genetic lesion occurred in the atg7 gene and further analysis of a re-created atg7 knockout and knock-outs in atg5 and atg9 revealed that these genes were specifically required for induction of prespore gene expression, but dispensable for stalk cell differentiation in vivo and in vitro.
Materials and methods
Cell culture
Dictyostelium discoideum Ax2 was cultured either in HL5 axenic medium (Formedium, UK) or on SM agar plates in association with Klebsiella aerogenes. For development, cells were distributed at 2.5 × 106 cells/cm2 on non-nutrient agar and for β-galactosidase staining on dialysis membrane supported by non-nutrient agar. atg9- cells (Tung et al., 2010) were obtained from the Dicty stock center http://dictybase.org/StockCenter/StockCenter.html.
Knock-out and expression constructs
To generate an atg7 knock-out vector, 5′ and 3′ fragments of the genomic region containing the atg7 gene were amplified using primer pairs atg7-5′f/atg7-5′r and atg7-3′f/atg7-3′r (Table 1), respectively, subcloned into vector pJet1.2blunt, and cloned into plasmid pLPBLP (Faix et al., 2004) using pstI/BamHI for the 5′ fragment and HindIII/SalI for the 3′ fragment respectively. The pLPBLP–atg7KO vector was linearised with ScaI and transformed into Ax2 cells.
Table 1
Oligonucleotide primers used for plasmid constructs.
atg5-5′f
ggatccCGTACCAATCGATTCAACTC
atg5-5′r
ctgcagCACCTATAGGTAAATGCCAC
atg5-3′f
aagcttCCCAATTCAAGAACTAATACCAG
atg5-3′r
gtcgacCCACAACCACTACTGCAAC
atg5KO1
CAATCAAATGATCTTTGGGATGG
atg5KO2
CAGGTTCAGCTGATTCCAC
atg5KO3
CTGGTTGAAGGTTTCGATAGAC
atg7-5′f
ggatccGACGAAACGACTTATAGTCC
atg7-5′r
ctgcagGTTGAATTGGTTGTGATGG
atg7-3′f
aagcttGGGTTTCGACTCTTATCTAG
atg7-3′r
gtcgacGGTCCAAGCACGTGAGGG
atg7KO1
GCCAGGTCATTCCGTACCTC
atg7KO2
GATGGCATAACTCTCCATCTC
atg7KO3
CTGTAGGCTCAAATGCTGAAG
Bsr-r
GCCGCTCCCACATGATG
Bsr-f
GTGGTAAGTCCTTGTGG
atg7-f
gaattcATGACAAATACACTTCAGTTTAAAG
atg7-r
atcgatATCATCAGAAATATCAATATCCC
atg7_mf
GATCAAATGGCTACCGTTACTAGAC
atg7_mr
CTAGTAACGGTAGCCATTTGATCTAAAG
YFP-f
CCGACAACCACTACCTGAGCTA
2Hterm-r
GGATCACTTGATTCTTCATCGGATC
Oligonucleotide primers used for plasmid constructs.To generate an atg5 knock-out vector, 5′ and 3′ fragments of genomic region of the atg5 gene was amplified using primer pairs atg5-5′f/atg5-5′r and atg5-3′f/atg5-3′r (Table 1), subcloned into pJet1.2blunt and cloned into pLPBLP using pstI/BamHI and HindIII/SalI digestion. The BamHI/SalI fragment was excised from the vector and transformed into Ax2. Transformants were selected at 10 μg/ml blasticidin and diagnosed for atg7 or atg5 gene disruption by two PCR reactions (Fig. 1).
Fig. 1
Knockout of . A, B. Constructs. Diagram of the atg7 (A) and atg5 (B) genes and their knockout constructs with the blasticidin resistant cassette (Bsr). Arrows indicate the position of the primers used in verification of the knockout clones. C, D. Diagnosis. Genomic DNA was prepared from clonal isolates of Ax2 transformed with the knockout construct for atg7 (C) or atg5 (D), and analysed by PCR. Primer pair atg7KO1 and KO2 amplifies a 1.5 kb fragment from random integrants only, whereas primer pair atg7KO3 and Bsr-r amplifies a 1.9 kb fragment from knockout clones (C). Primer pair atg5KO1 and KO2 amplifies a 0.5 kb fragment from random integrants, while primer pair atg5KO3 and Bsr-f amplifies a 2 kb fragment from knockout clones (D).
Knockout of . A, B. Constructs. Diagram of the atg7 (A) and atg5 (B) genes and their knockout constructs with the blasticidin resistant cassette (Bsr). Arrows indicate the position of the primers used in verification of the knockout clones. C, D. Diagnosis. Genomic DNA was prepared from clonal isolates of Ax2 transformed with the knockout construct for atg7 (C) or atg5 (D), and analysed by PCR. Primer pair atg7KO1 and KO2 amplifies a 1.5 kb fragment from random integrants only, whereas primer pair atg7KO3 and Bsr-r amplifies a 1.9 kb fragment from knockout clones (C). Primer pair atg5KO1 and KO2 amplifies a 0.5 kb fragment from random integrants, while primer pair atg5KO3 and Bsr-f amplifies a 2 kb fragment from knockout clones (D).To generate wild-type and mutant atg7 expression constructs, the act15p-YFP fragment of pDd-NYFP was cloned into pExp4-Hyg (Yamada et al., 2018) using SalI/XhoI to generate Dd-NYFP-Hyg. The atg7 coding region was amplified from genomic DNA of Ax2 with primers atg7-f and atg7-r (Table 1), subcloned into pJet1.2blunt, and cloned into Dd-NYFP-Hyg with EcoRI/ClaI to create act15p-YFP-atg7. To generate a Cys563 to Ala point mutation, 5′ and 3′ atg7 fragments were amplified from act15p-YFP-atg7 using primers YFP-f and atg7-mr and atg7-mf and 2Hterm-r (Table 1). After annealing the fragments, atg7Cys563Ala was amplified with atg7-f and atg7-r and cloned into Dd-NYFP-Hyg using EcoRI/ClaI. Constructs were transformed into atg7- cells by electroporation and transformants were selected at 30 μg/ml hygromycin.
Western analysis of expressed proteins
Cells were lysed in SDS-sample buffer, proteins were separated on 4–12% polyacrylamide gels (Thermo Fisher Scientific, Whaltham, MA), transferred to nitrocellulose and probed with anti-GFP antibody (Roche Applied Science, Penzberg, Germany), followed by HRP-conjugated anti-mouse antibody. YFP-positive bands were detected using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific, Whaltham, MA).
In vitro induction of stalk cell differentiation
Cells harvested from growth medium were resuspended in stalk salts (10 mM MES buffer pH 6.2, 10 mM KCl, 2 mM NaCl, 1 mM CaCl2) at 2 × 105 cells/ml and distributed as 1.25 ml aliquots in a 6-well culture dish. After 2 h at 22 °C, medium was supplemented with 1 mM cAMP, and after further incubation of 6–7 h, the medium was replaced with stalk salts containing 100 nM DIF-1 (Enzo biochem, New york). After further incubation for 16–23 h, vacuolation of the cells was examined by phase contrast microscopy.
Induction of developmental gene expression
For induction of prespore genes, cells were developed on non-nutrient agar at 12 °C overnight and then at 22 °C for a few hours until loose mounds had formed. Mounds were then dissociated, resuspended to 5 × 106 cells/ml in 1 mM MgCl2 in KK2 (20 mM potassium phosphate buffer, pH 6.2) and incubated in the presence and absence of 1 mM cAMP. For induction of ecmA, dissociated loose mound cells were resuspended in stalk salts at 3 × 106 cells/ml and shaken with or without 1 mM cAMP and 100 nM DIF-1. For induction of cprB, cells were starved at 4 °C overnight to induce aggregation competence and then shaken at 3 × 106 cells/ml in KK2 with or without 1 mM cAMP. For all genes, cells were incubated with cAMP and/or DIF-1 for 4 h at 22 °C and subsequently harvested for RNA isolation. The transcript levels of the different genes were analysed by RT-qPCR using the primers listed in Table 2 as described previously (Yamada et al., 2018).
Table 2
Oligonucleotide primers used for qRT-PCR.
cotC-f
GAAAGACGTGGTGGTATC
cotC-r
TTGCATCTTGGAAGTCATC
pspA-f
GCACTCGGTTCTGATTGGAG
pspA-r
GATGTTTGGGATGGGGTTGG
cprB-f
GAGAATGGTGCTCAACATGG
cprB-r
CTGGACCTTCATCATCTTTACC
ecmA-f
CCGTAAACTGTGAATGTGATGACC
ecmA-r
GTCTTGGAATCGCAACTATCAGC
spaA-f
CACCAGGATCAACAATGGG
spaA-r
AACGGTCGGTAAGGATATCG
gbfA-f
TCAACCTCTGTATCATGTCC
gbfA-r
ATGGTGAAAGTCCTGCACC
Ig7-f
AACAGCTATCACCAAGCTTGATTAGCC
Ig7-r
TTACATTTATTAGACCCGAAACCAAGCG
carA-f
GGATCCGGTCTTTTAGATGGAAATCCAG
carA-r
TCAACACTGCCATACAACCC
Oligonucleotide primers used for qRT-PCR.To induce and assay cotC-gal, cells from dissociated loose mounds were resuspended at 3 × 106 cells/ml in 1 mM MgCl2 in KK2 and shaken for 6 h as 80 μl aliquots in microtiter plates. Cells were lysed by freeze-thawing, supplemented with 20 μl of 5x assay buffer (500 mM NaH2PO4/Na2HPO pH 7, 50 mM KCl, 5 mM MgSO4, 2 mM MgCl2, 2% β-mercaptoethanol and 5 mM chlorophenol red-β-D-galactopyranoside) and incubated at room temperature. OD574 was measured at regular intervals using a microtiter plate reader.Visualization of β-galactosidase expression in intact structures was performed using established procedures (Dingermann et al., 1989).
Results
Lesion of Atg7 impairs spore but not stalk differentiation in D. discoideum
In order to identify genes that control Dictyostelium sporulation, we performed REMI mutagenesis on Ax2 cells transformed with a fusion construct of mRFP and the spore coat gene cotC, expressed from its own promoter (Yamada et al., 2018) and screened for mutants with spore defects. CotC-mRFP is localized to Golgi-derived prespore vesicles in prespore cells and is exocytosed during fruiting body formation to be incorporated into the spore wall. We isolated a clone 10va3, which failed to form spores. The cells were slightly (∼1 h) delayed in aggregation and more strongly in post-aggregative development, forming mounds with multiple early sorogens (a.k.a. first fingers) at 19 h, when the parental cells had nearly completed fruiting body formation (Fig. 2A). Expression of cotC-mRFP was undetectable in sorogens (Fig. 2B), suggesting that prespore differentiation is altered. The 10va3 sorogens eventually formed small fruiting bodies at 45 h on top of a basal cell mass, but cells in their spore heads were mostly round rather than elliptical as is the case for spores, and were not labelled with cotC-mRFP (Fig. 2C). Stalks contained vacuolated cells and thus stalk cell differentiation did not seem to be disturbed.
Fig. 2
Identification of atg7 by REMI mutagenesis and validation by gene knock-out. A-C. Phenotype of parental strain Ax2/cotC-mRFP and REMI clone 10va3. A. Developing structures at 19 h and 45 h. Bar: 200 μm. B. Sorogens were photographed under phase contrast and epifluorescence. Bar: 100 μm. C. Spores of terminal structures under phase contrast (top) and epifluorescence (bottom) illumination. Bar: 10 μm. D-F. Phenotype of the recapitulated atg7 knockout. Developing Ax2 and atg7- structures were photographed in situ (D) at 16, 24 and 46 h, or in case of atg7- also squashed under a coverslip (E). Bar: 50 μm. F. Spores and stalks from mature Ax2 and atg7- fruiting structures, stained with 0.002% Calcofluor and photographed under phase contrast and epifluorescence. Bar 10 μm.
Identification of atg7 by REMI mutagenesis and validation by gene knock-out. A-C. Phenotype of parental strain Ax2/cotC-mRFP and REMI clone 10va3. A. Developing structures at 19 h and 45 h. Bar: 200 μm. B. Sorogens were photographed under phase contrast and epifluorescence. Bar: 100 μm. C. Spores of terminal structures under phase contrast (top) and epifluorescence (bottom) illumination. Bar: 10 μm. D-F. Phenotype of the recapitulated atg7 knockout. Developing Ax2 and atg7- structures were photographed in situ (D) at 16, 24 and 46 h, or in case of atg7- also squashed under a coverslip (E). Bar: 50 μm. F. Spores and stalks from mature Ax2 and atg7- fruiting structures, stained with 0.002% Calcofluor and photographed under phase contrast and epifluorescence. Bar 10 μm.Sequencing of the genomic region flanking the inserted plasmid showed that the insertion in clone 10va3 occurred at a BamHI site in the atg7 gene. Knock-out of the atg7 gene was reported previously to result in loss of autophagy, formation of multi-tipped aggregates and defective spore differentiation (Otto et al., 2003), but a role for Atg7 in prespore gene expression was not reported. In addition, the formation of seemingly normal stalks in 10va3 was unexpected, since the autophagy gene atg1 is essential for stalk cell differentiation in vitro (Kosta et al., 2004). To analyse the role of Atg7 in cell differentiation in more detail, we created an atg7 knock-out by deleting a central region of the gene that contained about half of its Atg7-N and ThiF domains (Fig. 1A,C).The atg7- cells recapitulated the phenotype of clone 10va3 (Fig. 2D–F). Development was delayed several hours compared to parental Ax2 cells, but atg7- cells eventually formed small fruiting bodies with a thickened lower part. In contrast to the elliptical phase bright spores of Ax2, cells in atg7- spore heads were round and often phase dark. Most of these cells were not stained with calcofluor, a cellulose binding dye, although a fraction showed weak staining (Fig. 2F). Quantitation showed that only 6% of atg7- cells produced detergent resistant spores, of which 1/3rd germinated to yield viable amoebas (Table 3). Malformation of the fruiting body and poor sporulation are consistent with the previously described insertion mutant of atg7- (Otto et al., 2003). We also confirmed that spore defects are cell-autonomous, since the atg7- cells did not form viable spores when mixed with Ax2 (Table 3).
Table 3
Spore production in atg7- cells.
strain
time (h)
detergent resistant cells (%)a
germinating spores (%)b
overall viable spores (%)c
Ax2
25
149 ± 4
85 ± 7
127 ± 13
atg7-
43–49
6 ± 6
32 ± 31
2 ± 1
1:1 Ax2/atg7-
25
89 ± 50
76 ± 19 (All Ax2)d
Ax2, atg7- and a 1:1 mixture of AX2 and atg7- cells were plated on 1 cmb nitrocellulose filters supported by NN agar at 2.5 × 106 cells per filter. Filters were vortexed with 0.1% Triton-X100 when fruiting bodies had formed.
Detergent resistant spores were counted and data are expressed as percentage of the plated cell number. Ax2 cells show >100% spores due to some cell division occurring during development.
The detergent resistant spores were clonally plated on bacterial lawns, after 2–5 days emerging plaques were counted and expressed as percentage of the plated spores.
The overall percentage of viable spores was determined as (fraction of triton-resistant x fraction of germinated spores) x 100.
The genotype of the germinated spores was evaluated from the developmental phenotype.
Spore production in atg7- cells.Ax2, atg7- and a 1:1 mixture of AX2 and atg7- cells were plated on 1 cmb nitrocellulose filters supported by NN agar at 2.5 × 106 cells per filter. Filters were vortexed with 0.1% Triton-X100 when fruiting bodies had formed.Detergent resistant spores were counted and data are expressed as percentage of the plated cell number. Ax2 cells show >100% spores due to some cell division occurring during development.The detergent resistant spores were clonally plated on bacterial lawns, after 2–5 days emerging plaques were counted and expressed as percentage of the plated spores.The overall percentage of viable spores was determined as (fraction of triton-resistant x fraction of germinated spores) x 100.The genotype of the germinated spores was evaluated from the developmental phenotype.Similar to clone 10va3, the atg7- fruiting bodies formed a stalk that penetrated the (pre)spore cell mass and connected to the basal cell mass (Fig. 2E and F). The cells inside the stalk were highly vacuolated and encapsulated in cellulose, although arrangement of the atg7- stalk cells was somewhat irregular compared to wild type. The cells in the expanded bottom region of the stalk eventually also vacuolated. These results show that Atg7 is essential for sporulation, while it is dispensable for stalk cell differentiation.The earlier reports describing requirement for the autophagy protein Atg1 in stalk cell differentiation were based on cells differentiating in a monolayer in the presence of the polyketide DIF-1 (Kosta et al., 2004). To test whether Atg7 is required under these conditions, we rendered atg7- cells in monolayers competent to DIF-1 by pre-incubation with cAMP (Berks and Kay, 1990) and then stimulated cells with DIF-1. In contrast to atg1- cells (Kosta et al., 2004), atg7- and Ax2 cells readily vacuolated in response to DIF-1 (Fig. 3), although most vacuoles of the atg7- cells appeared to contain more material than those of Ax2. Both strains remained amoeboid in the absence of DIF-1. Apparently, Atg7 is not required for DIF-induced stalk cell vacuolation in vitro.
Fig. 3
Stalk cell induction . Ax2 and atg7- cells were pre-incubated for 6 h with 1 mM cAMP. After removal of cAMP, cells were incubated for 23 h with 100 nM DIF-1. Control cells received the DIF-1 solvent, 0.1% ethanol. About 70 cells per sample were photographed, with representative images shown in (A). Some of the typical stalk cell vacuoles are indicated by arrows. Bar: 20 μm. B. Percentages of vacuolated over total cells were determined from images. Means and SD of three experiments. Values for DIF-treated cells were not statistically different between Ax2 and atg7- (t-test, P = 0.46).
Stalk cell induction . Ax2 and atg7- cells were pre-incubated for 6 h with 1 mM cAMP. After removal of cAMP, cells were incubated for 23 h with 100 nM DIF-1. Control cells received the DIF-1 solvent, 0.1% ethanol. About 70 cells per sample were photographed, with representative images shown in (A). Some of the typical stalk cell vacuoles are indicated by arrows. Bar: 20 μm. B. Percentages of vacuolated over total cells were determined from images. Means and SD of three experiments. Values for DIF-treated cells were not statistically different between Ax2 and atg7- (t-test, P = 0.46).
Expression of cell type markers in atg7-
The lack of cotC-mRFP expression in 10va3 sorogens (Fig. 2B) suggests that the abolished spore production is due to defective prespore differentiation. To examine cell differentiation in more detail, we transformed Ax2 and atg7- cells with fusion constructs of cell type specific promoters and the LacZ reporter gene (gal). The transformants were developed to early and late sorogens and fruiting bodies, and stained with X-gal to visualize β-galactosidase expression.The prespore marker cotC-gal is expressed strongly in the posterior prespore region of Ax2 early culminants at 17 h, but at 17 and 24 h expression of cotC-gal in atg7- was very low and only detectable after prolonged staining with X-gal (Fig. 4A). At 24 h, cotC-gal expression was still very weak and confined to a short central region of the sorogen. In atg7- fruiting bodies, some cotC-gal expression was detected in the abnormal spores of the spherical heads. The prestalk markers ecmA-gal and ecmB-gal were expressed in the primary stalks of atg7- fruiting structures at about the same levels as in Ax2 cells. The vacuolating cell masses at the base of the atg7- stalks only started to express the prestalk markers very late in fruiting body formation (Fig. 4B and C). Due to the overall delayed developmental programme of atg7-, its fruiting bodies started to form about 7 h later than in the Ax2 parent.
Fig. 4
Expression pattern of cell-type markers in . Ax2 and atg7- cells, transformed with cotC-gal (A), ecmA-gal (B) or ecmB-gal (C) were incubated on dialysis membrane supported by non-nutrient agar for the time periods shown above the images. Structures were fixed and stained with X-gal for 30 min at 22 °C for all structures, and also for 4 h at 37 °C for atg7-/cotC-gal structures as shown inside the images. Bar: 50 μm.
Expression pattern of cell-type markers in . Ax2 and atg7- cells, transformed with cotC-gal (A), ecmA-gal (B) or ecmB-gal (C) were incubated on dialysis membrane supported by non-nutrient agar for the time periods shown above the images. Structures were fixed and stained with X-gal for 30 min at 22 °C for all structures, and also for 4 h at 37 °C for atg7-/cotC-gal structures as shown inside the images. Bar: 50 μm.
Induction of post-aggregative genes by cAMP in atg7-
Prespore differentiation requires cAMP in the micromolar range acting on cell surface receptors (cARs) (Schaap and Van Driel, 1985; Wang et al., 1988a), and for many prespore genes, also intracellular cAMP acting on PKA (Hopper and Williams, 1994). Very low cotC expression in atg7- slugs (Fig. 4) prompted us to examine whether prespore gene induction by cAMP was impaired. Transcripts of the prespore genes cotC and pspA, but not of the constitutively expressed gene Ig7, strongly increased after 4 h of incubation with 1 mM cAMP in differentiation competent Ax2 cells, but remained low in competent atg7- cells and in the absence of cAMP (Fig. 5A,D). To assess whether defective cAMP induction of atg7- cells was specific to prespore genes, we also tested the prestalk gene ecmA and the prestalk-enriched gene cprB (CP2). CprB requires only cAMP for induction (Pears et al., 1985) and was induced in both Ax2 and atg7- cells, albeit that induction in atg7- was 40% lower than in Ax2 (Fig. 5B). EcmA is reported to require DIF-1 in addition to cAMP (Berks and Kay, 1990), and while effects of DIF-1 alone on ecmA induction were weak (Fig. 5C), induction by cAMP plus DIF-1 was high in both Ax2 and atg7- cells. These experiments show that atg7- cells are specifically defective in cAMP induction of prespore gene expression.
Fig. 5
Induction of cell type-specific genes by cAMP in . Ax2 and atg7- cells were developed into loose mounds (overnight at 12 °C) for prespore and ecmA induction or starved overnight at 4 °C for cprB induction. Aggregates were dissociated and cells were shaken in suspension with or without 1 mM cAMP and/or 100 nM DIF-1 as indicated. After 4 h, RNA was isolated and transcript levels were analysed by RT-qPCR, using primers specific for cotC and pspA (A), cprB (B) and ecmA (C). The RNAs from all different experiments were also probed with the constitutively expressed gene Ig7 (D). Data are expressed relative to expression in Ax2 in the presence of cAMP. Means and SD of three experiments, assayed with technical duplicates are presented. P-values of t-tests comparing cAMP-induced levels of the different genes between Ax2 and atg7- are shown underneath large brackets.
Induction of cell type-specific genes by cAMP in . Ax2 and atg7- cells were developed into loose mounds (overnight at 12 °C) for prespore and ecmA induction or starved overnight at 4 °C for cprB induction. Aggregates were dissociated and cells were shaken in suspension with or without 1 mM cAMP and/or 100 nM DIF-1 as indicated. After 4 h, RNA was isolated and transcript levels were analysed by RT-qPCR, using primers specific for cotC and pspA (A), cprB (B) and ecmA (C). The RNAs from all different experiments were also probed with the constitutively expressed gene Ig7 (D). Data are expressed relative to expression in Ax2 in the presence of cAMP. Means and SD of three experiments, assayed with technical duplicates are presented. P-values of t-tests comparing cAMP-induced levels of the different genes between Ax2 and atg7- are shown underneath large brackets.
Is defective sporulation the result of reduced autophagy in atg7-?
The requirement of Atg7 for cAMP induction of prespore gene expression suggests that autophagy is required for gene regulation. However, a role for Atg7, independent of autophagy, was shown in starving mouse fibroblasts, where binding of Atg7 to the p53tumour suppressor was required for normal cell cycle arrest. This effect did not require the E1-like enzyme activity of Atg7, which mediates its role in autophagy (Lee et al., 2012). To assess whether the effects of loss of Atg7 in Dictyostelium are independent from its role in autophagy, we complemented the atg7- mutant with both intact Atg7 and Atg7 harbouring a Cys563 to Ala mutation, which abolishes its E1-like enzyme activity. Fig. 6 shows that only intact Atg7 restores normal fruiting body formation and sporulation in the atg7- mutants, indicating that the E1-like enzyme activity of Atg7 is required for sporulation.
Fig. 6
Complementation of . Atg7- cells were transformed with a fusion construct of the actin15 promoter and the YFP and atg7 coding sequences (act15p-YFP-atg7) or with act15p-YFP-atg7 harbouring a Cys563 to Ala mutation that deletes the Atg7 E1-like ligase activity. A,B. Cells were developed for 23 h and 41 h and structures were photographed in situ (A) or squashed below a coverslip (B). C. Cells from the spore head were also stained with 0.002% Calcofluor. Bars in A, B and C equal 200, 40 and 5 μm, respectively. D. The percentage of detergent resistant spores formed from a known number of plated cells was determined as described in the legend to Table 1, with spores harvested from both 23 h and 44 h fruiting bodies. *: significantly different, P < 0.01. E. Lysates from atg7-, atg7-/act15p-YFP-atg7 and atg7-/act15p-YFP-atg7C563A cells were size-fractionated by SDS-PAGE and Western blots were probed with anti-GFP antibodies to visualize the YFP fusion proteins.
Complementation of . Atg7- cells were transformed with a fusion construct of the actin15 promoter and the YFP and atg7 coding sequences (act15p-YFP-atg7) or with act15p-YFP-atg7 harbouring a Cys563 to Ala mutation that deletes the Atg7 E1-like ligase activity. A,B. Cells were developed for 23 h and 41 h and structures were photographed in situ (A) or squashed below a coverslip (B). C. Cells from the spore head were also stained with 0.002% Calcofluor. Bars in A, B and C equal 200, 40 and 5 μm, respectively. D. The percentage of detergent resistant spores formed from a known number of plated cells was determined as described in the legend to Table 1, with spores harvested from both 23 h and 44 h fruiting bodies. *: significantly different, P < 0.01. E. Lysates from atg7-, atg7-/act15p-YFP-atg7 and atg7-/act15p-YFP-atg7C563A cells were size-fractionated by SDS-PAGE and Western blots were probed with anti-GFP antibodies to visualize the YFP fusion proteins.Several mutants in autophagy genes, such as atg5, atg6, atg8 and atg9 show a multi-tipped phenotype and spore defects (Otto et al., 2003, 2004; Tung et al., 2010). To assess whether specific defects in prespore gene induction are a general feature of autophagy mutants, we analysed the phenotype of atg5- and atg9- mutants in greater detail. Atg5 acts as a substrate in the first of the two steps of the ubiquitin-like system to conjugate Atg8 onto autophagosomes where Atg7 acts like an E1 enzyme, whereas Atg9 is required for recruiting lipid membrane in autophagosome formation (Lamb and Tooze, 2016). We investigated cell differentiation in an existing atg9- and recreated atg5- mutant (Fig. 1). During development on agar, atg9- and atg5- showed similar fruiting body defects as atg7-, with virtually absent spore formation, a relatively normal stalk with fully vacuolated and cellulose-encapsulated stalk cells and a large mass of basal cells that eventually also vacuolated (Fig. 7A–C). Similar to atg7-, cotC-gal expression was very low in atg9- and confined to a small region of the sorogens (Fig. 7D). Both ecmA-gal and ecmB-gal were expressed at similar levels in the primary stalk of developing fruiting bodies of Ax2 and atg9- (Fig. 7E and F). As was the case for atg7-, the enlarged bases of the atg9- fruiting bodies only expressed ecmA-gal and ecmB-gal very late in development.
Fig. 7
Developmental phenotypes of . A-C. Developing structures. Atg5- and atg9- cells were developed on non-nutrient agar and terminal fruiting bodies were photographed in situ (A), or stained with Calcofluor, squashed under a coverslip and photographed under phase contrast (B, C left panel) or epifluorescence (C, right panel). Bar: 50 μm. D-F. Cell-type specific gene expression. Ax2 and atg9- cells, transformed with cotC-gal (D), ecmA-gal (E) and ecmB-gal (F) were incubated on dialysis membrane supported by non-nutrient agar for the time periods shown above the images. Structures were fixed and stained with X-gal for 30 min at 22 °C for all structures, and also for 4 h at 37 °C for some atg9-/cotC-gal structures as shown inside the images. Bar: 50 μm.
Developmental phenotypes of . A-C. Developing structures. Atg5- and atg9- cells were developed on non-nutrient agar and terminal fruiting bodies were photographed in situ (A), or stained with Calcofluor, squashed under a coverslip and photographed under phase contrast (B, C left panel) or epifluorescence (C, right panel). Bar: 50 μm. D-F. Cell-type specific gene expression. Ax2 and atg9- cells, transformed with cotC-gal (D), ecmA-gal (E) and ecmB-gal (F) were incubated on dialysis membrane supported by non-nutrient agar for the time periods shown above the images. Structures were fixed and stained with X-gal for 30 min at 22 °C for all structures, and also for 4 h at 37 °C for some atg9-/cotC-gal structures as shown inside the images. Bar: 50 μm.cAMP induction of the prespore genes cotC and pspA was also absent from the atg5- and atg9- mutants, while cprB induction was 50% reduced. EcmA induction by cAMP and DIF was variable between experiments, but higher than in Ax2 (Fig. 8). Overall, these mutations in different aspects of the autophagy pathway all yielded the same phenotypic defects as atg7-, indicating that it is autophagy itself that is required for cAMP induction of prespore gene expression.
Fig. 8
Induction of cell type-specific genes by cAMP in . Ax2, atg5- and atg9- cells were developed to differentiation competence and treated with cAMP and/or DIF-1 as described in the legend to Fig. 5, and transcript levels of the indicated genes and the constitutively expressed gene Ig7 were analysed by RT-qPCR. Means and SD of three experiments, assayed with technical duplicates. P-values of t-tests comparing cAMP or cAMP + DIF-induced levels of the different genes between Ax2 and atg5- or atg9- are shown underneath large brackets.
Induction of cell type-specific genes by cAMP in . Ax2, atg5- and atg9- cells were developed to differentiation competence and treated with cAMP and/or DIF-1 as described in the legend to Fig. 5, and transcript levels of the indicated genes and the constitutively expressed gene Ig7 were analysed by RT-qPCR. Means and SD of three experiments, assayed with technical duplicates. P-values of t-tests comparing cAMP or cAMP + DIF-induced levels of the different genes between Ax2 and atg5- or atg9- are shown underneath large brackets.
How does autophagy interact with cAMP induction of prespore gene expression?
The requirement of autophagy for cAMP-induced prespore expression could either result from i. cells not being competent to detect and process the cAMP signal, or ii. from autophagy being part of the cAMP signal transduction pathway by either producing a stimulator or degrading an inhibitor of prespore gene expression.In addition to cAMP activation of cAMP receptors (cARs), cAMP activation of protein kinase A (PKA) is required for expression of many prespore genes and for spore maturation (Hopper et al., 1993), with precocious sporulation being induced by overexpression of the PKA catalytic subunit, PkaC (Mann et al., 1994). Because cARs also activate adenylate cyclase A (Theibert and Devreotes, 1986), PKA can potentially act downstream of cARs. We therefore examined whether PkaC overexpression can restore sporulation in atg7- and atg9-.
Fig. 9 shows that PkaC overexpression in Ax2 caused precocious maturation of many spores at the sorogen base, before the prespore mass had ascended the stalk. However, no viable spores were formed in atg7- and atg9- overexpressing PkaC. To test whether the failure of PkaC to rescue sporulation in atg7- already acted at the stage of prespore gene induction, we compared cAMP induction of the prespore genes cotC and pspA between Ax2 and atg7- cells, both overexpressing pkaC-YFP. Fig. 9D shows that levels of cotC and pspA expression in response to cAMP stimulation remained very low in the atg7-/PkaC-YFP cells, indicating the pkaC does not act downstream of Atg7.
Fig. 9
Effect of PKA-C overexpression. A. Ax2, atg7- and atg9- cells were transformed with act15p-pkaC-YFP and expression of pkaC-YFP was analysed by Western blot using anti-GFP antibody. B. Transformed cells were developed on agar for 19 h and photographed in situ (left panels, bar: 200 μm) or submerged in a droplet of 0.002% calcofluor and squashed under a coverslip (right panels, bar: 10 μm). The image of the Ax2/pkaC-YFP fruiting body was generated by focus stacking using Auto-Montage (http://www.syncroscopy.com). The large cell mass at its base (arrow) also contained spores (right panels). C. The percentage of detergent resistant spores formed from a known number of plated cells was determined as described in the legend to Table 3, with spores harvested from both 20, 24 h and 43–46 h fruiting bodies. Spore percentages between Ax2 and atg7- or atg9- transformants were significantly different, when compared pairwise at each time point, with P-values <0.01. D. Ax2 and atg7- cells transformed with act15p-pkaC-YFP were developed into loose mounds, dissociated and incubated for 4 h with or without 1 mM cAMP. RNA was isolated and transcript levels were analysed by RT-qPCR, using primers specific for the prespore genes cotC and pspA and the constitutively expressed gene Ig7. Data are expressed relative to expression in cAMP treated Ax2/pkaC-YFP cells. Means and SD of three experiments, assayed with technical duplicates are presented. P-values of t-tests comparing cAMP-induced levels between Ax2 and atg7-derived cells are shown in the panels.
Effect of PKA-C overexpression. A. Ax2, atg7- and atg9- cells were transformed with act15p-pkaC-YFP and expression of pkaC-YFP was analysed by Western blot using anti-GFP antibody. B. Transformed cells were developed on agar for 19 h and photographed in situ (left panels, bar: 200 μm) or submerged in a droplet of 0.002% calcofluor and squashed under a coverslip (right panels, bar: 10 μm). The image of the Ax2/pkaC-YFP fruiting body was generated by focus stacking using Auto-Montage (http://www.syncroscopy.com). The large cell mass at its base (arrow) also contained spores (right panels). C. The percentage of detergent resistant spores formed from a known number of plated cells was determined as described in the legend to Table 3, with spores harvested from both 20, 24 h and 43–46 h fruiting bodies. Spore percentages between Ax2 and atg7- or atg9- transformants were significantly different, when compared pairwise at each time point, with P-values <0.01. D. Ax2 and atg7- cells transformed with act15p-pkaC-YFP were developed into loose mounds, dissociated and incubated for 4 h with or without 1 mM cAMP. RNA was isolated and transcript levels were analysed by RT-qPCR, using primers specific for the prespore genes cotC and pspA and the constitutively expressed gene Ig7. Data are expressed relative to expression in cAMP treated Ax2/pkaC-YFP cells. Means and SD of three experiments, assayed with technical duplicates are presented. P-values of t-tests comparing cAMP-induced levels between Ax2 and atg7-derived cells are shown in the panels.The cAMP receptors cAR1, 2 and 3 can largely complement each other's function in mediating cAMP-induced prespore gene expression. However, cAR1, the only cAR, which, like prespore induction, is inhibited by adenosine, most likely mediates this process (Verkerke-VanWijk et al., 1998). We first tested whether expression of the cAR1 gene carA was defective in the atg7- mutant. Fig. 10A shows that carA transcript levels were only marginally reduced in atg7- during the first 12 h of development, indicating that its lack of cAMP-induced prespore gene expression is not due to lack of cAR1. During persistent stimulation with micromolar cAMP, cAR1 receptors are endocytosed and eventually degraded (Wang et al., 1988b). Autophagy was also reported to promote endocytosis of membrane receptors (Shin et al., 2016; Xu et al., 2016). We therefore tested whether Atg7 was required for internalization of cAR1, which could be part of the cAMP pathway activating prespore genes. We transformed both Ax2 and atg7- cells with a cAR1-GFP fusion construct, expressed from the constitutive actin 15 promoter (Xiao et al., 1997) and observed cAR1-GFP localization in the absence and presence of cAMP. Fig. 10B shows that cAR1-GFP remains mostly membrane localized in both Ax2 and atg7- in the absence of cAMP. Upon cAMP stimulation cAR1-GFP patches appear inside both Ax2 and atg7- cells, while staining at the cell periphery decreases. Upon persistent stimulation with cAMP, cAR1 is also phosphorylated, which causes a mobility shift on SDS-PAGE, followed by protein degradation (Vaughan and Devreotes, 1988). Fig. 10C shows that both Ax2 and atg7-, transformed with cAR1-GFP showed a mobility shift and subsequent degradation of the cAR1-GFP. It is therefore unlikely that autophagy stimulates prespore gene expression by causing cAR1 internalization.
Fig. 10
cAMP receptor levels, internalization and phosphorylation in . A. cAR gene expression. Ax2 and atg7- cells were developed at 22 °C on non-nutrient agar. RNA was extracted at the indicated time periods and analysed for carA and Ig7 expression by RT-qPCR. B. Internalization. Dissociated loose mound cells of Ax2 and atg7-, transformed with A15-cAR1-GFP (Xiao et al., 1997) were incubated in the presence or absence of 1 mM cAMP and photographed under epifluorescence at the indicated time points in minutes. Arrows highlight patches of internalised cAR1-GFP. Bar: 10 μm. C. cAR1 band-shift. At the indicated time points after cAMP addition, cells were lysed in SDS sample buffer and analysed by Western blot, using anti-GFP antibody.
cAMP receptor levels, internalization and phosphorylation in . A. cAR gene expression. Ax2 and atg7- cells were developed at 22 °C on non-nutrient agar. RNA was extracted at the indicated time periods and analysed for carA and Ig7 expression by RT-qPCR. B. Internalization. Dissociated loose mound cells of Ax2 and atg7-, transformed with A15-cAR1-GFP (Xiao et al., 1997) were incubated in the presence or absence of 1 mM cAMP and photographed under epifluorescence at the indicated time points in minutes. Arrows highlight patches of internalised cAR1-GFP. Bar: 10 μm. C. cAR1 band-shift. At the indicated time points after cAMP addition, cells were lysed in SDS sample buffer and analysed by Western blot, using anti-GFP antibody.Protein degradation by autophagy yields ammonia, which was reported to promote spore differentiation (Bradbury and Gross, 1989; Gross et al., 1983). To investigate whether lack of ammonia caused defective cAMP-induced prespore gene expression in autophagy mutants, we treated atg7-/cotC-gal cells with cAMP and increasing ammonia concentrations. However, there was no restoration of cotC-gal induction by ammonia (Fig. 11).
Fig. 11
Effect of ammonia on cAMP induction of . Ax2 and atg7- cells were transformed with cotC-gal and developed into loose mounds. Cells were then dissociated in 20 mM potassium phosphate pH 7.4 containing 1 mM MgCl2 and incubated with cAMP and increasing concentrations of NH4Cl for 6 h. After cell lysis, expression of cotC-gal was analysed with a spectrophotometric β-galactosidase assay. Means and SD of two experiments performed in duplicate. Values for cAMP-treated Ax2 cells were significantly higher than for cAMP-treated atg7- cells at each of the NH4Cl concentrations at P < 0.005.
Effect of ammonia on cAMP induction of . Ax2 and atg7- cells were transformed with cotC-gal and developed into loose mounds. Cells were then dissociated in 20 mM potassium phosphate pH 7.4 containing 1 mM MgCl2 and incubated with cAMP and increasing concentrations of NH4Cl for 6 h. After cell lysis, expression of cotC-gal was analysed with a spectrophotometric β-galactosidase assay. Means and SD of two experiments performed in duplicate. Values for cAMP-treated Ax2 cells were significantly higher than for cAMP-treated atg7- cells at each of the NH4Cl concentrations at P < 0.005.We finally tested how loss of autophagy affected two transcription factors with roles in prespore gene expression. The transcription factor SpaA acts downstream of PKA to induce expression of some prespore genes and spore maturation (Yamada et al., 2018). GbfA was isolated as a protein binding to G-rich motifs in the prestalk gene cprB, and to be required for cAMP induction of this gene. Subsequent studies showed that it also interacted with G-rich motifs in prespore genes and was required for their cAMP-inducibility (Hjorth et al., 1989; Powell-Coffman et al., 1994; Schnitzler et al., 1994). Expression of gbfA is about 30% reduced in atg7- cells (Fig. 12A), which can account for the ∼40% reduction of cAMP induction of cprB, but not the complete loss of cotC and pspA induction (Fig. 5). SpaA expression is about 60% reduced in atg7- (Fig. 12B), also not enough to account for complete loss of cotC induction. SpaA is only expressed in prespore and spore cells and we tested whether it was itself induced by cAMP. This was the case (Fig. 12C) with induction being ∼70% reduced in atg7- cells, in agreement with its 60% reduced developmental expression. Overall, the effects of loss of Atg7 on spaA and gbfA expression are insufficient to account for the complete lack of prespore induction in atg7- cells.
Fig. 12
Expression of transcription factors in the . A,B. Developmental regulation. The RNAs isolated for analysis of carA expression in Fig. 6 were used to study gbfA (A) and spaA (B) expression using spaA and gbfA specific primers (Table 2). C. cAMP induction. The RNAs isolated for analysis of cprB induction in Fig. 5 were here analysed for spaA induction. Significant differences in expression between Ax2 and atg7- at the same developmental time (A,B) or after induction with cAMP (C) are marked with * for 0.01 < P < 0.05 and ** for P < 10−5.
Expression of transcription factors in the . A,B. Developmental regulation. The RNAs isolated for analysis of carA expression in Fig. 6 were used to study gbfA (A) and spaA (B) expression using spaA and gbfA specific primers (Table 2). C. cAMP induction. The RNAs isolated for analysis of cprB induction in Fig. 5 were here analysed for spaA induction. Significant differences in expression between Ax2 and atg7- at the same developmental time (A,B) or after induction with cAMP (C) are marked with * for 0.01 < P < 0.05 and ** for P < 10−5.
Discussion
Disruption of autophagy prevents cAMP induction of prespore differentiation
A screen for mutants defective in spore differentiation identified Atg7, a component of the autophagy pathway as being essential for this process (Fig. 2). Further analysis showed that the atg7- mutant was specifically impaired in cAMP induction of prespore gene expression, but not in cAMP-induction of different classes of prestalk genes and in stalk cell differentiation (Fig. 5). Closer investigation of mutants lacking Atg5 and Atg9 revealed that they were also specifically defective in cAMP-induced prespore gene expression, indicating that the defect in atg7- mutants was due to loss of autophagy and not to a role of Atg7, unrelated to autophagy.Because Dictyostelium cells go through multicellular development while starving, loss of autophagy, which essentially deprives cells of metabolites and sources of energy can be expected to interfere with several developmental processes, which is evident from the abnormal multi-tipped morphology of autophagy mutants and effects on expression of many classes of genes (Calvo-Garrido et al., 2010; Mesquita et al., 2017) (Fischer et al., 2019). Deleterious effects of loss of Atg7 and other autophagy proteins on spore formation was reported before (Otto et al., 2003, 2004; Tung et al., 2010). However, these studies focussed on resolving the autophagy pathway and did not study sporulation in detail. Loss of autophagy also prevents production of the spore maturation inducing peptide SDF-2 (Cabral et al., 2010), but unlike the cell-autonomous defect in prespore gene expression caused by loss of autophagy reported here, this is a non-cell autonomous defect that acts much later in development. Since spore differentiation requires a considerable investment in building materials for construction of the multi-layered spore wall, defective sporulation in autophagy mutants is to be expected. However, the early and specific effect of autophagy loss on cAMP-induced prespore gene expression is enigmatic.
Role of autophagy in stalk cell differentiation
The lack of effect of loss of autophagy genes on stalk cell differentiation was unexpected since autolysosome formation occurs much more prominently in prestalk than prespore cells, while fusion of autolysosomes is considered to cause formation of the large central vacuole of the stalk cells (Schaap, 1983; Uchikawa et al., 2011). Furthermore, loss of two other autophagy genes atg1 or vmp1 prevent cells from differentiating into stalk cells in vitro in response to DIF-1, an inducer of stalk cell differentiation (Calvo-Garrido and Escalante, 2010; Kosta et al., 2004). The atg7- mutant also showed normal DIF-induced stalk cell differentiation in vitro (Fig. 3), and, like atg5- and atg9- , formed somewhat disorganized, but otherwise normal stalks in vivo (Fig. 2, Fig. 7), and this was also reported for vps13-mutants (Muñoz-Braceras et al., 2015).The relatively normal stalk cell differentiation in atg7-, atg5-, atg9-, vps13- and likely all other autophagy mutants that still manage to form fruiting structures could be a consequence of the fact that unlike atg1, these genes act more downstream in the autophagy pathway and might not inhibit autophagy altogether. Also non-canonical forms of autophagy that do not require Atg5 or Atg7 have been described (Arakawa et al., 2017; Dupont et al., 2017). Another explanation could be that both Atg1 and Vmp1 have other roles that prevent stalk cell differentiation specifically. Both atg1- and vmp1- cells show early developmental arrest (Calvo-Garrido et al., 2008; Otto et al., 2004). In addition to autophagy, Vmp1 is also involved in organelle biogenesis, contractile vacuole function and protein secretion (Calvo-Garrido et al., 2008), and interference with these functions may preclude normal developmental progression. Apart from initiating phagophore formation, Atg1 regulates the activity of transketolase, an enzyme in the pentose phosphate pathway (Mesquita et al., 2015).However, if autophagy does not cause stalk cell vacuolization, as the phenotypes of most autophagy mutants, except atg1- and vmp1-, suggest, than what does? One possibility is that the stalk vacuole is more akin to the large central vacuole of plants or fungi that fulfils a range of functions. While both the plant and fungal vacuoles also fuse with autophagosomes during the normal progression of autophagy (Yoshimoto and Ohsumi, 2018), the biogenesis of these vacuoles is not dependent on autophagy. Dictyostelium may have as yet unnoticed protovacuoles that normally own much of their size increase to fusion with autophagosomes, but can also inflate in their own right.
Elimination of putative prespore pathway components that are affected by autophagy
While a pleiotropic effect of autophagy on the formation of normal viable spores is to be expected, direct involvement of non-specific digestion of cell contents on a specific cAMP signal transduction pathway is difficult to explain. The sporulation defect of atg5-, atg7- and atg9- mutants is cell-autonomous (Otto et al., 2003, 2004) (Table 3), which excludes that the defect is caused by the absence of signal molecules or materials produced by e.g. the prestalk cells. The cAMP receptors (cARs) that mediate cAMP-induction of prespore genes are expressed at normal levels in atg7- cells (Fig. 10A), while cAMP-induced prestalk gene expression, which occurs at the same developmental stage as prespore gene induction is not impaired (Fig. 5, Fig. 8). This indicates that lack of autophagy does not generally interfere with the acquisition of differentiation competence.In addition to extracellular cAMP acting on cARs, intracellular cAMP acting on PKA is also required for expression of some prespore genes, such as cotC, and for terminal spore maturation (Hopper et al., 1993). CotC expression requires the transcription factors CudA and SpaA, which likely act downstream of PKA (Yamada et al., 2008, 2018). However, PKA overexpression neither rescued cAMP induction of prespore gene expression in atg7-, nor sporulation in either the atg7- or atg9- mutant (Fig. 9), indicating that defective autophagy does not act by preventing PKA activation. This is further substantiated by the observation that cAMP induction of the prespore gene pspA, which does not require PKA, SpaA or CudA for expression (Hopper et al., 1993; Yamada et al., 2018) is also lacking in the atg7- mutant (Fig. 5, Fig. 8). The transcription factor GbfA is required for cAR regulated expression of prespore and prestalk genes, particularly cprB (Hjorth et al., 1989; Powell-Coffman et al., 1994; Schnitzler et al., 1994). While gbfA expression is ∼40% reduced in atg7- (Fig. 12A), this reduction can account for the similarly reduced cprB expression, but not for the complete absence of prespore gene expression (Fig. 5, Fig. 8).cAR1 phosphorylation and endocytosis accompany induction of prespore gene expression by micromolar cAMP and could potentially mediate this process (Vaughan and Devreotes, 1988; Wang et al., 1988b). However, neither cAR1 phosphorylation nor internalization were impaired in the atg7- mutant (Fig. 10). For autophagy to mediate cAMP-induced prespore gene expression, autophagy itself should be activated by cAMP. However, autophagic vesicles are actually down-regulated in prespore cells (Schaap, 1983). This leaves the possibilities that autophagy either produces a catabolite that is specifically required for the cAMP pathway or eliminates a pathway specific inhibitor. An obvious catabolite of protein degradation is ammonia, which is known to promote spore and inhibit Dictyostelium stalk cell differentiation (Bradbury and Gross, 1989; Gross et al., 1983) (Wang and Schaap, 1989). However, we could not restore cAMP induction in the atg7- mutant by co-incubation with ammonia (Fig. 11).No further pathway components or inhibitors thereof are known, ending our options to identify the nature of the interaction between autophagy and prespore gene expression by a biased approach. Our current forward genetic strategy to identify sporulation genes, or a genetic screen for a suppressor of the atg7- phenotype is more likely to identify the prespore pathway components that are affected by loss of autophagy.
Authors: Artemis Kosta; Céline Roisin-Bouffay; Marie-Françoise Luciani; Grant P Otto; Richard H Kessin; Pierre Golstein Journal: J Biol Chem Date: 2004-09-09 Impact factor: 5.157
Authors: Sze Man Tung; Can Unal; Alexandra Ley; Cohue Peña; Budi Tunggal; Angelika A Noegel; Oleg Krut; Michael Steinert; Ludwig Eichinger Journal: Cell Microbiol Date: 2010-01-11 Impact factor: 3.715
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: William D Kim; Morgan L D M Wilson-Smillie; Aruban Thanabalasingam; Stephane Lefrancois; Susan L Cotman; Robert J Huber Journal: Front Cell Dev Biol Date: 2022-02-16