| Literature DB >> 31041887 |
Samiullah Khan1,2, Juliet Roberts1, Shu-Biao Wu3.
Abstract
BACKGROUND: Egg formation takes place in the oviduct of laying hens over a 24 h period. Infectious bronchitis virus (IBV) causes pathological lesions in the chicken oviduct. In the current study, mitochondrial counts were determined in three different segments of the oviduct during egg formation in laying chickens challenged with IBV T strain. Nuclear DNA encoded genes that are involved in mitochondrial biogenesis, fission and function were studied in the shell gland of the oviduct undergoing virus multiplication.Entities:
Keywords: Chicken oviduct; Infectious bronchitis; Laying chicken; Mitochondrial function; Nuclear DNA encoded genes
Year: 2019 PMID: 31041887 PMCID: PMC6446503 DOI: 10.1186/s12860-019-0190-7
Source DB: PubMed Journal: BMC Mol Cell Biol ISSN: 2661-8850
Allocation of birds into various groups for IBV challenge study in the oviduct of laying hens
| Group | Time-point (hr) | |
|---|---|---|
| 5 | 15 | |
| IBV T strain (20 birds) | 10 birds | 10 birds |
| Control (20 birds) | 10 birds | 10 birds |
Time-point (hr) refers to egg post-oviposition time as determined by video camera. At the time of processing of individual hen, the forming egg was either in the distal magnum/isthmus (5 h time-point) or in the shell gland (15 h time-point)
Forward (F) and reverse (R) primer sequence details used in the current study
| Gene name | Abbreviation used | Primer sequence (5′ – 3′) | Amplicon size (bp) | Annealing temperature °C | Amplification efficiency (%) | R2 | Slope | Accession No. |
|---|---|---|---|---|---|---|---|---|
| Glyceraldehyde-3-phosphate dehydrogenase |
| F-GGTCACCAAGAAGGTGGAGA | 137 | 63 | 96 | 0.99888 | −3.434 | NC_006088.3 |
| NADH dehydrogenase subunit 4 |
| F-CGCAGGCTCCATACTACTCG | 137 | 60 | 99 | 0.99944 | −3.341 | NC_001323.1 |
| Citrate synthase |
| F-TACTACACGGTGCTCTTCGG | 152 | 60 | 96 | 0.99943 | −3.089 | XM_015300287.1 |
| Succinate dehydrogenase complex flavoprotein subunit A |
| F-TCTGTCCATGGTGCTAATCG | 126 | 60 | 94 | 0.99790 | −3.484 | NM_001277398.1 |
| Dynamin-1-like protein |
| F-TGTGACCCGAAGACCCCTTA | 91 | 60 | 99 | 0.99861 | −3.345 | NM_001079722.1 |
| Cytochrome C, somatic |
| F-CCCAGTGCCATACGGTTGAA | 140 | 60 | 96 | 0.9930 | −3.430 | NM_001079478.1 |
| PPARG coactivator 1 alpha |
| F-AGTGACATCGAGTGTGCTGCT | 70 | 63 | 100 | 0.99472 | −3.331 | NM_001006457.1 |
| (Na+-K+) ATPase |
| F-GTCAACCCGAGGGATGCTAA | 179 | 60 | 99 | 0.99663 | −3.338 | J03230.1 |
| S1 glycoprotein | IBV T | F-TCAGGTGGTTGGCATTTACA | 181 | 60 | 99 | 0.99982 | −3.323 | U29522.1 |
| Nucleocapsid protein (3′ UTR) | IBV Vic S | F-ATAGGCATGTAGCTTGATTACC | 76 | 60 | 98 | 0.99823 | −3.320 | DQ059623.1 |
| TATA-Box Binding Protein |
| F-TAGCCCGATGATGCCGTAT | 147 | 61 | 97 | 0.99676 | −3.407 | NM_205103 |
| Tyrosine 3-monooxygenase/tryptophan |
| F- TTGCTGCTGGAGATGACAAG | 60 | 60 | 104 | 0.99912 | −3.222 | NM_001031343.1 |
aGene was used to amplify fragment of genomic DNA; bGene was used to amplify fragment of mtDNA
*The primer sequences for IBV Vic S [69], TBP [86], YWHAZ [87] and (Na-K) ATPase [88] were sourced from literature
Fig. 1Gel electrophoresis for assessing the specificities of the primers. L) DNA ladder; 1) ND4 (137 bp); 2) GAPDH (137 bp); 3) SDHA (126 bp); 4) Drp1/DNM1L (91 bp); 5) CS (152 bp); 6) PGC-1α/PPARGC1A (70 bp); 7) CYC, S (140 bp); 8) Na-K ATPase (179 bp); 9) IBV T strain (181 bp); 10) IBV Vic S strain as a positive control (76 bp). For the DNA gel electrophoresis in the Agilent 2100 Bioanalyzer, Agilent DNA 1000 Kit was used as per the manufacturer’s instructions
Fig. 2Antibody titre of the control and challenged hens on days 9–10 post-infection. The antibody titre was calculated as per the protocol of the Infectious Bronchitis Virus Antibody Test Kit (IDEXX Laboratories). According to the kit protocol, Sample/Positive (S/P) ratio > 0.20 shows antibody level positive for IBV. Bars represent standard deviation. Superscripts (a,b) show significant differences
Fig. 3Mean mitochondrial count per cell in different segments of oviduct of laying hens at different time-points and IBV challenge. a Mitochondria in the shell gland (P = 0.0050). b Mitochondria in the isthmus (P = 0.2577). c. Mitochondria in the magnum (P = 0.0879). Superscripts (a,b) show significant difference between the control and IBV T strain challenged groups. Bars represent standard error of the mean values
Relative expression stabilities of genes in the shell gland of laying hens challenged with IBV
| Gene | Group | ||||||
|---|---|---|---|---|---|---|---|
| Virus challenge | Time-point (hr) | Virus challenge | Time-point | Interaction | |||
| Yes | No | 5 | 15 | ||||
|
| 1.125 ± 0.097 | 1.050 ± 0.096 | 0.892 ± 0.092y | 1.283 ± 0.080x | 0.5522 | 0.0032 | 0.7135 |
|
| 0.966 ± 0.042b | 1.079 ± 0.054a | 1.154 ± 0.026x | 0.891 ± 0.050y | 0.0343 | < 0.0001 | 0.0188 |
|
| 1.066 ± 0.063 | 0.993 ± 0.053 | 1.191 ± 0.044x | 0.868 ± 0.047y | 0.2619 | < 0.0001 | 0.7039 |
|
| 1.025 ± 0.053 | 1.019 ± 0.049 | 1.089 ± 0.062 | 0.956 ± 0.030 | 0.9273 | 0.0671 | 0.9236 |
|
| 0.959 ± 0.025 | 1.041 ± 0.021 | 0.829 ± 0.037y | 1.247 ± 0.049x | 0.1900 | < 0.0001 | 0.5145 |
|
| 1.123 ± 0.134 | 1.237 ± 0.165 | 0.692 ± 0.077y | 1.668 ± 0.120x | 0.3916 | < 0.0001 | 0.0087 |
Values are normalised relative quantities (NRQ) to the mean expression level of all the samples ± S.E. Superscripts (a,b) across the row indicate significant difference between the virus challenged and control groups. Superscripts (x,y) across the row indicate significant difference between the 5 and 15 h time-points of egg-shell formation. In each group at each time-point, there were 10 samples processed for qPCR assay
Fig. 4Relative expression levels of SDHA and Na-K ATPase in the shell gland tissue affected by virus challenge and egg-shell formation time-point interaction. a. SDHA. b. Na-K ATPase. Values are normalised relative quantities (NRQ) to the mean expression level of all the samples ± S.E. Superscripts (a,b) across the bars indicate significant difference in the viral challenged and control groups