Ivan Nombela1, Ricardo Requena-Platek2, Byron Morales-Lange3, Veronica Chico4, Sara Puente-Marin5, Sergio Ciordia6, Maria Carmen Mena7, Julio Coll8, Luis Perez9, Luis Mercado10, Maria Del Mar Ortega-Villaizan11. 1. Instituto de Investigación, Desarrollo e Innovación en Biotecnología Sanitaria de Elche (IDiBE) and Instituto de Biología Molecular y Celular (IBMC), Universidad Miguel Hernández (UMH), 03202 Elche, Spain. nombela@umh.es. 2. Instituto de Investigación, Desarrollo e Innovación en Biotecnología Sanitaria de Elche (IDiBE) and Instituto de Biología Molecular y Celular (IBMC), Universidad Miguel Hernández (UMH), 03202 Elche, Spain. ricardorequena.p@gmail.com. 3. Instituto de Biología, Pontificia Universidad Católica de Valparaiso, 2373223 Valparaiso, Chile. byron.morales@pucv.cl. 4. Instituto de Investigación, Desarrollo e Innovación en Biotecnología Sanitaria de Elche (IDiBE) and Instituto de Biología Molecular y Celular (IBMC), Universidad Miguel Hernández (UMH), 03202 Elche, Spain. vchico@umh.es. 5. Instituto de Investigación, Desarrollo e Innovación en Biotecnología Sanitaria de Elche (IDiBE) and Instituto de Biología Molecular y Celular (IBMC), Universidad Miguel Hernández (UMH), 03202 Elche, Spain. spuente@umh.es. 6. Unidad de Proteómica, Centro Nacional de Biotecnología (CNB- CSIC), 28049 Madrid, Spain. sciordia@cnb.csic.es. 7. Unidad de Proteómica, Centro Nacional de Biotecnología (CNB- CSIC), 28049 Madrid, Spain. mcmena@cnb.csic.es. 8. Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), 28040 Madrid, Spain. juliocoll@inia.es. 9. Instituto de Investigación, Desarrollo e Innovación en Biotecnología Sanitaria de Elche (IDiBE) and Instituto de Biología Molecular y Celular (IBMC), Universidad Miguel Hernández (UMH), 03202 Elche, Spain. luis.perez@umh.es. 10. Instituto de Biología, Pontificia Universidad Católica de Valparaiso, 2373223 Valparaiso, Chile. luis.mercado@pucv.cl. 11. Instituto de Investigación, Desarrollo e Innovación en Biotecnología Sanitaria de Elche (IDiBE) and Instituto de Biología Molecular y Celular (IBMC), Universidad Miguel Hernández (UMH), 03202 Elche, Spain. mortega-villaizan@umh.es.
Abstract
Nucleated teleost red blood cells (RBCs) are known to express molecules from the major histocompatibility complex and peptide-generating processes such as autophagy and proteasomes, but the role of RBCs in antigen presentation of viruses have not been studied yet. In this study, RBCs exposed ex vivo to viral hemorrhagic septicemia virus (VHSV) were evaluated by means of transcriptomic and proteomic approaches. Genes and proteins related to antigen presentation molecules, proteasome degradation, and autophagy were up-regulated. VHSV induced accumulation of ubiquitinated proteins in ex vivo VHSV-exposed RBCs and showed at the same time a decrease of proteasome activity. Furthermore, induction of autophagy was detected by evaluating LC3 protein levels. Sequestosome-1/p62 underwent degradation early after VHSV exposure, and it may be a link between ubiquitination and autophagy activation. Inhibition of autophagosome degradation with niclosamide resulted in intracellular detection of N protein of VHSV (NVHSV) and p62 accumulation. In addition, antigen presentation cell markers, such as major histocompatibility complex (MHC) class I & II, CD83, and CD86, increased at the transcriptional and translational level in rainbow trout RBCs exposed to VHSV. In summary, we show that nucleated rainbow trout RBCs can degrade VHSV while displaying an antigen-presenting cell (APC)-like profile.
Nucleated teleost red blood cells (RBCs) are known to express molecules from the major histocompatibility complex and peptide-generating processes such as autophagy and proteasomes, but the role of RBCs in antigen presentation of viruses have not been studied yet. In this study, RBCs exposed ex vivo to viral hemorrhagic septicemia virus (VHSV) were evaluated by means of transcriptomic and proteomic approaches. Genes and proteins related to antigen presentation molecules, proteasome degradation, and autophagy were up-regulated. VHSV induced accumulation of ubiquitinated proteins in ex vivo VHSV-exposed RBCs and showed at the same time a decrease of proteasome activity. Furthermore, induction of autophagy was detected by evaluating LC3 protein levels. Sequestosome-1/p62 underwent degradation early after VHSV exposure, and it may be a link between ubiquitination and autophagy activation. Inhibition of autophagosome degradation with niclosamide resulted in intracellular detection of N protein of VHSV (NVHSV) and p62 accumulation. In addition, antigen presentation cell markers, such as major histocompatibility complex (MHC) class I & II, CD83, and CD86, increased at the transcriptional and translational level in rainbow trout RBCs exposed to VHSV. In summary, we show that nucleated rainbow trout RBCs can degrade VHSV while displaying an antigen-presenting cell (APC)-like profile.
Nucleated red blood cells (RBCs) can develop immune responses to viruses that directly target these cells, such as infectious salmonid anemia virus (ISAV) [1] and piscine orthoreovirus (PRV) [2,3,4,5,6], which mainly results in the up-regulation of the interferon (IFN)-α gene and interferon-stimulated genes. Recently, we reported that rainbow trout RBCs can mount an antiviral response against viral hemorrhagic septicemia virus (VHSV) [7]. Also, we have reported that RBCs can be stimulated by infectious pancreatic necrosis virus (IPNV), where up-regulation of IFN type 1-related genes leads to expression of antiviral myxovirus resistance protein Mx [8]. However, rainbow trout RBCs are nonpermissive to VHSV and IPNV infections, and the cellular mechanisms that make the infection nonpermissive are being studied [9].Autophagy is an evolutionarily conserved mechanism in which intracellular material is enveloped in double-membrane vesicles and targeted for fusion with lysosomes for degradation. Numerous pathogens have been known to cause autophagy, including viruses [10]. The role of autophagy in the context of viral infections is still controversial and can have either antiviral or proviral functions depending on the virus and host cell [11]. Autophagy can contribute to the innate immune response by delivering viral pathogen-associated molecular pattern (PAMPs) to endosomal Toll-like receptors (TLRs) [12,13] through vesicle trafficking. Related to VHSV, it was found that rhabdoviral infections, including VHSV, can be inhibited when autophagy is activated [14]. Moreover, the viral glycoprotein G is sufficient to induce autophagy [14] and a Pepscan technique has successfully identified the peptides involved in autophagy activation [15]. In teleosts, VHSV infection in turbot RBCs led to expression of NK-lysin, an antimicrobial peptide, associated with LC3 protein in autophagosomes [16].Recently, groups have reported on selective autophagy mechanisms, suggesting that autophagy is far from being a nonselective degradative process [17]. Autophagy uses adaptors known as SLRs (sequestosome 1/p62-like receptors) that can selectively target pathogens for degradation in autophagosomes [18]. p62 contains domains that interact with both ubiquitinated proteins and autophagy-specific light chain 3 (LC3) modifier [19] in the inner face of the autophagosome; in this way, p62 is involved in delivering ubiquitinated proteins marked for proteasome degradation to autophagosomes. Ubiquitination is a process mediated by the E3 ligases, in which a series of three different enzymes are involved in the activation, conjugation and ligation of ubiquitin to the proteins targeted for degradation [20]. Ubiquitinated proteins are primarily degraded by the proteasome. The ubiquitin-proteasome system (UPS) plays an important role in cell homeostasis by ensuring the quality of newly synthetized proteins and the regulation of levels of proteins performing critical functions in the cell. Functional 20S proteasomes have been identified in human [21] and rainbow trout [7] RBCs. As with autophagy, the UPS plays a double role in the context of viral infections: it can be manipulated by viruses to bypass host defenses mechanisms or participate in the elimination of viral components [22]. The UPS has been named as the principal source of antigenic peptides for the major histocompatibility complex (MHC) of the immune system [23]. Autophagy is also known to be involved in antigen degradation and delivery to MHC class I and II molecules, which could trigger the adaptive immune response [24,25,26].Antigen presentation is a key process to activate T cells. This process is mediated by antigen-presenting cells (APCs) such as dendritic cells (DCs). DCs act as an important link between the innate and adaptive immune responses and are involved in patrolling tissues, pathogen engulfment, degradation, movement to lymphoid tissues, and T cell stimulation. However, the presence of APCs, and specifically DCs, was largely unknown in fish until recently, when a subset of APCs resembling those of mammals was identified in zebrafish [27] and rainbow trout [28]. APCs are characterized through cell markers such as CD86 and CD83, which serve as costimulatory molecules, and MHC molecules. Among them, MHC molecules are some of the most important proteins involved in the antigen presentation process, as they display pathogen-derived fragments on the cell surface to allow recognition by T cells. Expression of MHC molecules indicates that a cell can play an APC role. MHC class I (MHCI) protein expression has been detected in rainbow trout RBCs [29,30] and MHC class II (MHCII) transcriptional expression has been recently reported in nucleated rainbow trout [31,32] and chicken [33] RBCs. However, the role of RBCs in viral antigen presentation is unknown. APCs are classified as professional or atypical [34]. Professional APCs constitutively express MHC molecules, possess machinery to process antigens, and can localize to tissues and T cell zones, whereas atypical APCs up-regulate MHC expression under certain conditions. Little evidence exists regarding atypical APCs priming T cells in an antigen-specific manner [34].The aim of this study was to elucidate whether APCs cell markers regulation occurred in nucleated teleost RBCs after VHSV exposure, while also analyzing potential autophagy and UPS implications. These processes have been reported to generate peptides used by MHC molecules for antigen presentation [35]. Recently, we found that RBCs are nonpermissive to VHSV infection [7], but the cause of this abortive infection is being studied [9]. Our results show an increase in ubiquitination and autophagy activation in ex vivo VHSV-exposed RBCs. Inhibition of autophagy degradation led to increased levels of VHSV in RBCs. We also detected p62 degradation at early stages post infection. We found up-regulation of MHCI, MHCII, CD83, and CD86 molecules at the protein level on rainbow trout RBCs after VHSV exposure. Therefore, we show for the first time to our knowledge that nucleated RBCs can display and up-regulate APCs cell markers and process viral antigens through autophagy.
2. Materials and Methods
2.1. Animals
Rainbow trout (Oncorhynchus mykiss) individuals of approximately 5 to 20 gr. were obtained from a commercial fish farm (Piszolla S.L., Cimballa Fish Farm, Zaragoza, Spain). Fish were maintained at the University Miguel Hernandez (UMH) facilities in a recirculating dechlorinated water system at a stocking density of 1 fish/3L and fed daily with a commercial diet (Skretting, Burgos, Spain). Water temperature was constantly monitored to maintain fish at 14 °C. Fish were acclimatized to laboratory conditions for 2 weeks before experimentation. Experimental protocols and methods of the experimental animals were reviewed and approved by the Animal Welfare Body and the Research Ethics Committee at the UMH (approval number 2014.205.E.OEP; 2016.221.E.OEP) and by the competent authority of the Regional Ministry of Presidency and Agriculture, Fisheries, Food and Water supply (approval number 2014/VSC/PEA/00205). All methods were carried out in accordance with the Spanish Royal Decree RD 53/2013 and EU Directive 2010/63/EU for the protection of animals used for research experimentation and other scientific purposes.
2.2. Cell Cultures and Virus
Rainbow trout were sacrificed by overexposure to tricaine methanesulfonate (Sigma-Aldrich, Madrid, Spain) at 0.3 g/L. Peripheral blood was sampled from the caudal vein using insulin syringes (NIPRO, Bridgewater, NJ, USA). Approximately 100 µL of blood was diluted in RPMI-1640 medium (Dutch modification) (Gibco, Thermo Fischer Scientific Inc., Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Cultek, Madrid, Spain), 1 mM pyruvate (Gibco), 2 mM l-glutamine (Gibco), 50 µg/mL gentamicin (Gibco), 2 µg/mL fungizone (Gibco), and 100 U/mL penicillin/streptomycin (Sigma-Aldrich). Then, RBCs were purified by two consecutive density gradient centrifugations with Histopaque 1077 (7206g, Ficoll 1.007; Sigma-Aldrich). Finally, RBCs were washed twice with RPMI 2% FBS. An RBC purity of 99.99% was estimated by optical microscopy evaluation. Then, purified RBCs were cultured in the above indicated medium at a density of 107 cells/mL in cell culture flasks at 14 °C overnight.For autophagy assays, RBCs were treated with niclosamide (Sigma-Aldrich) after three hours post-exposure (hpe) to VHSV and then incubated for the time and at the concentration indicated for each assay. Similarly, the proteasome inhibitor MG132 (Sigma-Aldrich) was added after three hpe to VHSV and then incubated for the time and at the concentration indicated for each assay.Viral hemorrhagic septicemia virus (VHSV-07.71) [36] was purchased from the American Type Culture Collection (ATCC, VR-1388) and propagated in fathead minnowepithelioma papulosum cyprini EPC cells (ATCC, CRL-2872) at 14 °C, as previously reported [37].
2.3. Antibodies
To label VHSV, we used the mouse monoclonal 2C9 antibody against the N protein of VHSV (NVHSV) [38] produced at Dr Coll’s laboratory. To label MHCI, mouse anti-MHCI against zebrafish MHCI (Ab-Mart, Shangai, China; Ref nº #X1-K4HVT2) was used (Supplementary Figure S1). Sequence alignment between zebrafish (UniprotKB Entry K4HVT2) and rainbow trout (NCBI Entry AAG53681.1) MHCI protein sequences, using NCBI BLAST tool (https://blast.ncbi.nlm.nih.gov), resulted in 48% identity and 68% positives. To label LC3, rabbit anti-LC3A/B antibody (Cell Signaling Technology, Danvers, MA; Ref nº #4108) was used. To label p62, we used rabbit anti-p62/SQSTM1 antibody (www.antibodiesonline.com; Ref nº #ABIN2854836) (Supplementary Figure S2). This antibody shows reactivity with zebrafish. Sequence alignment between zebrafish (UniprotKB Entry F1Q5Z8) and rainbow trout (XP_021439759.1) p62/sequestosome 1 protein sequences, resulted in 61% identity and 70% positives. To label ubiquitin, rabbit anti-ubiquitin antibody (StressMarq, Victoria, Canada; Ref nº #SPC-119) was used. This antibody shows reactivity with rainbow trout. Mouse anti-MHCII, mouse anti-CD86, and rabbit anti-CD83 antibodies against respective rainbow trout molecules were produced at the laboratory of Dr Luis Mercado using synthetic epitopes from the indicated molecules [39]. Western blots of anti-MHCII, anti-CD86, and anti-CD83 antibodies in RBCs can be found in Supplementary Figure S3. A polyclonal antibody against VHSV G glycoprotein (GVHSV) produced in rabbit [40], kindly donated by Dr Niels Lorenzen to Dr Julio Coll, was used in the DuoLink proximity assay. Rabbit polyclonal antibody against human α-actin (Sigma-Aldrich, Nº #2066) was used for western blotting as a loading control. Secondary antibodies used are indicated in each assay.
2.4. Viral Exposure Assays
Ex vivo rainbow trout RBCs were exposed to VHSV at different multiplicities of infection (MOI), as indicated in each figure. After three hours of incubation at 14 °C, cells were washed with cold RPMI, then RPMI 2% FBS was added and the culture was incubated at 14 °C for the different times indicated in each assay. Virus was not removed in the time-course assays. MOI was calculated using the following formula:
2.5. Rainbow Trout Challenge with VHSV
Young rainbow trout individuals were infected by intramuscular injection of 50 µL RPMI 2% FBS medium with VHSV (108 TCID50/mL). As a negative control, individuals were injected with 50 µL of sterile RPMI 2% FBS. Over the course of the challenge, individuals were maintained at 14 °C for the number of days indicated.
2.6. Proteasome Activity Assay
RBC proteasome activity was measured using Proteasome 20S Activity Assay Kit (Sigma-Aldrich). RBCs were exposed to VHSV for 24 h at the indicated MOI. After, approximately 2 × 105 cells in 90 µL RPMI were adhered to a transparent 96-well plate previously treated with poly-D lysine (Sigma-Aldrich) by centrifugation at 800 rpm for two minutes. Then, 100 µL of Proteasome Assay Loading Solution (prepared following manufacturer instructions) were added to each well. After five hours of incubation at room temperature with protection from light, fluorescence was measured using POLARstar Omega Microplate Reader (BMG Labtech, Ortenberg, Germany) with an excitation wavelength of 490 nm and an emission wavelength of 525 nm.
2.7. RNA Isolation and cDNA Synthesis
The E.Z.N.A. Total RNA Kit (Omega Bio-Tek Inc., Norcross, GA, USA) was used for total RNA extraction in accordance with the manufacturer’s instructions. To eliminate possible residual genomic DNA, the sample was treated using TURBO™ DNase (Ambion, Thermo Fischer Scientific Inc.) following the manufacturer’s instructions. RNA was quantified with a NanoDrop Spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA).cDNA was synthesized from RNA using M-MLV reverse transcriptase (Invitrogen, Thermo Fischer Scientific Inc.) as previously described [41]. cDNA was stored at −20 °C.
2.8. Transcriptome Analysis
Ficoll-purified rainbow trout RBCs were exposed to VHSV as described above. After 4 and 72 hpe, VHSV-exposed (n = 16) and unexposed (n = 16) RBCs (106 cells per fish) were resuspended in a 1/10 dilution of 9.5 μL of 10× lysis buffer (Clontech, Takara Bio, Mountain View, CA, USA) and 0.5 µL of RNase Inhibitor (Invitrogen, ThermoFisher Scientific, Waltham, MA, USA). Fish samples were grouped into 2 pools of 8 individuals for each condition (control and VHSV-exposed) and preserved at −80 °C until cDNA library construction. cDNA was directly produced from pooled lysed cells using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, Takara Bio) [31]. Sequence reads are available at SRA-NCBI accession SRP133501. RNA-Seq library preparation, sequencing, and mapping were carried out by STABVida Lda (Caparica, Portugal) as previously described [31].
2.9. Proteome Analysis
Ficoll-purified rainbow trout RBCs were exposed to VHSV as described above. At 72 hpe, VHSV-exposed (n = 16) and unexposed (n = 16) RBCs (8 × 106 cells per fish) were pelletized by centrifugation (1600 rpm), the supernatant was removed, and the cell pellet was washed three times with phosphate- buffered saline (PBS), digested, cleaned-up/desalted and grouped into 2 pools of 8 individuals for each condition (control and VHSV-exposed). Then, samples were subjected to liquid chromatography and mass spectrometry analysis (LC-MS) as previously described [31]. Log2 peptide ratios followed a normal distribution that was fitted using least squares regression. Mean and standard deviation values derived from the Gaussian fit and were used to estimate P values and false discovery rates (FDR) at quantitation level. The confidence interval for protein identification was set to <95% (P < 0.05), and only peptides with an individual ion score above the 1% FDR threshold were considered correctly identified. Only proteins with at least two peptide spectrum matches (PSMs) were considered in the quantitation.
2.10. Pathway Enrichment Analysis
Using the transcriptomic and proteomic results, differentially expressed genes (DEGs) and proteins (DEPs) pathway enrichment analyses were performed using ClueGO [42], CluePedia [43], and Cytoscape [44]. The Gene Ontology (GO) Immune System Process, GO Biological Process, Reactome pathways, KEGG pathways, and Wikipathways databases were used. A P value ≤ 0.05 and Kappa score of 0.4 were used as threshold values. Genes and proteins were identified by sequence homology with Homo sapiens using Blast2GO version 4.1.9 (BioBam, Valencia, Spain) [45].
2.11. Semi-quantitative PCR
Semi-quantitative PCR was performed using the commercial kit GoTaq G2 DNA polymerase (Promega, Madison, WI, USA) and synthesized cDNA. PCR reactions were performed in a total volume of 12.5 µL using 10 µM for dNTPs (Invitrogen), 0.75 mM MgCl2 (Promega), 1X GoTaq Green Buffer (Promega) and 1.25 U of GoTaq G2 DNA polymerase (Promega). Primer concentration was 50 nM for cd83, mhcI, and mhcII and 25 nM for cd86. A total of 12 ng of cDNA was used for each sample. Cycling conditions were 95 °C for 5 min; 35 cycles at 95 °C for 30 s, 60 °C or 62 °C (depending on the Tm of primers) for 30 s, and 72 °C for 20 s; and 72 °C for 5 min. An Aeris (ESCO, Singapore, Singapore) thermal cycler was used for PCR. Primers sequences used are listed in Table 1. Samples were stored at −20 °C until analysis in agarose gel electrophoresis.
Table 1
List of primer sequences used for semi-quantitative PCR.
Gene
Forward Primer(5′–3′)
Reverse Primer(5′–3′)
Reference or Accession Number
mhcI
CCAGAGGATGTATGGTTGTGAG
TGGAGCGATCCATGTCTTTGTC
AF287490.1
mhcII
GTACTCCAGGTGGGAGTGGA
TGCAGCGCCTATGACTTCTA
AY273808.1
cd86
ATGTAACAGTGGCCTGTGA
CCACCCACTGCTGTTCACTA
FJ607781.1
cd83
GGAGCGTGAAGTGAACTTT
TCCTGGTTCTGCTCTCCTACA
AY263797.1
ef1α
TGGAGACTGGCACCCTGAAG
CCAACATTGTCACCAGGCATGG
[46]
2.12. Agarose Gel Electrophoresis
Each amplified DNA fragment generated by semi-quantitative PCR was separated via agarose gel (2%) (Cleaver Scientific, Warwickshire, UK) electrophoresis. Gel was prepared by diluting agarose in tris-borate-EDTA buffer (TBE) (45 mM TrisHCl, 0.45 M boric acid, 10 mM EDTA) (Merck, Ñuñoa, Chile) buffer with the pH adjusted to 8. To visualize DNA bands, 0.5 µL of GelRed (Biotium, Fremont, CA, USA) were added to 25 mL of TBE buffer/agarose, and 3 µL of each sample were loaded to the gel. Electrophoresis was done at 90V for 40 min using a PowerPac 300 power supply (Biorad, CA, USA). DNA bands were visualized using UV light in an Infinity 115 (Vilber Lourmart, Marné La Vallée, France) gel documentation system with the BioCapt software (Vilber Lourmart, Marné La Vallée, France). To determine the molecular weight, we used AccRuler 100 Bp Plus DNA RTU ladder (Maestrogen, Hsinchu City, Taiwan) which includes band sizes from 3000 bp to 100 bp.
2.13. Gene Expression by RT-qPCR
cDNA was synthetized as previously described. RT-qPCR was performed in 20 μL reactions using 12 ng of cDNA, 10 μL of TaqMan universal PCR master mix (Thermo Fischer Scientific), 900 nM final concentration of each primer (300 nM for NVHSV gene) and 300 nM of probe (150 nM for NVHSV gene) using the ABI PRISM 7300 System (Thermo Fischer Scientific). Cycling conditions were 50 °C for 2 min; 95 °C for 10 min; and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Gene expression was analyzed by the 2−ΔCt or 2−ΔΔCt method [47]. The eukaryotic 18S rRNA gene (Cat#4310893E, Thermo Fischer Scientific) was used as an endogenous control. Primer and probe sequences are listed in Table 2.
Table 2
List of primers and probes sequences used in quantitative RT-qPCR.
Gene
Forward Primer(5′–3′)
Reverse Primer(5′–3′)
Probe(5′–3′)
Reference or Accession Number
atg4b
GATCCTGTCCCTGTGATGATGA
CCCCTATTGGCTTCCCTTCT
ACCCCCCCCGGCGATTCTTC
XR_002473879
ulk1
CTTCTGCTGCTGGGTCTTCTG
GGTGACGGAAGAACTCCTCAAA
CGAAACCACAAGGACCGCATGGA
XR_002473462
becn1
GCGTGGGTGTCGTCTCAGTT
CAGGGAAGCAAGGAGAGCAT
ACCCTGGGTGTGCCCCTTGACC
NM_001124429
gabarap
CCTCATCCATCCATTTTTACCTCTT
ATTCAACCGAAATCCCCATCT
TCTGAATTTTATTTGCCTCCGGGTCTCC
NM_001165091
pik3c3
AGGCCAGCTGTGTGTGTTTCTA
GTTGCACATAGCGTTCCTGTTTA
TTTGCCCCCCCGGATGATTGA
XM_021577851
cul3
GCAGCTTACGTTACAGCATCACA
TGGTGTTGGAGCCTGTTACCT
AACGCCACCTTCTACGGCCCAATC
XM_021587294.1
ikbkb
TGTTCCTGTTTGACCGTTCCT
CCGTCTGGACAAAGCGTATGT
CCTACGAGCCCCAGTTCACCCCC
XM_021621802.1
keap1
CCTCCACAAGCCCACCAA
AAGTATCCCCCTGCCGTGTA
CACGCCCAAAGTGCCCCAGC
XM_021556738.1
rab7
GTTGCGTGCTGGTGTTTGAC
ACTCGTCCCTCCAGCTGTCTAG
TGACCGCCCCCAACACCTTCAA
XM_021609589.1
sec13
GCAGTGATCCAGGCACAGAA
CTGGGACTAGGATAGATGGTAGAAGTG
ATTCCACTCCTCCTCCTACCCCCACA
XM_021610740.1
traf6
AGGACGCGGTGTGGAAGAG
CATGAATCTTGCTGTCCTCGTAAA
AGATGCACCAAAGCCAACACTGCCA
XM_021586866.1
mhcI
GACAGTCCGTCCCTCAGTGT
CTGGAAGGTTCCATCATCGT
[48]
mhcII
TGCCATGCTGATGTGCAG
GTCCCTCAGCCAGGTCACT
CGCCTATGACTTCTACCCCAAACAAAT
[49]
cd86
GGTCTGTGACCCTCCCCTGTA
CCCTCGTCTTATGGTAGCCATT
XR_002470439.1
cd83
TTGGCTGATGATTCTTTCGATATC
TGCTGCCAGGAGACACTTGT
TCCTGCCCAATGTAACGGCTGTTGA
[50]
NVHSV
GACTCAACGGGACAGGAATGA
GGGCAATGCCCAAGTTGTT
TGGGTTGTTCACCCAGGCCGC
[41]
2.14. Extracellular Immunofluorescence Staining
To stain the cell surface markers MHCI, MHCII, CD83, and CD86, RBCs were fixed in 4% paraformaldehyde (PFA; Sigma-Aldrich) and 0.008% glutaraldehyde (Sigma-Aldrich) diluted in RPMI medium for 20 min. Primary antibodies were diluted in PBS at 1/200 dilution for anti-MHCI, 1/200 for anti-MHCII, 1/100 for anti-CD83, and for 1/200 anti-CD86. Samples were incubated for 60 min. For flow cytometry, goat anti-rabbit IgG (H+L) CF™ 488 antibody (Sigma-Aldrich) was used for the secondary antibody for anti-CD83, and goat anti-mouse IgG (H+L) CF™ 488 antibody (Sigma-Aldrich) was used for anti-MHCI, anti-MHCII, and anti-CD86. Secondary antibodies were incubated for 30 min at 1/200 dilution. RBCs were washed with PBS after each antibody incubation. Flow cytometry analysis was done in a BD FACSCanto™ II (BD Biosciences) flow cytometer. Immunofluorescence (IF) images were taken with the INCell Analyzer 6000 cell imaging system (GE Healthcare, Little Chalfont, UK).
2.15. Intracellular Immunofluorescence Staining
RBCs were fixed with 4% PFA and 0.008% glutaraldehyde diluted in RPMI medium. RBCs were incubated with permeabilization buffer containing 0.05% saponin (Sigma-Aldrich) in PBS, for 15 min. Primary antibodies were used at 1/1000 dilution for 2C9 anti-NVHSV, 1/200 for anti-p62, and 1/100 for anti-ubiquitin in permeabilization buffer. Samples were incubated for 60 min at room temperature. Secondary antibodies were incubated for 30 min at 1/200 dilution in permeabilization buffer. RBCs were washed with permeabilization buffer after antibody incubations. Goat anti-rabbit IgG (H+L) CF™ 647 antibody and goat anti-mouse IgG (H+L) CF™ 488 antibody was used as secondary antibodies (Sigma-Aldrich). For anti-ubiquitin and anti-NVHSV double staining, goat anti-rabbit IgG (H+L) CF™ 488 antibody and goat anti-mouse IgG (H+L) CF™ 647 antibody was used as secondary antibodies. RBCs were maintained in 1% PFA in PBS. Nuclear staining was performed by staining RBCs with 1 μg/mL of 4′-6-408 Diamidino-2-phenylindole (DAPI; Sigma-Aldrich) for five minutes.For LC3 staining, RBCs were fixed using 4% PFA and 0.008% glutaraldehyde (Sigma-Aldrich) in PBS for 20 min and permeabilized with cold methanol (Panreac) for 15 min. LC3 antibody was diluted 1/100 in 0.3% Triton X-100 in PBS and incubated for two hours at room temperature for flow cytometry and overnight at 4 °C for immunofluorescence. Secondary antibody goat anti-rabbit IgG (H+L) CF™ 488 (Sigma-Aldrich) was diluted 1/200 in 0.3% Triton X-100 (Sigma-Aldrich) in PBS and incubated for 30 min for flow cytometry and 90 min for immunofluorescence, both at room temperature. RBCs were kept in 1% PFA in PBS before the analysis. Immunofluorescence images were taken in the INCell Analyzer 6000 cell imaging system (GE Healthcare).
2.16. Transmission Electron Microscopy (TEM)
Control and VHSV-exposed RBCs were fixed with glutaraldehyde at 2% in 0.1 M cacodylate buffer for three to four hours at room temperature. Post-fixation was performed with osmium tetroxide at 1% in 0.1 M cacodylate buffer for one hour at 4 °C. RBCs were centrifuged at 1600 rpm and washed with 0.1 M cacodylate buffer over 10 min three times after both steps. For the last wash, RBCs were kept at 4 °C overnight. The sample was applied to 3% agar and dehydrated using an increasing gradient of alcohol (30%, 50%, 70%, 96% and 100% during 10 min), acetone (two 10-min rounds), acetone/epon resin 1:1 (1 h), and epon resin (overnight with the Eppendorf tape open and then closed for four hours). Finally, a block with the sample was polymerized at 58 °C to 60 °C for 24 h. Images were taken using the electronic transmission microscope Jeol 1011 (JEOL, Inc. Peabody, MA, USA) from the UMH Institute of Bioengineering.
2.17. In situ Proximity Ligation Assay (PLA)
Superfrost microscope slides were cleaned using ethanol. Two areas of 1 cm2 were delimited using a Dako pen (Agilent, Santa Clara, CA, USA) on each microscope slide, and Dako pen stain dried overnight. Ficoll-purified RBCs were washed three times, and approximately 2.5 × 105 RBCs were used from unexposed or VHSV-exposed (MOI 10) RBCs, at 14 °C for 24 h. RBCs were added to each area in a volume of 125 µL of RPMI. RBCs were left to sediment for 15 min. Then, RPMI was carefully removed, and 100 µL fixation buffer consisting of RPMI with 4% PFA was added for 1 h at room temperature. RBCs were washed three times with PBS after removing the fixation buffer. Then, 70% ethanol was applied to the slides for 30 s. Slides dried on ice for one hour and then were stored at −20 °C.Duolink In Situ–Fluorescence kit (Sigma-Aldrich) was used following the manufacturer’s instructions to perform the PLA. Once slides dried, blocking solution was added to each area, and slides were incubated for one hour at 37ºC in a wet chamber. Blocking solution was removed, and a mixture containing the primary antibodies mouse anti-MHCI (1/200) or anti-MHCII (1/200) and polyclonal rabbit anti- GVHSV antibody [40] (kindly provided by Dr Neils Lorenzen to Dr Julio Coll) (1/300) were incubated overnight in a wet chamber at 4 °C. Alternatively, anti-MHCI or anti-MHCII were incubated together with rabbit serum (1/300) to detect nonspecific background signals. After incubation with the primary antibodies, RBCs were washed twice with wash buffer A for 5 min with slow agitation. Excess wash buffer A was removed, and the PLA Probes MINUS reagent was incubated at a 1/5 dilution for 1 h at 37 °C in the wet chamber. Then, ligation shock reagent and ligase were added to the RBCs after washing. Amplification reagents were added to the RBCs and then removed after 100 min of incubation. Slides were mounted with a cover slip using DuoLink In Situ Mounting Medium with DAPI and stored at −20 °C until analysis.To quantify positive colocalization between MHCI or MHCII and GVHSV peptides in RBCs, we used a counting algorithm in the IN Cell Developer software (GE Healthcare). Briefly, RBC cytoplasm was delimited using a collar around the nucleus (labeled by DAPI) of a ~5 µm radius. Positive colocalization was noted by detection of granules inside the RBCs cytoplasm (settings were adjusted for a minimum brightness and granular size to be considered for colocalization between the two molecules).
2.18. Western Blot
RBCs pellets (107 cells) and head kidney tissue samples were resuspended in 100 µL PBS buffer with a protease inhibitor cocktail (Sigma-Aldrich). Cells were lysed by freezing and thawing samples three times. Tissues were disrupted using micropestles (Invitrogen). Cell debris was eliminated by centrifugation at 12,000 rpm for 10 min. Samples were loaded in a 12% polyacrylamide gel (Invitrogen), except for anti-ubiquitin which was at 16%, under reducing conditions. Electrophoresis was performed at 150 V for 100 min. Proteins in the gel were transferred to 0.4 µm pore size nitrocellulose membranes (BioRad, Madrid, Spain) for 120 min at 100 V in transfer buffer (2.5 mM Tris, 9 mM glycine, 20% methanol). Membranes were then blocked with 5% dry milk and 0.2% Tween-20 in PBS and incubated with rabbit polyclonal anti-ubiquitin, rabbit polyclonal anti-αactin (42 kDa), mouse monoclonal anti-MHCI (45 kDa), mouse polyclonal anti-MHCII (~34 kDa), mouse polyclonal anti-CD86 (~31 kDa), or rabbit polyclonal anti-CD83 (~24 kDa) in PBS containing 5% dry milk and 0.2% Tween-20 (blocking buffer) overnight at 4 °C. Membranes were washed three times for 10 min each with PBSTween-20 0.2% buffer before incubation with GAR-Po (Sigma-Aldrich) or GAM-Po (Sigma-Aldrich) in blocking buffer for 60 min. Membranes were then washed three times with PBSTween-20 0.2%. Peroxidase activity was detected using enhanced chemiluminescence (ECL) reagents (Amersham Biosciences, Buckinghamshire, UK) and exposure to X-ray. Protein lanes and bands were analyzed by densitometry using ImageJ software (version 1.51, National Institutes of Health, Bethesda, MD, USA). Lanes were selected using the rectangle tool of ImageJ software and the integrated density of the lane was measured. α-actin band densitometry was calculated by plotting the band density after selecting the bands with the rectangle tool.
2.19. Software and Statistics
All graphs show the mean and standard deviation of the data. P values associated with each graphic are represented by: *, P value < 0.05; **, P value < 0.01; ***, P value < 0.001; ****, P value < 0.0001. Graphpad Prism 6 (www.graphpad.com) (Graphpad Software Inc., San Diego, CA, USA) was used to prepare graphs and perform statistical calculations. Flow cytometry data were analyzed using Flowing Software v2.5.1 (http://flowingsoftware.btk.fi/) to obtain mean fluorescence intensity (MFI) values and Weasel v3.0.1 (https://frankbattye.com.au/Weasel/) to obtain graphical representation of histograms and dot plots.
3. Results
3.1. Transcriptomic Analysis Indicated Up-Regulation of Antigen-Processing-Related Molecules in Ex Vivo VHSV-Exposed Rainbow Trout RBCs
To identify major processes activated when rainbow trout RBCs are exposed to VHSV, a transcriptomic analysis using RNA-Seq and pathway enrichment evaluation were performed on VHSV-exposed RBCs at 4 and 72 hpe. Several up-regulated genes were classified into GO categories of ubiquitination and proteasome degradation and MHC class I antigen processing and presentation (Figure 1, Supplementary Table S1) at 4 hpe. Selected genes belonging to the ubiquitination and proteasome degradation category are listed in Table 3 (Supplementary Tables S1 and S2). Among these up-regulated genes are cullin 3 (cul3) and proteasome subunits α6 (psma6) and β5 (psmb5). Also related to the MHCI presentation pathway, our analysis identified calnexin (canx), GTPase activating protein SEC13 (sec13), and inhibitor of nuclear factor kappa B kinase (ikbkb). Ras-related rab 7 (rab7) and tumor necrosis factor (TNF) receptor-associated factor 6 (traf6) were analyzed by RT-qPCR as genes related to the MHCI presentation pathway. RT-qPCR validation of the genes identified in the transcriptomic analysis is shown in Supplementary Figure S4, where a tendency to up-regulation is observed at 4 hpe, although the RT-qPCR data do not strongly support the fold changes found by RNA-Seq. Moreover, we also identified up-regulation of some genes involved in autophagy, such as unc-51–like autophagy activating kinase 1 (ulk1), beclin 1 (becn1), and autophagy-related 9A (atg9a) (Table 4). In contrast, at 72 hpe, RBCs showed a global down-regulation (Supplementary Tables S1 and S2).
Figure 1
Transcriptomic analysis indicated up-regulation of antigen-processing-related molecules in ex vivo VHSV-exposed rainbow trout RBCs. Number of up-regulated and down-regulated genes related to proteasomal protein and catabolic process (GO:0010498), protein deubiquitination (GO:0016579), ubiquitin-dependent protein catabolic process (GO:0006511), antigen processing and presentation of peptide antigen via MHC class I (GO:0002474) (Supplementary Table S1), by RNA-Seq from ex vivo unexposed and VHSV-exposed RBCs at 4 hpe. Asterisks denote GO-term significance.
Table 3
Fold change of genes from the “class I MHC-mediated antigen processing and presentation” and “antigen processing: ubiquitination and proteasome degradation” pathways in the transcriptomic analysis of VHSV-exposed rainbow trout RBCs at 4 hpe. Gene expression values were calculated by normalization against unexposed RBCs. Gene P values were <0.001 and FDR P values < 0.05. Gene symbols correspond to homologue Homo sapiens genes identified by sequence homology using Blast2GO.
Antigen Processing: Ubiquitination and Proteasome Degradation
Class I MHC-Mediated Antigen Processing and Presentation
Gene Symbol
Log2 Fold
Gene Symbol
Log2 Fold
cul3
4.77
canx
4.31
keap1
7.56
sec13
5.35
psma6
5.02
ikbkb
5.69
psmb5
3.72
klhl13
5.36
Table 4
Fold change of the autophagy-related genes ulk1, becn1, and atg9a obtained in the transcriptomic analysis of VHSV-exposed rainbow trout RBCs at 4 hpe. Gene expression values were calculated by normalization against uninfected RBCs. Gene P values were < 0.001 and FDR P values < 0.05.
Autophagy-Related Genes
Gene Symbol
Log2 Fold
ulk1
3.46
becn1
5.55
atg9a
3.69
3.2. Proteomic Analysis of VHSV-Exposed RBCs Showed Proteasome Down-Regulation, Increased Ubiquitination, and Regulation of Antigen Presentation-Related Molecules at 72 hpe
We analyzed the response of ex vivo RBCs to VHSV at 72 hpe using a proteomic analysis and pathway enrichment evaluation. Up-regulated proteins were overrepresented in antigen processing and presentation of peptide antigen via MHC class II (GO:0002495), and proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161), while proteasome (KEGG:03050) and antigen-processing and presentation of exogenous peptide antigen (GO:0002478) were mostly down-regulated (Figure 2a). A list of all overrepresented terms and statistics is provided in Supplementary Table S3. Table 5 displays the fold change of proteins from these categories (Supplementary Table S4).
Figure 2
Proteomic analysis of VHSV-exposed RBCs showed proteasome down-regulation, increased ubiquitination, and regulation of molecules from antigen presentation pathways at 72 hpe. (a) Number of up-regulated and down-regulated proteins related to proteasome (KEGG:03050), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161), antigen-processing and presentation of exogenous peptide antigen (GO:0002478), and antigen processing and presentation of peptide antigen via MHC class II (GO:0002495), as identified by proteomic analysis from ex vivo unexposed and VHSV-exposed rainbow trout RBCs at 72 hpe (Supplementary Table S3). Asterisks denote GO-term significance. (b) Cytoscape pathway network of significantly overrepresented Immune System Process GO terms in VHSV-exposed RBCs at 72 hpe (Supplementary Table S3). Each node represents a GO-term from GO Immune System Process. Node size shows GO-term significance (P value): a smaller P value indicates larger node size. Edge (line) between nodes indicates the presence of common genes: a thicker line implies a larger overlap. The label of the most significant GO-term for each group is highlighted. Up-regulated pathways are coded as red, while down-regulated pathways are coded as green. Pathways with a similar number of up-regulated or down-regulated proteins are coded as gray. Asterisks denote statistical significance.
Table 5
List of up-regulated (left) and down-regulated (right) identified proteins from the “antigen processing and presentation of peptide antigen via MHC class II”, “proteasome-mediated ubiquitin-dependent protein catabolic process” and “proteasome” pathways. Protein FDR P values were < 0.001. Protein symbols correspond to homologue Homo sapiens proteins identified by sequence homology using Blast2GO.
Antigen Processing and Presentation of Peptide Antigen via MHC Class II
Proteasome-mediated Ubiquitin-Dependent Protein Catabolic Process
Proteasome
Upr.Protein
Log2 Fold
Downr.Protein
Log2 Fold
Upr.Protein
Log2 Fold
Downr.Protein
Log2 Fold
Upr.Protein
Log2 Fold
Downr.Protein
Log2 Fold
ACTR1B
3.37
CAPZB
−2.68
CD2AP
7.50
HSPA5
−6.23
PSMB3
4.44
PSMA1
−5.33
AP2S1
5.75
CLTC
−3.69
DDB1
3.32
PSMA1
−5.33
PSMB6
3.73
PSMA2
−5.43
CLTA
4.51
RAB7A
−4.69
GCLC
4.63
PSMA2
−5.43
PSMC2
2.98
PSMA3
−3.31
DNM2
5.32
HSPA1A
4.74
PSMA3
−3.31
PSMD13
2.26
PSMA4
−4.78
DYNC1H1
5.43
NPLOC4
1.68
PSMA4
−4.78
PSMD2
3.98
PSMA5
−6.15
KIF15
3.89
PLAA
5.08
PSMA5
−6.15
PSMD4
5.83
PSMA6
−6.49
PYCARD
3.28
PSMB3
4.44
PSMA6
−6.49
PSME1
5.73
PSMA8
−5.50
PSMB6
3.73
PSMA8
−5.50
PSMB1
−4.45
PSMC2
2.98
PSMB1
−4.45
PSMB2
−5.29
PSMD13
2.26
PSMB2
−5.29
PSMB4
−3.69
PSMD2
3.98
PSMB4
−3.69
PSME2
−3.44
PSMD4
5.83
PSME2
−3.44
PSME1
5.73
RAD23B
−3.77
RACK1
3.95
UBC
−5.19
RAD23A
4.85
UBR2
−11.48
RPS27A
5.03
VCP
−2.86
UBB
4.39
WFS1
−10.33
USP19
8.29
YOD1
2.95
A Cytoscape pathway network of significantly overrepresented Immune System Process GO terms showed up-regulation in antigen processing and presentation of peptide antigen via MHC class II, cytoplasmic pattern recognition receptor signaling pathway, neutrophil degranulation, and leukocyte activation; however, it showed down-regulation of antigen presentation via MHC class I. (Figure 2b). In Supplementary Figure S5, we show a Venn diagram to compare the common products found in our omics studies.
3.3. VHSV Induced Ubiquitination But Impaired Proteasome Degradation in Ex Vivo VHSV-exposed Rainbow Trout RBCs
To validate the role of the UPS in the nonpermissive infection of rainbow trout RBCs by VHSV, we performed a time-course experiment analyzing the expression of two genes belonging to the ubiquitin E3 ligase complex: cul3 and kelch-like ECH-associated protein 1 (keap1). The results showed increased expression of cul3 at 3 hpe while keap1 expression increased at 12 hpe (Figure 3a). We measured the activity of the 20S proteasomes using a commercial kit and observed a MOI-dependent decrease in 20S proteasome activity (Figure 3b). Then, we performed a western blot using an anti-ubiquitin antibody for unexposed and VHSV-exposed RBCs with or without the proteasome inhibitor MG132. Ubiquitination of proteins on VHSV-exposed RBCs increased in comparison with unexposed RBCs. A higher amount of ubiquitinated proteins was also found in RBCs treated with MG132 (Figure 3c,d). To test whether the proteasome is involved in the degradation of VHSV, we assessed the presence of NVHSV using 2C9 monoclonal antibody in VHSV-exposed RBCs treated with MG132. Flow cytometry results did not show an increase in intracellular NVHSV in VHSV-exposed RBCs treated with MG132 (Figure 3e). The population used for the flow cytometry analysis is depicted in Supplementary Figure S6. Double staining using 2C9 and anti-ubiquitin antibodies showed higher ubiquitin labeling in RBCs with VHSV (Figure 3f).
Figure 3
VHSV induced protein ubiquitination but impaired proteasome degradation in ex vivo VHSV-exposed rainbow trout RBCs. (a) Time-course expression of cul3 and keap1 at 0, 3, 6, 24, 48, and 72 hpe from VHSV-exposed (MOI 1) RBCs. Data represent mean ± SD (n = 5), relative to control cells (black dotted line). A two-way analysis of variance (ANOVA) with Sidak´s multiple comparisons test was performed to test statistical significance between unexposed and VHSV-exposed RBCs at each time point. (b) 20S proteasome activity measured by fluorogenic substrates in RBCs unexposed or exposed to VHSV at the indicated MOI at 24 hpe. Data represent mean ± SD (n = 3). Kruskal-Wallis with Dunn’s multiple comparisons test was performed to test statistical significance between each condition and unexposed RBCs. (c) Western blot of ubiquitin of lysates from unexposed and VHSV-exposed (MOI 10) RBCs at 24 hpe, treated with or without MG132 (5 µM). α-actin was used as endogenous control. Results are representative of 2 independent experiments. (d) Integrated densitometry of ubiquitin lane content from unexposed and VHSV-exposed (MOI 10) RBCs at 24 hpe, treated with or without MG132 (5 µM). Values were normalized to α-actin. Data represent mean ± SD (n = 2). (e) Intracellular quantification by flow cytometry of NVHSV in VHSV-exposed (MOI 10) RBCs at 72 hpe, treated with or without MG132 (1 or 5 µM). Data represent mean ± SD (n = 4). Kruskal-Wallis with Dunn’s multiple comparisons test was performed to test statistical significance between MG132 treated and non-treated RBCs. (f) Representative immunofluorescence of unexposed (control) and VHSV-exposed RBCs at MOI 100 and at 9 hpe stained with anti-ubiquitin (488 stain), 2C9 anti-NVHSV (647 stain), and DAPI for nuclei staining. Asterisks denote statistical significance.
3.4. VHSV Induced Autophagy in Ex Vivo VHSV-exposed Rainbow Trout RBCs
To determine whether VHSV induced autophagy in ex vivo rainbow trout RBCs, we exposed RBCs to VHSV at MOI 1 for 24 h. We identified the presence of autophagosome-like vesicles inside VHSV-exposed RBCs (Figure 4a) via TEM. We visually counted the number of autophagosome-like vesicles in unexposed RBCs and VHSV-exposed RBCs and noted a significant increase in VHSV-exposed RBCs (Figure 4b). The turnover of the autophagy protein LC3A/B was monitored by means of LC3A/B immunostaining, as previously described for rainbow trout cells [14,51]. LC3 immunostaining increased at higher MOIs in a dose-dependent manner up to 2-fold in comparison with unexposed RBCs at 24 and 72 hpe (Figure 4c). By immunofluorescence microscopy, we identified an increased number of LC3 dots in VHSV-exposed RBCs (Figure 4d). Moreover, we analyzed the ubiquitin-binding protein p62, which undergoes degradation during activation of autophagy [52], as it is an autophagosome cargo protein that targets other proteins for selective autophagy. To evaluate whether p62 undergoes degradation in the RBC response to VHSV, an intracellular staining using anti-p62 antibody was performed on unexposed and VHSV-exposed (MOI 10) RBCs at 6, 12, and 24 hpe. Decreased intracellular p62 levels were detected in VHSV-exposed RBCs at 6 hpe compared to control RBCs (Figure 4e,f). By 24 hpe, p62 levels recovered from the degradation observed at 6 hpe. Kinetics of expression of the autophagy-related genes ulk1, becn1 and gabarap showed statistically significant up-regulation at 3 hpe (Supplementary Figure S7).
Figure 4
VHSV induced autophagy in ex vivo VHSV-exposed rainbow trout RBCs. (a) Representative transmission electron micrographs of VHSV-exposed RBCs, pointing out autophagosome-like vesicles (black arrows). (b) Count of autophagosome-like vesicles from transmission electron micrographs of unexposed and VHSV-exposed rainbow trout. Data represent the mean ± SD (n = 30). A Mann-Whitney test was performed to test statistical significance. (c) Autophagosome membrane protein LC3 expression levels in VHSV-exposed RBCs at 24 (gray bars) and 72 hpe (black bars) relative to unexposed RBCs (red line) evaluated by flow cytometry (n = 5). Data is represented as MRFI (Mean Relative Fluorescence Intensity) = fluorescence in VHSV-exposed RBCs/fluorescence in non-exposed RBCs. A Kruskal-Wallis with Dunn´s multiple comparisons test was performed to test statistical significance between each condition and unexposed RBCs. (d) Representative immunofluorescence of unexposed (control) and VHSV-exposed RBCs at MOI 1 and at 72 hpe stained with anti-LC3 (488) and DAPI for nuclei staining. (e) Mean fluorescence intensity of p62 protein expression in RBCs unexposed (gray bars) and exposed to VHSV at MOI 10 (red bars) after 6, 12, and 24 hpe. Data represent the mean ± SD (n = 5). A Mann-Whitney test was performed to test statistical significance between unexposed and VHSV-exposed RBCs at each time point. (f) Representative histograms of p62 in RBCs exposed to VHSV (MOI 10) at 6, 12, and 24 hpe: unexposed (gray histogram), VHSV-exposed (red histogram). Asterisks denote statistical significance.
3.5. Niclosamide Increased p62 and Intracellular VHSV Levels in Ex Vivo VHSV-exposed RBCs
The drug niclosamideblocks autophagy degradation via lysosomal dysfunction [53,54]. Moreover, niclosamide has been previously used in the context of viral infections [55]. After exposing RBCs to VHSV MOI 10, RBCs were treated with niclosamide at 10 and 20 µM. Then, an intracellular stain using 2C9 and anti-p62 antibodies was done at 72 hpe. Flow cytometry results showed that VHSV-exposed RBCs treated with niclosamide at both tested concentrations had a higher percentage of NVHSV- and p62-positive cells compared to RBCs exposed to VHSV but not treated with niclosamide (Figure 5a). MFI of unexposed RBCs and VHSV-exposed (MOI 10) RBCs were similar, but both NVHSV and p62 MFI increased up to three-fold in the presence of niclosamide (Figure 5b).
Figure 5
Niclosamide increased p62 and intracellular VHSV levels in ex vivo VHSV-exposed RBCs. (a) Representative histograms of NVHSV (green) and p62 (red) intracellular expression in RBCs unexposed (control) and VHSV-exposed (MOI 10) RBCs treated or not with niclosamide 10 or 20 µM and evaluated by flow cytometry at 72 hpe. Percentages represent the number of positive cells. Dimethyl sulfoxide (DMSO) was added to untreated RBCs to match culture conditions of treated cells (DMSO 0.04%). (b) MFI of intracellular NVHSV (green) and p62 (red) in unexposed (control) and VHSV-exposed (MOI 10) RBCs treated or not with niclosamide 10 or 20 µM and evaluated by flow cytometry at 72 hpe. Data represent mean ± SD (n = 6). A two-way ANOVA with Tukey´s multiple comparisons test was performed to test statistical significance. Asterisks denote statistical significance.
3.6. Rainbow Trout RBCs Up-Regulated MHCI, MHCII, CD86, and CD83 after VHSV Exposure
Because antigen presentation pathways were overrepresented in transcriptomic and proteomic analyses, we investigated whether RBCs expressed characteristic cell markers molecules of APCs. RNA was extracted from RBCs and then we performed RT-PCR. Semi-quantitative PCR was performed, and a mix of tissue samples from the head kidney, spleen, and gill was used as a positive control for APCs genes expression. Final products from semi-quantitative PCR were analyzed in agarose gel electrophoresis. mRNA transcripts from mhcI, mhcII, and cd83 were detected in rainbow trout RBCs, whereas there was no cd86 expression (Figure 6a). We then examined how VHSV modified the expression of these transcripts using quantitative RT-qPCR. We observed a slight increase in mhcI expression and a pronounced increase in mhcII, cd83, and cd86 expression in VHSV-exposed RBCs at 4 hpe. Whereas, we only observed up-regulation of cd86 at 72 hpe (although lower than levels at 4 hpe), while no up-regulation was observed at 72 hpe for the mhcI, mhcII, and cd83 genes (Figure 6b). We confirmed the up-regulation of MHCI, MHCII, CD86, and CD83 at the protein level in VHSV-exposed RBCs 24 hpe (Figure 6c–e). Also, cd83 gene expression was found to be up-regulated by transcriptomic analysis at 4 hpe (Log2 fold: 4.87; Supplementary Table S2). In contrast, MHCI protein expression was found down-regulated by proteomic analysis at 72 hpe (Log2 fold: −11.38; Supplementary Table S4).
Figure 6
Rainbow trout RBCs up-regulated MHCI, MHCII, CD83, and CD86 molecules after exposure to VHSV. (a) Specific transcript mRNA expression of mhcI, mhcII, cd86, and cd83 genes from rainbow trout RBCs. A mix of gill, spleen, and head kidney tissues was used as a positive control of expression from the assayed cell markers (C+). The ef1α gene was used as an endogenous control. (b) Fold change in the expression of mhcI, mhcII, cd86, and cd83 in rainbow trout RBCs at 4 and 72 hpe with VHSV MOI 1 in comparison to unexposed RBCs, by RT-qPCR. Data represent mean ± SD (n = 4). Dotted red line represents basal gene expression from unexposed RBCs. A Mann-Whitney test was performed to test statistical significance between VHSV-exposed and unexposed RBCs. (c) Representative histograms of MHCI, MHCII, CD86, and CD83 extracellular stain in unexposed RBCs (black) and VHSV-exposed RBCs (red) (MOI 10) at 24 hpe. (d) MFI of MHCI, MHCII, CD86, and CD83 extracellular stain in unexposed RBCs (gray bars) and VHSV-exposed RBCs (red bars) (MOI 10) at 24 hpe. Data represent mean ± SD (n = 4). A Mann-Whitney test was performed to test statistical significances between VHSV-exposed and unexposed RBCs. (e) Representative immunofluorescence images of MHCII and CD83 expression in control and VHSV-exposed RBCs at 24 hpe. Asterisks denote statistical significance.
3.7. VHSV Induced Autophagy and Antigen Presentation Genes Expression in RBCs from VHSV-challenged Rainbow Trout
We evaluated whether VHSV could induce both autophagy- and antigen-presentation-related genes in vivo by using RBCs from VHSV-challenged and mock-infected rainbow trout. We used tissue samples from the spleen and head kidney, as well as total blood and Ficoll-purified RBC samples, from VHSV-challenged and mock-infected rainbow trout to quantify NVHSV gene transcripts by RT-qPCR. RBCs from challenged rainbow trout showed lower levels of NVHSV in comparison with total blood, spleen, and head kidney samples (Figure 7a). We also analyzed ubiquitination of proteins in RBCs from VHSV-challenged and mock-infected rainbow trout and we did not observe an increase in ubiquitinated proteins at 2 days post challenge (dpc) (Figure 7b,c), in contrast to ex vivo experiments. We analyzed the expression of a set of genes related to autophagy, E3 ubiquitin ligase component, and antigen presentation in RBCs from VHSV-challenged rainbow trout after 1 and 2 dpc by RT-qPCR. The expression of autophagy-related genes gabarap and pik3c3 was significantly up-regulated at 1 dpc. However, only pik3c3 gene expression was observed up-regulated at 2 dpc. On the other hand, atg4b and becn1 genes were down-regulated at 1 and 2 dpc. ulk1 gene expression was also down-regulated at 2 dpc (Figure 7d). For E3 ubiquitin ligase components, cul3 and keap1 expression was significantly increased at 1 and 2 dpc, respectively (Figure 7d). For antigen presentation-related genes, mhcI and cd83 were highly up-regulated in RBCs from VHSV-challenged rainbow trout at 1 and 2 dpc, while cd86 was significantly down-regulated at 1 dpc. mhcII gene expression showed a tendency to increase at 1 dpc, but not significantly (Figure 7d).
Figure 7
VHSV induced autophagy, E3 ubiquitin ligase components, and antigen presentation genes expression in RBCs from VHSV-challenged rainbow trout. (a) Quantification of NVHSV in head kidney, spleen, blood, and purified RBC samples from challenged rainbow trout 2 dpc. Data represent mean ± SD (n = 7). A Kruskal-Wallis with Dunn´s multiple comparisons test was performed to test statistical significance. (b) Western blot of ubiquitin in RBCs from mock and VHSV-challenged rainbow trout at 2 dpc. α-actin was used as a loading control. Samples from 2 individuals were loaded for each condition. (c) Densitometry bar plot of ubiquitin lane protein content of RBCs from mock and VHSV-challenged rainbow trout after 2 dpc. Values were normalized to α-actin. Data represent mean ± SD (n = 2). Mann-Whitney test was used to test statistical differences. (d) Gene expression values of the autophagy-related genes atg4b, ulk1, becn1, gabarap, and pik3c3; E3 ligase component genes cul3 and keap1; and antigen presentation genes mhcI, mhcII, cd83, and cd86 measured by RT-qPCR in RBCs from mock (gray) and VHSV-challenged (red) rainbow trout at 1 dpc (no pattern) and 2 dpc (striped pattern). Data represent mean ± SD (n = 6). A Mann-Whitney test was performed to test statistical significances between RBCs from mock and VHSV-challenged rainbow trout. Asterisks denote statistical significance.
3.8. GVHSV Protein Peptides Colocalize with MHCI and MHCII in VHSV-Exposed Rainbow Trout RBCs
To establish a correlation between the presence of VHSV peptides from autophagy and MHCI and MHCII molecules (the expression of which was up-regulated after VHSV exposure), we performed a PLA between MHCI or MHCII and VHSV using the DuoLink kit. At 24 hpe, RBCs were stained using a rabbit polyclonal antibody against GVHSV and a mouse monoclonal antibody against MHCI or MHCII. We observed an increase in the percentage of positive cells in VHSV-exposed RBCs in contrast to unexposed RBCs (Figure 8a). A representative positive colocalization is shown in Figure 8b.
Figure 8
GVHSV protein peptides colocalize with MHCI and MHCII in VHSV-exposed rainbow trout RBCs. (a) Percentages of positive RBCs in MHCI – GVHSV and MHCII – GVHSV interaction under unexposed and VHSV-exposed conditions. Rabbit serum was used to test unspecific interaction with mouse anti-MHCI and anti-MHCII antibodies in VHSV-exposed RBCs. Data represent percentage of positives RBCs counted by IN Cell Developer software using an algorithm to detect fluorescent events in RBCs (n = 2 individuals, 8 fields were analyzed in each slide). A Kruskal-Wallis with Dunn´s multiple comparisons test was performed to test statistical significances between all the conditions. (b) Representative microscopy images of Duolink PLA for MHCI or MHCII and GVHSV in VHSV-exposed RBCs. Positive RBCs for the PLA are indicated with white arrows. Asterisks denote statistical significance.
4. Discussion
In this study, we have demonstrated that autophagy is implicated in the clearance of VHSV virions in nucleated rainbow trout RBCs, a cell whose main known function has been oxygen transportation. While previous studies have identified virus-related autophagy in teleost RBCs [16] and have localized the expression of MHCI molecules to the surface of nucleated RBCs [30], even in different vertebrate species [56], our results provide the first evidence of nucleated RBCs up-regulating APC markers in the context of a viral infection. Our findings suggest that RBCs could potentially play a new role in which autophagy is involved in viral protein degradation and the generated peptides are coupled to MHC molecules. A graphical summary of this process is shown in Figure 9.
Figure 9
Proposed schematic representation of processes involved in VHSV degradation and antigen processing in rainbow trout nucleated RBCs. VHSV cell entry is mediated by endosome acidification, which leads to membrane fusion and thus release of the capsid. RBC transcription of autophagy genes and components of the E3 ubiquitin ligase then starts and intracellular proteins are ubiquitinated to be marked for degradation. The low proteasome activity induced as a consequence of the VHSV proteins presence leads to the accumulation of ubiquitinated proteins that are suggested to be degraded in the autophagosome. Finally, peptides from this process can be coupled into MHC molecules that are later transported to the membrane to potentially participate in the antigen presentation process.
Transcriptomic analysis of RBCs at four hours after VHSV exposure showed up-regulation of cul3, keap1, psma6, and psmb5 genes from the antigen-processing category. cul3 and keap1 are components of the E3 ubiquitin ligase complex involved in the ubiquitination of proteins targeted for proteasome degradation [57], and psma6 and psmb5 are part of proteasome complexes. In the MHCI presentation pathway, our analysis identified canx, which is involved in the assembly of MHCI [58]; sec13, whose expression correlates with the expression of MHCI [58]; and ikbkb. These results correlated with the increase in ubiquitinated proteins induced by VHSV as detected by western blot. Different viruses have been reported to induce ubiquitination. This effect was observed with West Nile Virus; its capsid protein was ubiquitinated by Makorin ring finger 1 protein and later sent for proteasome degradation [59]. Ubiquitination was also reported for the core protein of human hepatitis C virus [60] and turnip yellow mosaic virus [61]. However, our results also showed lower proteasome activity, which could be due in part to the accumulation of ubiquitinated proteins in VHSV-exposed RBCs. Proteasome activity has been reported to favor the replication of different viruses [62,63], and it has been found to prevent viral replication [64]. In contrast, proteasome activity did not seem to play a role in VHSV degradation in our study.Increased autophagy activity was demonstrated both at the transcriptional and translational levels in VHSV-exposed RBCs. Several studies have shown a protective role of autophagy against different viruses, including dengue [65], sindbis [66], vesicular stomatitis virus (VSV) [67], and VHSV [14]. Our results demonstrated that VHSV exposure induced autophagy in rainbow trout RBCs; this prevented VHSV infection, as shown by p62 degradation and the results observed when VHSV-exposed RBCs were treated with niclosamide, which led to the accumulation of both p62 and VHSV. p62 accumulation suggested that autophagosome degradation was blocked in RBCs. We also observed an increase in intracellular VHSV. Therefore, autophagy may be a mechanism involved in VHSV degradation. We previously reported that the N:G gene expression ratio in RBCs exposed to VHSV was lower than commonly reported ratio levels [7], indicating that VHSV replication in RBCs was inhibited early after VHSV exposure. VHSV starts replication of the N gene within the first 6 hpe in RBCs in the permissive cell line RTG2 [7], so all processes aiming to inhibit VHSV infection in RBCs should occur during this time. Our results correlated with this report, since there was an early transcriptional response of autophagy-related genes together with p62 degradation at 6 hpe. p62 has been described to be the link between autophagy and the UPS [68,69], since autophagosome degradation of ubiquitinated proteins has been already reported [70], and p62 itself undergoes degradation upon autophagy activation. Moreover, some studies have reported a direct interaction between p62 and different viruses [66] or bacteria [71]. Our results showed a decrease in p62 levels that later recovered [72], suggesting that p62 may act as an adaptor protein that targeted VHSV for autophagic degradation, although this cannot be confirmed because we have not observed interaction between p62 and VHSV proteins. In this sense, other ubiquitin-binding autophagy mediators such as NRB1, NDP52 and optineurin [73] could be evaluated in the future.RBCs exhibited an APC-like profile with MHCII, CD86, and CD83 endogenous expression. CD86 and CD83 are known costimulatory cell surface markers of APC maturation [74] and are involved in the regulation of different immune processes, such as lymphocytes proliferation and activation [75]. The presence of MHCII with the costimulatory molecules CD83 and CD86 suggests a more professionalized APC profile for RBCs, since MHCI has been reported to be expressed in almost all nucleated cells [76]. Our results showed modulation in the expression of MHCI, MHCII, CD83, and CD86 proteins when RBCs were exposed to VHSV. Antigen presentation via MHCI is normally associated with peptides derived from UPS, but recent reports have shown a contribution of autophagy to antigen presentation via MHCI molecules [77]. On the other hand, autophagy is the main source of peptides for MHCII molecules [78]. Moreover, we showed that antigen presentation via MHCI and MHCII potentially could be functional, because peptides from GVHSV colocalized with MHC molecules. Recently, it has been reported that different cell types called atypical APCs, such as neutrophils [79] or lymph node stromal cells [80] could be involved in antigen presentation, supporting the hypothesis that these atypical APCs could play an important role in various immune processes apart from antigen presentation [34]. However, to properly classify teleost RBCs as a typical APC, studies are needed to test their ability to activate naïve T cells, as this is main difference between atypical and typical APCs [34].The results obtained from ex vivo RBCs culture experiments were partially corroborated under an in vivo scenario. RBCs from VHSV-challenged rainbow trout showed lower NVHSV transcript load compared to other tissues, similar to VHSV halted infection in ex vivo RBCs cultures [7]. We observed the expression of autophagy genes early after VHSV challenge, similar to the kinetics observed in ex vivo RBCs exposed to VHSV. In addition, we observed up-regulation of cul3 at 1 dpc followed by keap1 up-regulation at 2 dpc, just as we observed in ex vivo time-course experiments. In vivo results showed up-regulation of mhcI, mhcII, cd83, and cd86 in RBCs from challenged rainbow trout, which correlated with their increased expression observed in ex vivo RBCs exposed to VHSV. In contrast, lack of ubiquitination was observed in RBCs from VHSV-challenged rainbow trout.In summary, after VHSV cell entry into RBCs, the transcription of autophagy genes and components of the E3 ubiquitin ligase started. The low proteasome activity that was induced as a consequence of the presence of VHSV led to the accumulation of ubiquitinated proteins. Finally, peptides from this process could be coupled into intracellular MHC molecules that would be later transported to the membrane to potentially participate in the antigen presentation process. Further studies are being performed to fully describe the potential functional APC role in nucleated teleost RBCs to ascertain how MHC molecules participate or are implicated in the presentation of degraded viral antigens in nucleated RBCs. Given that RBCs are the most abundant cell type in the blood, this new knowledge will shed light on the design of novel vaccine targets. Potential applications of these results could imply that RBCs, which can be transfected and induce immune gene expression [32], are target of new strategies for vaccination.
Authors: E Datan; S G Roy; G Germain; N Zali; J E McLean; G Golshan; S Harbajan; R A Lockshin; Z Zakeri Journal: Cell Death Dis Date: 2016-03-03 Impact factor: 8.469
Authors: Ivan Nombela; Aurora Carrion; Sara Puente-Marin; Verónica Chico; Luis Mercado; Luis Perez; Julio Coll; Maria Del Mar Ortega-Villaizan Journal: F1000Res Date: 2017-11-07
Authors: Sara Puente-Marin; Iván Nombela; Sergio Ciordia; María Carmen Mena; Verónica Chico; Julio Coll; María Del Mar Ortega-Villaizan Journal: Genes (Basel) Date: 2018-04-09 Impact factor: 4.096
Authors: Paolo Ronza; José Antonio Álvarez-Dios; Diego Robledo; Ana Paula Losada; Roberto Romero; Roberto Bermúdez; Belén G Pardo; Paulino Martínez; María Isabel Quiroga Journal: Animals (Basel) Date: 2021-04-30 Impact factor: 2.752
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Sara Puente-Marin; Ivan Nombela; Veronica Chico; Sergio Ciordia; Maria Carmen Mena; Luis Garcia Perez; Julio Coll; Maria Del Mar Ortega-Villaizan Journal: Vaccines (Basel) Date: 2019-07-03
Authors: Ivan Nombela; Marina Lopez-Lorigados; Maria Elizabeth Salvador-Mira; Sara Puente-Marin; Veronica Chico; Sergio Ciordia; Maria Carmen Mena; Luis Mercado; Julio Coll; Luis Perez; Maria Del Mar Ortega-Villaizan Journal: Vaccines (Basel) Date: 2019-07-09
Authors: Maria Salvador-Mira; Veronica Chico; Monica Arostica; Fanny Guzmán; Nerea Roher; Luis Perez; Maria Del Mar Ortega-Villaizan Journal: Int J Mol Sci Date: 2021-10-30 Impact factor: 5.923