Literature DB >> 31031465

Homology modeling identified for purported drug targets to the neuroprotective effects of levodopa and asiaticoside-D in degenerated cerebral ganglions of Lumbricus terrestris.

Mamangam Subaraja1, A Kulandaisamy2, N R Siva Shanmugam2, Arambakkam Janardhanam Vanisree1.   

Abstract

CONTEXT: Homology modeling plays role in determining the therapeutic targets dreadful for condition such as neurodegenerative diseases (NDD), which pose challenge in achieving the effective managements. The structures of the serotonin transporter (SERT), aquaporin (AQP), and tropomyosin receptor kinase (TrkA) which are implicated in NDD pathology are still unknown for Lumbricus terrestris, but the three-dimensional (3D) structure of the human counterpart for modeling. AIM: This study aims to generate and evaluate the 3D structure of TrkA, SERT, and AQP proteins and their interaction with the ligands, namely Asiaticoside-D (AD) and levodopa (L-DOPA) the anti-NDD agents. SUBJECTS AND METHODS: Homology modeling for SERT, AQP, and TrkA proteins of Lumbricus terrestris using SWISS-MODEL Server and the modeled structure was validated using Rampage Server. Wet-lab analysis of their correspondent m-RNA levels was also done to validate the in silico data.
RESULTS: It was found that TrkA had moderately high homology (67%) to human while SERT and AQP could exhibit 58% and 42%, respectively. The reliability of the model was assessed by Ramachandran plot analysis. Interactions of AD with the SERT, AQP-4, and TrkA showed the binding energies as -9.93, 8.88, and -7.58 of Kcal/mol, respectively, while for L-DOPA did show -3.93, -5.13, and -6.0 Kcal/mol, respectively. The levels of SERT, TrkA, and AQP-4 were significantly reduced (P < 0.001) on ROT induced when compared to those of control worms. On ROT + AD supplementation group (III), m-RNA levels were significantly increased (P < 0.05) when compared to those of ROT induced worms (group II).
CONCLUSION: Our pioneering docking data propose the possible of target which is proved useful for therapeutic investigations against the unconquered better of NDD.

Entities:  

Keywords:  Asiaticoside-D; Lumbricus terrestris; degenerative cerebral ganglions; homology modeling; m-RNAs

Mesh:

Substances:

Year:  2019        PMID: 31031465      PMCID: PMC6444839          DOI: 10.4103/ijp.IJP_600_18

Source DB:  PubMed          Journal:  Indian J Pharmacol        ISSN: 0253-7613            Impact factor:   1.200


Introduction

Three-dimensional (3D) structure of a target protein from the amino acid sequence of homologous proteins could be predicted using X-ray or nuclear magnetic resonance structural analyses. From the earthworm Lumbricus rubellus, 8129 unique-expressed sequence tags were isolated.[12] Of which, around 21% of gene (1728) exhibit significant homologies to counterparts documented in the genome of the nematode (Caenorhabditis elegans), the fruit fly (Drosophila melanogaster), and humans (Homo sapiens), highlighting that within most of eukaryotic organisms, the key in biological and metabolic pathways is preserved. Besides, it is very interesting to note that the cohorts of earthworm showed higher percentage (%) of homology with the humans (220 genes) when compared with those of fruit fly (68 genes) and nematode (49 genes).[3] According to the studies, 14,000 of protein-coding human gene are related to worm's gene and 70% of the gene was known to be associated with human disease. As worms were reported to exhibit similar structural, functional, and signaling features as that of mammalian systems.[4] Their simple nervous system could be an ideal candidate of replica for investigation that aims in the exploration of neurobiology of humans. The mammalian nerve growth factors (NGF) is similar to worms gene: NGF is now known to stand at the apex of the ngf pathways also conserved in mammals that is crucial for differentiation, migration, cell polarity, and axon guidance during neuronal development,[5] learning and memory,[678] and the efficacy of synaptic transmission.[9] Serotonin is an important monoamine acting in the brains of humans and animals. Serotonergic system is highly conserved and exists in both the vertebrates and invertebrates model.[10] Serotonin transport (SERT) – which serotonin transports from the synaptic cleft to the presynaptic neuron – is a type of monoamine transporter protein consisting of 630 amino acids. SERT has a structure similar to the octopamine transporter and dopamine transporter (DAT) and is regulated by several pathways that are linked by protein kinases (PK), such as PKG, PKC, and p38 mitogen-activated PK (MAPK).[111213] MAPK/PI3K/AKT/mTOR and RAS/RAF/MEK/ERK pathways signify signaling transduction and regulated by cellular physiological processes, such as differentiation, proliferation, and cell survival. PLC γ1 activate the TrkA and prompt the level of Ca2+ ions which are regulate the synaptic plasticity and PKC signaling cascade.[1415] Aquaporin (AQP) is a channel protein which manages water transport in plants, microbial organisms, invertebrates (insects, ticks, and nematodes), and vertebrates. The water transport is a fundamental process in neuronal function,[16] and the AQPs are expressed in tissues where a fluid balance is of a major concern. In brain, AQPs were reported for regulating water homeostasis, edema, angiogenesis, cell migration, and development.[17] They were found to be abnormally expressed in pathological conditions such as neuroinflammatory diseases and neurodegenerative diseases (NDD), in which preservation of brain homeostasis is at risk,[1819] and thus AQPs have been selected for docking analysis in this study. Docking studied the drug design and is regularly used to predict the binding actions of drug molecules to their targeted proteins. The biological and pharmaceutical significance of molecular docking was well-understated.[20] Many current treatments focus on preventing the loss of neurotransmitters or replacing their depleted neurotransmitters such as levodopa (L-DOPA) for replacing dopamine in Parkinson's disease and donepezil in the treatment of Alzheimer disease. Although these are also studies which are interested in assessing the impact of gene therapy and stem cells against neurodegeneration (ND), ND therapy is still focused on identifying the drug molecules which can target key molecules that can cause the debilitating ND condition. Lee and Kim[21] studied human catecholamine-O-methyltransferase for designing anti-PD drug using the ligand docking and homology modeling. Modeling plays role in determining the therapeutic targets dreadful for condition such as NDD, which pose challenge in achieving the effective managements. The structures of the SERT, AQP-4, and TrkA which are implicated in NDD pathology are still unknown for Lumbricus terrestris, but the 3D structure of the human counterpart for modeling. Through this point, it can be suggested that the binding interaction between drugs and its molecule targets can be considered for building therapeutic strategies; the wet-lab data could be considered for feature research. As in silico studies in model systems have validated “energy sufficiencyas a promising therapeutic approach, we aimed at elucidating the structure similarity of proteins of L. terrestris with those of humans and in assessing their signified interaction with drugs that were proven for their neuroprotective effects.

Subjects and Methods

Sequences analysis and preparation of protein structures

The sequences of SERT, AQP, and TrkA protein of earthworm were retrieved from the Universal Protein Resource (Uniprot) in the FASTA format. The crystal structures of these proteins of L. terrestris are not available in protein databank database (PDB) and hence were retrieved from the templates such as SERTs (PDB ID: 5I6Z), TrkA (PDB ID: 4G65), and AQP (PDB ID: 2D57s).

Protein modeling and validation

The 3D structure of the protein (NAME) was modeled using a SWISS-MODEL Server,[22] which is based on homology modeling. The structure validation was validated using Rampage Sever.[23]

Preparation of ligand structures

Asiaticoside-D structure was drawn using ChemDraw software and converted to their 3D structure using Openbabel software. L-DOPA was retrieved from PubChem (ID No. 6047) which is reported to alter the locomotors and rigidity as side effect was observed.[24]

Energy minimization

Analysis of protein structure energy was minimized using chimera software.

Prediction of active sites

Binding sites of protein were analyzed using the SITEHOUND server.[25]

Molecular docking and molecular dynamic simulations

In the current study, docking was studied using AutoDock provided by the Scripps Research Institute (version 4.2, La Jolla, CA)[26] and molecular dynamic stimulation.[27] Estimated binding energy (ΔG binding) kcal/mol and inhibition constant (Ki) were calculated. Binding energy = Intermolecular energy + Torsional energy. ΔGbind = ΔGvdw + ΔGele. + ΔGH-bond + ΔG desolv + ΔGtors Here ΔG = change in free energy.

Experimental studies for validation of the docking date of the neuroprotective Asiaticoside-D

The laboratory maintained worms were randomly divided into five groups with each group containing twelve L. terrestris. Group I: Served as control L. terrestris Group II: L. terrestris exposed to 0.4 ppm of ROT for 7 days Group III: L. terrestris exposed to 0.4 ppm of ROT and 15 ppm of Asiaticoside-D (AD) for 7 days Group IV: L. terrestris exposed to 15 ppm of AD for 7 days Group V: L. terrestris exposed to 0.2% of dimethyl sulfoxide for 7 days. After the experimental time, the worms were euthanized. The CGs were dissected out and were used for further investigation.

Semiquantities-reverse transcriptase-polymerase chain reaction

Semiquantitative reverse transcription-polymerase chain reaction (Semi-QRT-PCR) was performed as 20 μl of reaction mixture containing 2.0 μl of cDNA, 500nM of forward primer, 500nM reverse primer, and 10 μl PCR Master Mix. The cycling conditions were as follows: initially denaturing at 95°C for 5 min, denaturing at 95°C for 15 s, annealing 60°C for 20 s, and extension at 72°C for 30 s. 5 μl of each PCR products was loaded with 2.0% agarose gel and UV was visualized using gel documentation system. The β-actin served as loading control and band intensities were analyzed using image J software. Primer sequences (Primer 3 software) were follows: SERT (FP: CCAGTGTCACCAACCTCACA and RP: ACCACTTGACCGTTCCAACA), AQP-4 (FP: TTCCGCATCACCAACTCTCC and RP: CTGCTGAGGAGGATTCACGG), TrkA (FR: CCCTGAAGGAAGTGACGGAG and RP: GTGTAGGCTGACCACATGCT), and β-actin (FP: TCTCGGCGATTTTGTCCCAT and RP: GAGCATGTGTGTGGTGTCCT) used for RT-PCR.

Results

Homolog modeling and evaluation

The AQP, SERT, and TrkA protein structures were used for SWISS-MODEL Server [Table 1]. Homology showed that TrkA had moderately high homology (67% identity) to human while SERT and AQP had exhibited 58% and 42% of identity, respectively, toward those of human origin. The query cover and chain were shown in Table 2.
Table 1

The quality of the homologous-modeled protein was seen in SWISS-MODEL Server

Sequence alignment of (A) AQP, (B) SERT, and (C) TrkA were performed. Alignment result between AQP, SERT, and TrkA protein transmembrane region and the orange regions represent the amino acids transmembrane region of 2D57s, 516Z, and 4G65. AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase

Table 2

Data on homologous modeling protein of earthworms with these of human using SWISS-MODEL Server

ProteinsMaximum identity (%)Query coverage (%)Template
AQP42952D57 A chain
SERT581005I6Z A chain
TrkA67954J9U E chain

AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase

The quality of the homologous-modeled protein was seen in SWISS-MODEL Server Sequence alignment of (A) AQP, (B) SERT, and (C) TrkA were performed. Alignment result between AQP, SERT, and TrkA protein transmembrane region and the orange regions represent the amino acids transmembrane region of 2D57s, 516Z, and 4G65. AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase Data on homologous modeling protein of earthworms with these of human using SWISS-MODEL Server AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase The protein structures were validated by the use of Rampage severs [Figure 1]. The 3D structure of AQP showed 94.9% amino acid residue in the preferred areas, 4.7% amino acid residue in the allowed areas, and 0.4% amino acid residue in the outlier areas; SERT showed 95.5% amino acid residue in the preferred areas, 3.4% amino acid residue in the allowed areas, and 1.1% amino acid residue in the outlier areas; whereas TrkA showed 97.9% amino acid residue in the preferred areas, 1.9% amino acid residue in the allowed region, and 0.2% amino acid residue in the outlier areas [Table 3].
Figure 1

Ramachandra plot of modeled (a) AQP, (b) SERT and (c) TrkA protein structures. The blue colour area indicates the favored regions, the organ colour areas indicate the allowed regions, and the areas outside of the read areas represent the outlier region

Table 3

Evaluation of amino acid residues by Ramachandran Plot in the AQP, SERT and TrkA

Protein sNumber of residues in favored region (%)Number of residues in allowed region (%)Number of residues in outlier region (%)
AQP94.94.70.4
SERT protein95.53.41.1
TrkA97.91.90.2

AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase

Ramachandra plot of modeled (a) AQP, (b) SERT and (c) TrkA protein structures. The blue colour area indicates the favored regions, the organ colour areas indicate the allowed regions, and the areas outside of the read areas represent the outlier region Evaluation of amino acid residues by Ramachandran Plot in the AQP, SERT and TrkA AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase

Molecular docking

The 3D structure of proteins and drugs were shown in the Figure 2a–e. The interaction of amino acid residues of SERT, AQ, P and TrkA with both AD and L-DOPA was identified [Figure 3a–f]. The binding interactions of AD were as follows: with residues Asn122 of SERT; with AQP residues Thr41; and with TrkA residues Arg373, Ala340, and Glu143. The protein SERT, AQP, and TrkA showed the binding energy −9.93, 8.88, and −7.58 of Kcal/mol, respectively, and inhibition constant as 2.43 mM, 307.80 nM, and 2.79 μM, respectively. The binding interaction of L-DOPA with the SERT residues (Leu123, Try79, Phe133, Ser126 and Gln131), AQP (Ser143, Thr14, AP50, ASP137 and Thr141), TrkA (Try131, Ser142, Arg373 and Gln339), it was found that the SERT, AQP and TrkA had exhibited very low binding energy −3.93, −5.13, and −6.0 Kcal/mol with inhibition constant 1.32 mM, 52.53 nM, and 39.97 μM respectively [Figure 3 and Tables 4, 5]. AD could exhibit higher binding energy with SERT (-9.93Kcal/mol).
Figure 2

Three dimensional structure of proteins [(a) AQP, (b) SERT and (c) TrkA] and ligands [(d) AD and (e) L-DOPA]

Figure 3

Proteins interact with ligands were as seen in Autodock software. Interaction of AD with (a) AQP, (b) SERT and (c) Trk A. Interaction of L-DOPA with (d) AQP, (e) SERT and (f) Trk A

Table 4

Energy, Inhibition constant and Root mean square deviation values obtained on docking of AD and L-DOPA as ligand with AQP, SERT and TrkA protein

Protein–ligand complexBinding energy (kcal/mol)RMSD (A)Inhibition constant (Ki)Final intermolecular energy (kcal/mol)vdW + Hbond + desolv energy (kcal/mol)Electrostatic energy (kcal/mol)Total internal energy (kcal/mol)
AQP-AD−8.88147.416307.80 nM−12.46−12.470−4.92
AQP- LDOPA−5.13153.213173.91 uM−7.22−4.682.54−2.59
SERT-AD−9.93245.84252.52 nM−13.51−13.45−0.06−1.97
SERT-LDOPA3.93250.5431.32 mM−6.02−5.52−0.5−3.1
TrkA-AD7.58111.3212.79 uM−11.16−10.95−0.21−3.16
TrkA-LDOPA−6.0115.21439.97 uM−8.09−6.57−1.52−2.8

AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase, RMSD=Root mean square deviation

Table 5

Interaction of amino acid residues of AQP, SERT and TrkA protein with AD and L-DOPA

ProteinsLigandNumber of H-bondsInteracting residues
AQPAD5Thr 41 (2), Asp 137 (2) and Arg 210
L-DOPA6Asp 50, Asp137 (2), Thr 141 (2) and Ser 143 (2)
SERTAD3Asn 122 (2) and Arg 125
L-DOPA7Phe 133, Trp 79, Gln 131 (2), Ser 126 (2) and Leu 123
TrKAAD9Gln 339 (2), Gln 143 (2), Val 338, Ile 343, Asp 344, Ala 346 (2) and Arg 373 (2)
L-DOPA11Glu 207, Gln 339 (3), Arg 373 (2), Leu 142 (2) and Tyr 131

AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase

Three dimensional structure of proteins [(a) AQP, (b) SERT and (c) TrkA] and ligands [(d) AD and (e) L-DOPA] Proteins interact with ligands were as seen in Autodock software. Interaction of AD with (a) AQP, (b) SERT and (c) Trk A. Interaction of L-DOPA with (d) AQP, (e) SERT and (f) Trk A Energy, Inhibition constant and Root mean square deviation values obtained on docking of AD and L-DOPA as ligand with AQP, SERT and TrkA protein AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase, RMSD=Root mean square deviation Interaction of amino acid residues of AQP, SERT and TrkA protein with AD and L-DOPA AQP=Aquaporin, SERT=Serotonin transporter, TrKA=Tropomyosin receptor kinase

Effect of asiaticoside-D against ROT on the m-RNA levels in CGs

The m-RNA levels of SERT, TrkA, and AQP-4 were significantly reduced (P < 0.05) on ROT exposure (Group II) when compared to those of control group(I). ROT + AD supplementation of SERT, TrkA, and AQP-4 were significantly increased (P < 0.05) when compared to those of ROT-induced worms, suggesting the protective action of AD was given to normal worms (in Group IV), there were no significant variations from those of control (Group I) in the levels of m-RNA [Figure 4].
Figure 4

(a) Banding pattern of SERT, TrkA and AQP-4 in CGs of control and experiment group of worms. (b) m-RNA was quantified by image J software. Data were presented as mean ± SME of each 12 worms (n = 6) and significant at * P < 0.05. Comparisons were made as follows: ***Control Vs ROT, *ROT Vs ROT + AD; Ns Control Vs AD and Ns Control Vs Vehicle control

(a) Banding pattern of SERT, TrkA and AQP-4 in CGs of control and experiment group of worms. (b) m-RNA was quantified by image J software. Data were presented as mean ± SME of each 12 worms (n = 6) and significant at * P < 0.05. Comparisons were made as follows: ***Control Vs ROT, *ROT Vs ROT + AD; Ns Control Vs AD and Ns Control Vs Vehicle control

Discussion

Homology modeling is broadly used in structure-based drug design process. Owing to an increased in the number of crystal structures, the importance of modeling has also increased. The common applications of homology models are as follows: (a) study of the effect of mutations,[28] (b) identification of binding and active sites on protein,[29] (c) thorough for ligand of a known binding sites,[30] (d) designing of novel ligand for a specified binding site, (e) modeling of substrate specificity,[31] (f) prediction of antigenic epitopes,[32] (g) stimulation of protein–protein docking,[33] (h) molecular substitute in X-ray structure modification,[34] and so on. A homology model in drug finding requires an extremely high accuracy of the binding sites for its characteristic applications. In our study, we show that TrkA had moderately high homology (67%) to human while SERT and AQP had exhibited 58% and 42% of identity as given Table 2. Excellence of model is build more than 50% sequence similarities which are sufficient for drug discovery. Those between 25% and 50% identity can be useful in designing of mutagenesis experiment and those in-between 10% and 25% are tentative.[353637] The memory enhancing and cognitive effects of Centella asiatica are believed to be mediated by its components such as asiaticoside, asiaticoside-E, and asiatic acid.[3839] Studies have identified that asiaticoside can act as a high-affinity tropomyosin kinase receptor (TrkA) agonist and that can provoke receptor dimerization, autophosphorylation, and activation of downstream signaling.[40] Asiaticoside was reported to interact with residues such as tyrosine Tyr 490, Arg 125, Gln 144, Asp 248, and a limited Tyr785 and Tyr674/675 at the active site of TrkA.[4142] Similar to this report, our study has found an in silico interaction between AD and TrkA [Figure 3c] as also supported by a report highlighting an interaction between asiaticoside and TrkA receptor.[40] This interaction may upregulate the tyrosine phosphorylation on TrkA residues and activates its downstream signaling. The observed in silico interaction can be interpreted to promote the activation of cell growth and survival thereby acting against ROT-induced cell degeneration in CGs. We also showed that m-RNA levels of TrkA were significantly reduced (P < 0.001) on ROT while AD can maintain their levels in CGs as observed by RT-PCR [Figure 4]. Hence, it is presumed that they may regulate Ras/Raf/MAP kinase, PI3K/Akt, and PLC-γ signaling pathways in CGs. The observed interaction of asiaticoside with the residues of AQP, namely arginine 159, 160, serine 180, threonine 157, and glycine 165 could be supported by Migliati et al.[43] Maintenance of water homeostasis could be achieved by interaction of asiaticoside (AS) with AQP, the water regulating channel as shown by Hossain et al.[42] Further, arginine 210 in AQP loop was reported to regulate the water channel regulation by phosphorylation.[44] AQPs are abnormally expressed in ND condition, during which conservation of brain homeostasis is at possibility. They are said to influence potassium (K+) and calcium (Ca2+) ions transport which could play important roles in the pathogenesis of NDD patients.[4445] AQP-4 was significantly affected by ROT, and AD could influence AQP channels that clear the water in excess and maintain the water homeostasis in CGs [Figure 4]. As the reports have shown that AQP-4 was down regulation of NDD patients;[46] observations made in the current study suggests the structure the idea of protective action of AD perhaps via it affect on AQP-4. The current in-silico analysis also had shown that the AD can formed hydrogen bond with SERT residues Asn122 [Figure 3b], which is regulate the transport mechanism of neurotransmission. The interesting finding was that the interaction score of AD with SERT was comparatively more than that of L-DOPA with SERT. It was reported earlier that bacosides and asiaticoside, nonpolar glycosides, may be transported across blood–brain barrier and interact with SERT[47] and hence may prove useful against NDD. The observation of the reduced level of SERT in ROT- induced striatum degeneration of rats as supported by Hoglinger et al.,[48] and the comparative increase of SERT [Figure 4] on ROT+AD treatment highlights the effect of AD. Hypothetically by virtue of its binding, AD might regulate the termination of synaptic signaling and reuptake into the presynaptic neurons in CGs which however do require lot of investigation to prove. This may exert neuroprotective effect against ROT-induced degeneration. Thus, it is inferred from such upregulated SERT m-RNA levels [Figure 4] and binding interactions that AD might improve cognitive and movement abilities which are precipitated by ROT-induced degeneration in worms. Our observation suggests that AD from the C. asiatica can have better binding features with the SERT proteins that govern cognition/motor functions which are impaired in the various types of ND thereby exhibiting its potential against such complaints.

Conclusion

The homology modeling of proteins of earthworms, namely SERT, TrkA, and AQP which were derived utilizing the highest resolution X-ray crystal structure of SERT, TrkA, and AQP of human did exhibit significant binding interaction with the neuroprotective ligand and establish themselves as ideal candidates as drug targets in the anti-NDD strategies.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.
  1 in total

1.  Preparation and Safety Evaluation of Centella asiatica Total Glycosides Nitric Oxide Gel and Its Therapeutic Effect on Diabetic Cutaneous Ulcers.

Authors:  Yi-Qiu Liu; Dandan Zhang; Junyu Deng; Ye Liu; Wei Li; Xuqiang Nie
Journal:  Evid Based Complement Alternat Med       Date:  2022-03-25       Impact factor: 2.629

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.