Kimie Nakagawa1, Kiyomi Fujiwara2, Akihiro Nishimura3, Chinami Murakami4, Kanaha Kawamoto5, Chihiro Ichinose6, Yumi Kunitou7, Yoshitomo Suhara8, Toshio Okano9, Hiroshi Hasegawa10. 1. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. nakagawa@kobepharma-u.ac.jp. 2. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. 194k38change@gmail.com. 3. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. sweet.vanilla0627@gmail.com. 4. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. chi73.smile@icloud.com. 5. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. knha.3mal@gmail.com. 6. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. ap3-m22@docomo.ne.jp. 7. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. ow_kqqhqfqq_5qjn111@docomo.ne.jp. 8. Laboratory of Organic Synthesis and Medicinal Chemistry, College of Systems Engineering and Science, Faculty of Bioscience and Engineering, Shibaura Institute of Technology, Saitama 337-8570, Japan. suhara@shibaura-it.ac.jp. 9. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. t-okano@kobepharma-u.ac.jp. 10. Laboratory of Hygienic Sciences, Kobe Pharmaceutical University, Kobe 658-8558, Japan. h-hase@kobepharma-u.ac.jp.
Abstract
UbiA prenyltransferase domain-containing protein 1 (UBIAD1) is a vitamin K2 biosynthetic enzyme. We previously showed the lethality of this enzyme in UBIAD1 knockout mice during the embryonic stage. However, the biological effects of UBIAD1 deficiency after birth remain unclear. In the present study, we used a tamoxifen-inducible systemic UBIAD1 knockout mouse model to determine the role of UBIAD1 in adult mice. UBIAD1 knockout resulted in the death of the mice within about 60 days of administration of tamoxifen. The pancreas presented with the most prominent abnormality in the tamoxifen-induced UBIAD1 knockout mice. The pancreas was reduced remarkably in size; furthermore, the pancreatic acinar cells disappeared and were replaced by vacuoles. Further analysis revealed that the vacuoles were adipocytes. UBIAD1 deficiency in the pancreatic acinar cells caused an increase in oxidative stress and autophagy, leading to apoptotic cell death in the tamoxifen-induced UBIAD 1 knockout mice. These results indicate that UBIAD1 is essential for maintaining the survival of pancreatic acinar cells in the pancreas.
UbiA prenyltransferase domain-containing protein 1 (UBIAD1) is a vitamin K2 biosynthetic enzyme. We previously showed the lethality of this enzyme in UBIAD1 knockout mice during the embryonic stage. However, the biological effects of UBIAD1 deficiency after birth remain unclear. In the present study, we used a tamoxifen-inducible systemic UBIAD1 knockout mouse model to determine the role of UBIAD1 in adult mice. UBIAD1 knockout resulted in the death of the mice within about 60 days of administration of tamoxifen. The pancreas presented with the most prominent abnormality in the tamoxifen-induced UBIAD1 knockout mice. The pancreas was reduced remarkably in size; furthermore, the pancreatic acinar cells disappeared and were replaced by vacuoles. Further analysis revealed that the vacuoles were adipocytes. UBIAD1 deficiency in the pancreatic acinar cells caused an increase in oxidative stress and autophagy, leading to apoptotic cell death in the tamoxifen-induced UBIAD 1 knockout mice. These results indicate that UBIAD1 is essential for maintaining the survival of pancreatic acinar cells in the pancreas.
Vitamin K is a cofactor for γ-glutamyl carboxylase (GGCX), an enzyme that converts specific glutamic acid residues in several substrate proteins involved in blood coagulation and bone metabolism to γ-carboxyglutamic acid residues [1,2]. In addition to its role as a cofactor for GGCX, vitamin K is involved in the transcriptional regulation of the nuclear receptor the steroid and xenobiotic sensing nuclear receptor (SXR) (also known as pregnane X receptor or PXR) [3,4,5] and regulates protein kinase A (PKA) signaling in osteoblasts and hepatocellular carcinoma cells [6]. Furthermore, menaquinone-4 (MK-4) is reported to have a role in the mitochondrial electron transport chain in Drosophila [7].There are two naturally occurring forms of vitamin K, phylloquinone (PK or vitamin K1) and the group of menaquinones (MKs). All forms of vitamin K are characterized by a common 2-methyl-1,4-naphthoquinone ring structure (menadione, MD) and a hydrophobic polyisoprenoid side chain attached at the 3-carbon position of the nucleus. PK has a monounsaturated side chain of four isoprenyl residues and is primarily found in leafy green vegetables. MKs can be classified into 14 types on the basis of the length of their unsaturated side chains. Among them, MK-4 is an atypical menaquinone that is not commonly synthesized by bacteria but can be synthesized in vivo by invertebrates and vertebrates in the presence of a suitable naphthoquinone precursor, such as MD or PK [8,9].We recently demonstrated that dietary PK releases MD into the mesenteric lymphatic system and blood circulation via cleavage of the side chain in the intestine, following which it is delivered to the tissues where it is converted into MK-4 and stored [8]. The UbiA prenyltransferase domain-containing protein 1 (UBIAD1) is a novel MK-4 biosynthetic enzyme screened and identified from the human genome database [10,11]. Enzymatic analysis using site-directed mutagenesis revealed that UBIAD1 is capable of generating various MKs, including MK-4; additionally, UBIAD1 missense mutations were found to significantly lower MK-4 biosynthetic activity in Schnyder corneal dystrophy [12,13]. To clarify the function of UBIAD1 in vivo, we attempted to generate mice completely lacking Ubiad1, a homolog of humanUBIAD1, by gene targeting. Conventional Ubiad1-deficient (Ubiad1−/−) mouse embryos failed to survive beyond embryonic day 7.5, exhibiting a small-sized body and gastrulation arrest, while the Ubiad1+/− mice exhibited normal growth and fertility [14]. The tissue concentrations and synthetic activity of MK-4 in Ubiad1+/− mice were approximately half of those in the wild-type mice. The Ubiad1mouse embryos could not be rescued, but their embryonic lifespans were extended to term by oral administration of MK-4 or CoQ10 in pregnant Ubiad1+/− mice [14]. These results suggest that UBIAD1 plays a critical role in embryonic development by synthesizing MK-4.UBIAD1 is an essential factor for mouse development, but it is not possible to conduct a functional analysis of this protein in each tissue from the fetal stage in UBIAD1-deficientmice. The goal of this study was to determine the role of UBIAD1 in the physiological function in adult mice. In order to determine the role of UBIAD1 in several tissues in adult mice, we created tamoxifen-inducible generalized UBIAD1 knockout mice and identified the novel functions of UBIAD1 in these mice after maturation.
2. Results
2.1. Tamoxifen-Induced Ubiad1-Deficient Mice Are Lethal
CAG-Cre-ERT+/−UBIAD1fl/fl (UBIAD1-cKO) mice injected with tamoxifen died within 60–70 days of tamoxifen administration. Tamoxifen-treated UBIAD1-cKO male mice died about 60 days after tamoxifen administration, while the female mice died after 70 days (Figure 1).
Figure 1
Kaplan–Meier survival curves of male (a) and female (b) Flox and UbiA prenyltransferase domain-containing protein 1 knockout (UBIAD1-cKO) mice after administration of tamoxifen.
2.2. The Pancreas of Tamoxifen-Induced UBIAD1-Deficient Mice Was Markedly Atrophied
Female UBIAD1-cKOmice were analyzed because they seemed to survive for longer periods than male mice. Body and tissue weights of UBIAD1-cKO female mice were measured at 40 days after administration of tamoxifen and compared with those of the tamoxifen-treated CAG-Cre-ERT−/−UBIAD1fl/fl (Flox) mice carrying conditional UBIAD1 alleles, but lacking Cre expression (Table 1). No significant differences in body weights were noted between the Flox and UBIAD1-cKOmice (both tamoxifen-treated and non-treated). However, the weight of the pancreas in the tamoxifen-treated UBIAD1-cKOmice was markedly reduced when compared with the Floxmice and the tamoxifen non-treated UBIAD1-cKOmice (Table 1). On the other hand, the weights of other tissues were not significantly different among the four types of mice (Table 1). MK-4 and deuterium-labeled MK-4 (MK-4-d7) concentrations converted from deuterium-labeled MD (MD-d8) in the tamoxifen-treated UBIAD1-cKOmice were significantly lower than in the tamoxifen-treated Floxmice (Table 2). Surprisingly, the pancreas of the tamoxifen-treated UBIAD1-cKOmice was markedly atrophied when compared with the tamoxifen-treated Floxmice, as shown in Figure 2A. Furthermore, UBIAD1 messenger RNA (mRNA) expression levels were markedly reduced in the tamoxifen-treated UBIAD1-cKOmice when compared with the tamoxifen-treated Floxmice and the tamoxifen non-treated UBIAD1-cKOmice (Figure 2B). UBIAD1 mRNA levels in other tissues were also markedly reduced in the tamoxifen-treated UBIAD1-cKOmice (Figure S2, Supplementary Materials).
Table 1
Body and tissue weights in the tamoxifen-treated and untreated Flox and UbiA prenyltransferase domain-containing protein 1 knockout (UBIAD1-cKO) mice. Tam—tamoxifen.
Flox Mice
Flox Mice + Tam
UBIAD1-cKO
UBIAD1-Cko + Tam
Body weight (g)
23.25 ± 0.39
23.45 ± 0.65
22.54 ± 0.39
22.03 ± 0.46
Cerebrum (g)
0.305 ± 0.023
0.287 ± 0.003
0.311 ± 0.004
0.294 ± 0.003
Cerebellum (g)
0.056 ± 0.005
0.059 ± 0.001
0.057 ± 0.004
0.055 ± 0.002
Liver (g)
0.887 ± 0.041
0.883 ± 0.014
0.872 ± 0.045
0.867 ± 0.020
Kidney (g)
0.257 ± 0.010
0.245 ± 0.006
0.254 ± 0.007
0.246 ± 0.010
Pancreas (g)
0.196 ± 0.011
0.192 ± 0.007
0.192 ± 0.005
0.054 ± 0.011 ***
*** p < 0.001 compared to corresponding value in Flox mice, Flox mice + Tam, and UBIAD1-cKO mice.
Table 2
Menaquinone-4 (MK-4) and deuterium-labeled MK-4 (MK-4-d7) concentrations in the Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen.
MK-4 concentration (pmol/g)
MK-4-d7 concentration (pmol/g)
Flox + Tam
UBIAD1-cKO + Tam
Flox + Tam
UBIAD1-cKO + Tam
Cerebrum
429.67 ± 16.55
135.92 ± 14.67***
20.48 ± 1.15
2.38 ± 0.49***
Cerebellum
801.12 ± 76.35
223.46 ± 26.38**
31.82 ± 5.95
2.67 ± 1.29***
Kidney
232.00 ± 12.03
24.45 ± 2.34***
108.18 ± 14.11
7.18 ± 2.46**
Pancreas
1140.91 ± 108.15
96.24 ± 24.15**
61.69 ± 5.21
N.D.1
1N.D.: not detected; ** p < 0.05 and *** p < 0.001 compared to corresponding value in Flox + Tam mice.
Figure 2
Morphological changes and UBIAD1 messenger RNA (mRNA) expression in the pancreas of tamoxifen-treated UBIAD1-cKO female mice. (A) Morphological changes in the pancreas of tamoxifen-treated Flox and UBIAD1-cKO female mice; (B) UBIAD1 mRNA expression in the pancreas of tamoxifen-treated or non-treated Flox and UBIAD1-cKO female mice. Data are shown as means ± standard errors of the mean (SEM); ** p < 0.01 compared with the corresponding value in other group of mice.
2.3. Disappearance of Pancreatic Acinar Cells and Formation of Vacuoles in the Pancreas of Tamoxifen-Induced UBIAD1-Deficient Mice
The pancreas of the tamoxifen-treated UBIAD1-cKOmice was remarkably smaller. Tissue sections were prepared, and hematoxylin–eosin (H&E) staining was performed. Pancreatic acinar cells were absent in the tamoxifen-treated UBIAD1-cKOmice; instead, several vacuoles were noted (Figure 3). On the other hand, the presence of internal α, β, and δ cells was confirmed by Gomori aldehyde fuchsin staining (Figure 4). No atrophy of the pancreatic islets of tamoxifen-treated UBIAD1-cKOmice was noted. The pancreas of tamoxifen-treated Floxmice was stained with insulin antibody only in the pancreatic islets, whereas, in tamoxifen-treated UBIAD1-cKOmice, pancreatic islets and portions other than the pancreatic islets were also widely stained (Figure 4). These results indicate that insulin secreted from pancreatic islets is dispersed within the pancreas in tamoxifen-treated UBIAD1-cKOmice.
Figure 3
Hematoxylin–eosin (H&E)-stained pancreas sections from female Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen.
Figure 4
Gomori aldehyde fuchsin and insulin immune-stained pancreas sections from female Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen. In the Gomori aldehyde fuchsin-stained sections, elastic fibers and pancreatic islet β class cells were stained purple, pancreatic islet δ cells were stained light green, pancreatic islet α cells were stained red, and connective tissue was stained green. Immunohistological staining with insulin specific antibody in the pancreas of the tamoxifen-treated Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen.
2.4. The Vacuoles Found in the Pancreas of Tamoxifen-Treated UBIAD1-cKO Mice Were Adipocytes
Immunohistochemical staining using adipocyte-specific antibodies (Fatty acid binding protein 4 (FABP4), Peroxisome proliferator-activated receptor (PPAR), and perilipin) was performed to investigate the vacuoles found in the pancreas of the tamoxifen-treated UBIAD1-cKOmice (Figure 5). These results indicate that, in the pancreas of tamoxifen-treated UBIAD1-cKOmice, pancreatic acinar cells disappeared and adipocytes were formed at the disappeared site.
Figure 5
Expression of adipocyte-specific markers in the vacuoles in tamoxifen-treated UBIAD1-cKO mice. Immunohistological staining with FABP4, PPAR, and perilipin in the pancreas of the tamoxifen-treated Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen. The tissues of immunohistological staining with PPAR staining were counterstained with hematoxylin.
2.5. Pancreatic Acinar Cells in the Pancreas of Tamoxifen-Treated UBIAD1-cKO Mice Increased Oxidative Stress and Autophagy and Disappeared by Apoptosis
In order to determine the cause of the formation of vacuoles and the disappearance of pancreatic acinar cells in the cKOmice, we investigated the involvement of oxidative stress, autophagy, and apoptosis. Strong 4-Hydroxy nonenal (4-HNE)-positive staining observed at the site where the acinar cells disappeared indicated that the pancreatic acinar cells in tamoxifen-treated UBIAD1-cKOmice were exposed to strong oxidative stress. In addition, positive staining for Microtubule-associated protein light chain 3 (LC3), a central protein in the autophagy pathway, was detected in atrophied pancreatic acinar cells in the tamoxifen-treated UBIAD1-cKOmice. Furthermore, cleaved caspase-3 positive cells were observed in the atrophic and non-atrophic pancreatic acinar cells (Figure 6). These findings indicated that pancreatic acinar cells in the tamoxifen-treated UBIAD1-cKOmice disappeared via apoptosis due to oxidative stress and enhancement of autophagy.
Figure 6
Expression of oxidative stress, autophagy, and apoptosis-specific markers 4-HNE, LC3, and cleaved caspase-3, respectively, in the pancreas of tamoxifen-treated Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen.
2.6. Abundance of Neutrophils and Mesenchymal Stem Cells in the Pancreas of Tamoxifen-Treated UBIAD1-cKO Mice
The pathology of the pancreas in tamoxifen-treated UBIAD1-cKOmice is similar to that of chronic pancreatitis. Several cells positively stained for myeloperoxidase (MPO), a neutrophil marker, were detected in the pancreas of tamoxifen-treated UBIAD1-cKOmice (Figure 7). Furthermore, in order to investigate whether undifferentiated mesenchymal stem cells were differentiated into adipocytes in the pancreatic tissue, the cells were stained with an antibody against CD105 (as known as Endoglin), a mesenchymal stem cell marker. As a result, several CD105-positive cells were detected in the pancreas of the tamoxifen-treated UBIAD1-cKOmice (Figure 7). These results suggest that the mesenchymal stem cells may have invaded during inflammation and differentiated into adipocytes in the pancreas of these mice.
Figure 7
The pancreas of the tamoxifen-treated UBIAD1-cKO mice was positive for the inflammation (myeloperoxidase; MPO) and mesenchymal stromal cell (CD105) markers. Immunohistological staining of MPO and CD105 in the pancreas of tamoxifen-treated Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen. The tissues of immunohistological staining with MPO staining were counterstained with hematoxylin.
2.7. Serum Glucose and Insulin Concentrations and Glucose Tolerance in Tamoxifen-Induced UBIAD1-Deficient Mice
We measured the serum glucose and insulin concentrations in the Flox and UBIAD1-cKOmice every week following tamoxifen administration. Serum glucose concentration was significantly lowered in tamoxifen-treated UBIAD1-cKOmice when compared with the tamoxifen-treated Floxmice; likewise, the concentration of serum insulin in these mice tended to be lower than that in the Floxmice (Figure 8A,B). Therefore, we conducted a glucose tolerance test in the two types of mice 40 days after tamoxifen administration. The blood glucose level in the tamoxifen-treated UBIAD1-cKOmice at 0 min before glucose loading was significantly lower than that of the tamoxifen-treated Floxmice. A slight increase in the level was noted in the tamoxifen-treated UBIAD1-cKOmice after glucose loading; however, they remained significantly lower in these mice when compared with the tamoxifen-treated Floxmice (Figure 8C) indicating that tamoxifen-induced UBIAD1 deficientmice may have decreased glucose absorption capacity and pancreatic function.
Figure 8
Serum glucose (A) and insulin (B) concentrations in Flox and UBIAD1-cKO mice after tamoxifen administration. Oral glucose tolerance test (C) in tamoxifen-treated Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen. Serum glucose was assayed at 0, 15, 30, 60, and 120 min. Each point on the curve represents the mean ± SEM. Data are shown as means ± SEM; * p < 0.05 and ** p < 0.01 when compared with the corresponding values at each point in the tamoxifen-treated Flox mice.
2.8. Abnormal Tissue Structure and Decreased Sodium-Dependent Glucose Transporter 1 (SGLT1) and Glucose Transporter 2 (GLUT2) Expressions in the Duodenum of Tamoxifen-Treated UBIAD1-cKO Mice
UBIAD1 is deficient not only in the pancreas but also in the duodenum of the tamoxifen-treated UBIAD1-cKOmice, thereby affecting the glucose absorption capacity of the duodenum. The basolateral membrane in the duodenum of the tamoxifen-treated UBIAD1-cKOmice appeared disorganized, while the surface of intestinal villus was rough when compared with those in the tamoxifen-treated Floxmice (Figure 9). Glucose is absorbed through the intestine by a transepithelial transport system that is initiated at the apical membrane by the co-transporter SGLT1; intracellular glucose is then assumed to diffuse across the basolateral membrane through GLUT2. Marked SGLT1 and GLUT2 expressions were observed on the luminal side of the villi in the duodenum of the tamoxifen-treated Floxmice, but not in the tamoxifen-treated UBIAD1-cKOmice (Figure 9). Expression of SGLT1 and GLUT2 was very weak in duodenal epithelial cells of the tamoxifen-treated UBIAD1-cKOmice.
Figure 9
H&E-stained and immunohistologically stained duodenum sections from female Flox and UBIAD1-cKO mice at 40 days after administration of tamoxifen. Immunohistological staining demonstrated sodium-dependent glucose transporter 1 (SGLT1) and glucose transporter 2 (GLUT2) expressions in the duodenum of the mice at 40 days after tamoxifen administration
3. Discussion
UBIAD1 is an essential enzyme required for MK-4 biosynthesis in mice and humans. The conventional UBIAD1 knockout mice do not survive during the early gestation period, thus indicating that UBIAD1 plays an essential role in the developmental process [14]. UBIAD1 exists in all tissues, and is expected to maintain the function of each tissue by biosynthesizing MK-4; nonetheless, the significance of this biosynthesis in each organization remains unclear. Therefore, in order to clarify the importance and role of UBIAD1 in each tissue in mice after birth, we generated a tamoxifen-induced systemic UBIAD1-deficientmice model and evaluated the effects of UBIAD1 deficiency in these mice after maturation.In the present study, the UBIAD1-deficientmice did not survive after maturation. Female and male UBIAD1-cKOmice demonstrated similar rates of death after administration of tamoxifen, but male UBIAD1-cKOmice died earlier than the female mice. Previously, we reported that the concentration of MK-4 in tissues of male wild-type mice was lower than that of the female wild-type mice [9]. Hence, it was considered that male UBIAD1-cKOmice in which UBIAD1 deficiency was induced by tamoxifen administration became MK-4-deficient earlier than female UBIAD1-cKOmice, leading to lethality. The body and tissue weights of female UBIAD1-cKOmice were measured 40 days after induction of UBIAD1 deficiency by tamoxifen. No significant differences in body weight were noted between the UBIAD1-cKO and Floxmice treated with tamoxifen, whereas the weight of the pancreas in the UBIAD1-cKOmice was significantly lower than that in the Floxmice. The pancreas of tamoxifen-treated UBIAD1-cKOmice was markedly atrophied and reduced in size; additionally, MK-4 concentration and UBIAD1 expression were decreased in the whole tissues of these mice. It is known that the concentration of MK-4 is highest in the pancreas when compared with any other tissue [9]. In a previous study, Thomas et al. indicated that MK-4 is detected in pancreatic secretions and is present within the secretory pathway of acinar cells, thereby suggesting that MK-4 has a unique function in acinar cells [15]. Consistent with the low concentrations of phylloquinone reported in exocrine tissues [16,17], no vitamin K compounds other than MK-4 were detected in pancreatic secretions. Thomas et al. reported that the detection of MK-4 in pancreatic secretions indicates its presence in the secretory pathway of the acinar cells [15]. Although the reason for the abundance of MK-4 in the pancreas is not clear, the findings of the current study suggest that it may play an important role in this organ.H&E staining revealed an absence of pancreatic acinar cells and an increase in the number of vacuoles in the tissues of the tamoxifen-treated UBIAD1-cKOmice. The number of pancreatic islets was similar in the tamoxifen-treated UBIAD1-cKOmice and Floxmice, indicating that the abnormality was limited to the pancreatic acinar cells. The pancreas of the tamoxifen-treated UBIAD1-cKOmice was remarkably reduced in size. However, no atrophy of the pancreatic islets of tamoxifen-treated UBIAD1-cKOmice was noted. We considered that the cause of the atrophy of the pancreas of UBIAD1-cKOmice was the loss of pancreatic acinar cells that occupy 90% of the pancreas. Although various digestive enzymes are present in pancreatic acinar cells, it is speculated that UBIAD1 deficiency did not cause significant cell damage in pancreas islets because pancreatic islets do not produce the digestive enzymes. As a result of observing the expression of insulin by immunohistological staining, the insulin in pancreatic islets was stained equally in both tamoxifen-treated Floxmice and UBIAD1-cKOmice. From this, it is speculated that the level of insulin secretion in pancreatic islets is not reduced in cKOmice. However, no insulin was observed in the pancreatic acinar cells of the Floxmice, whereas, in the UBIAD1-cKOmice, extensive insulin diffusion to the site of the pancreatic acinar cells was noted. The pancreatic acinar cells in the tamoxifen-treated UBIAD1-cKOmice almost disappeared, and most of the cells were replaced by vacuoles. Interestingly, the vacuoles stained positively for the adipocyte marker proteins FABP4, PPAR [18,19], and perilipin [20,21], indicating that the pancreatic acinar cells were replaced by fat cells. Although the functions of UBIAD1 and MK-4 in the pancreas are not clear, periostin, a member of a vitamin K-dependent γ-carboxylated protein family, is reported to be involved in pancreatitis [22]. In normal mice, periostin expression is strongly induced throughout the fibrotic reaction in cerulein-mediated acute pancreatitis [23]. However, in periostin-deficient mice, the most striking phenotype of periostin-knockout mice is the replacement of acinar cells by adipocytes after induction of acute pancreatitis [23]. The involvement of periostin was not further examined in the current study. However, MK-4 deficiency is caused by UBIAD1 deficiency in tamoxifen-induced UBIAD1-cKOmice, and since periostin is not γ-carboxylated by GGCX, it is speculated that the acinar cells may have disappeared and been replaced with adipocytes.In humans and mice, it is reported that vacuoles are formed at the site of pancreatic acinar cells during acute pancreatitis [24]. Pancreatic acinar cells are the functional units of the exocrine pancreas. They are known to synthesize, store, and secrete digestive enzymes. Under normal physiological conditions, digestive enzymes are activated only after they reach the duodenum [25]. Premature activation of these enzymes within pancreatic acinar cells leads to the onset of acute pancreatitis [25], wherein the acinar cells are digested by the enzymes. The causes of acute pancreatitis include oxidative stress and increased autophagy. Oxidative stress and its constant companion, inflammation, play critical roles in the pathogenesis of pancreatitis and its numerous complications [26,27,28,29]. Oxidative stress is caused by a combination of the increased production of reactive oxygen species and impaired antioxidant capacity. Previously, it was reported that autophagy is induced by the supramaximal stimulation of cerulein, and is directly related to trypsinogen activation and the onset of acute pancreatitis in mice [30]. Therefore, we investigated the involvement of oxidative stress, autophagy, and apoptosis in pancreatic acinar cell loss in these mice. The atrophied pancreatic acinar cells in the tamoxifen-treated UBIAD1-cKOmice were positive for the oxidative stress marker 4-HNE [31], and a large amount of LC3 deposition (indicating autophagy) was detected. Furthermore, the pancreatic acinar cells in the tamoxifen-treated UBIAD1-cKOmice were positive for the cleaved caspase-3 apoptotic marker. These results suggested that the pancreatic acinar cells disappeared via apoptosis due to enhanced oxidative stress and autophagy. Previous reports suggested that MK-4 prevents oxidative cell death in developing oligodendrocytes and neurons [32,33], and that UBIAD1 prevents oxidative damage in cardiovascular tissues [34], and sustains mitochondrial function in Drosophila [7]. Since both MK-4 and UBIAD1 are thought to be involved in anti-oxidation, the deficiency of both UBIAD1 and MK-4 may result in oxidative stress, autophagy enhancement, and apoptosis in pancreatic acinar cells. Mesenchymal stem cells were shown to differentiate into adipocytes [35]. However, according to the present study, most of the pancreatic acinar cells disappeared probably via apoptosis due to oxidative stress and autophagy; moreover, CD105-positive mesenchymal stem cells were frequently found at the site of these cells. Taken together, these results indicate that, after the disappearance of the pancreatic acinar cells in the tamoxifen-treated UBIAD1-cKOmice, mesenchymal stem cells may have invaded the tissues and differentiated into adipocytes due to stimulation via insulin in the pancreas. Thus, UBIAD1 and MK-4 may play essential roles in the survival and function of pancreatic acinar cells.Serum glucose concentration was significantly lower in the UBIAD1-cKOmice than in the Floxmice after tamoxifen administration, and both before and after the oral glucose tolerance test (OGTT). This may be due to a decrease in pancreatic function. However, analysis of the duodenal tissue revealed a disordered basolateral membrane in the tamoxifen-treated UBIAD1-cKOmice, and the surface of intestinal villus was rough. Moreover, SGLT1 and GLUT2 expression levels were decreased in the duodenum of the tamoxifen-treated UBIAD1-cKOmice. In the duodenum of tamoxifen-treated UBIAD1-cKOmice, UBIAD1 deficiency is thought to cause abnormalities in intestinal epithelial cell differentiation and maturation. As a result, expression of SGLT1 and GLUT2 in intestinal epithelial cells may be reduced. Intestinal glucose absorption is mediated by SGLT1, but GLUT2 is thought to provide a basolateral outlet. GLUT2 can be recruited to the apical membrane after application of a high-glucose bolus into the lumen to allow for the bulk absorption of glucose via facilitated diffusion. Furthermore, SGLT1 and GLUT2 are suggested to play important roles in intestinal glucose sensing [36,37,38,39]. The decrease in the expression levels of SGLT1 and GLUT2 is the main factor responsible for the reduction in glucose absorption from the intestine in UBIAD1-deficientmice. Thus, UBIAD1 is thought to be necessary for cell proliferation and differentiation, and for maintenance of the function of the intestinal epithelial cells. Previous reports demonstrated a relationship between vitamin K intake and insulin sensitivity or glucose tolerance [40]. However, the action of MK-4 on intestinal glucose absorption remains to be shown. The results of the current study suggest that UBIAD1 and MK-4 play important roles in maintaining the morphology and function of intestinal epithelial cells and the expression levels of SGLT1 and GLUT2, which are important for glucose absorption. Further detailed analyses are required to examine this phenomenon in the future.In summary, our data demonstrate that the loss of UBIAD1 in adult mice results in decreased survival, particularly due to severe abnormalities in the pancreas. The pathology of the UBIAD1-deficient pancreas is similar to that of acute pancreatitis, resulting in the disappearance of pancreatic acinar cells, which are replaced by adipocytes. The pancreatic acinar cells in UBIAD1-deficientmice demonstrated increased oxidative stress, autophagy, and apoptosis. Furthermore, mesenchymal stem cells in the pancreas may have been exposed to pancreatic insulin and differentiated into adipocytes. These findings indicate that both UBIAD1 and MK-4 play essential roles in maintaining the survival of pancreatic acinar cells.
4. Materials and Methods
4.1. Materials
MD-d8 was purchased from C/D/N Isotopes, Inc. PK epoxide, MK-4 epoxide, 18O-labeled PK and MK-4 (PK-18O and MK-4-18O), deuterium-labeled PK and PK epoxide (PK-d7 and PK-d7 epoxide), and MK-4-d7 and MK-4 epoxide (MK-4-d7 epoxide) were synthesized in our laboratory as reported previously [8,21].
4.2. Ethics Statement
All animal experimental protocols were performed in accordance with the Guidelines for Animal Experiments at Kobe Pharmaceutical University and were approved by Kobe Pharmaceutical University Committee for Animal Care and Use, Kobe, Japan (2016-001; 1 April 2016, 2017-006; 1 April 2017, 2018-055; 1 April 2018). All surgical procedures were performed under isoflurane anesthesia, and all efforts were made to minimize suffering.
4.3. Mice
The UBIAD1-floxed mice were generated, as previously described [14]. These offspring were then backcrossed to C57BL6/J for seven generations. UBIAD1flox/+ mice were intercrossed to generate UBIAD1flox/floxmice containing homozygous recombinant alleles. CAG-Cre-ERT2mice were obtained from Jackson Laboratories (#004453). CAG-Cre-ERT+/−UBIAD1fl/+ mice were generated by mating Ubiad1flox/floxmice with CAG-Cre-ERT2mice. CAG-Cre-ERT+/−UBIAD1fl/fl (UBIAD1-cKO) mice were generated by mating Ubiad1flox/flox (Flox) mice with CAG-Cre-ERT+/−UBIAD1fl/+ mice.
4.4. Genotyping
Genotypes of the flox allele were confirmed by PCR with a sense primer (Ubiad1-GN forward primer (FP-2), 5′–ATCTCACGAAGCTTGAGTTGGC–3′) and an antisense primer (Ubiad1-GN reverse primer (RP-2), 5′–CCACAGTAAGAGATCTTAAAGGCTA–3′). Genotypes of Cre recombinase allele and inter positive allele (IL2 gene) were confirmed by PCR using the following primers: No.4 Cre-F (5′–AATGCTTCTGTCCGTTTGCC–3′), No.4 Cre-R (5′–CTACACCAGAGACGGAAATC–3′), InterPosi (IL2-42)-F (5′–CTAGGCCACAGAATTGAAAGATCT–3′), and InterPosi (IL2-43)-R (5′–GTAGGTGGAAATTCTAGCATCATCC–3′). PCR was performed using 35 cycles with denaturation at 95 °C for 15 s, annealing at 62 °C for 30 s, and extension at 72 °C for 1 min. The predicted PCR products were Flox allele (1.6 kbp), wild-type allele (1.4 kbp), Cre (562 bp), and InterPosi (324 bp) (Figure S1, Supplementary Materials).
4.5. Real-Time PCR
Total RNA was isolated from mouse tissue using Isogen (Nippon Gene, Tokyo, Japan) according to the manufacturer’s protocol. First-strand complementary DNA (cDNA) synthesis was performed using ReverTra Ace qPCR RT Master Mix with genomic DNA (gDNA) Remover (TOYOBO, Tokyo, Japan). The cDNA was mixed with SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA), and amplified using the CFX96 real-time PCR system (Bio-Rad). MouseUbiad1 (GenBank NM_027873, FP: 1575–1595, RP: 1754–1774) and mouse 18s-ribosomal RNA (GenBank AK135936, FP: 438–455, RP: 486–505) were used in this study.
4.6. Measurements of MK-4 and MK-4-d7 in Tissues of Mice Administered MD-d8
The mice were administered MD-d8 orally as a single dose (10 μmol/kg body weight). After 24 h, the animals were sacrificed, and tissues were removed and stored at −80 °C for analysis. MK-4, MK-4 epoxide, MK-4-d7, and MK-4-d7 epoxide levels were measured by LC-APCI-MS/MS as reported previously [8,21].
4.7. Histology and Immunohistochemistry
For histological analysis, tissues were fixed in 4% paraformaldehyde and phosphate-buffered saline (PBS) at 4 °C for 20 h and embedded in a paraffin block. The sections were stained with H&E and Gomori’s aldehyde fuchsin staining (Muto Pure Chemicals Co. Ltd., Tokyo, Japan) according to the manufacturer’s recommendations. The following polyclonal antibodies were used: anti-FABP4 (ab92501, Abcam, Cambridge, UK), anti-PPAR gamma (ab209350, Abcam), anti-perilipin A (ab3526, Abcam), anti-4-hydroxynonenal (ab46545, Abcam), anti-LC3 (PM036, Medical & Biological Lab., Nagoya, Japan), anti-MPO (ab9535, Abcam), anti-CD105 (ab135528, Abcam), anti-SGLT1 (ab14685, Abcam), and anti-GLUT2 (NBP2-22218, Novus Biologicals, Inc., Centennial, CO, USA). Formalin-fixed, paraffin-embedded mice tissues were deparaffinized and incubated in 3% hydrogen peroxide/PBS for 30 min to quench endogenous peroxidases. The sections were rinsed in PBS and immunostained with each specific antibody diluted in 0.5% PBS/ovalbumin (1:100 or 1:200) at 4 °C overnight after antigen retrieval with HistoVT One buffer (Nacalai Tesque, Tokyo, Japan) at 95 °C for 20 min. The sections were then incubated with the secondary antibody goat anti-rabbit IgG-horseradish peroxidase (HRP) sc-2030 (Santa Cruz Biotechnology, Dallas, TX 75220, USA) diluted in 0.5% PBS/ovalbumin (1:200), for 30 min at room temperature. After incubation with Elite ABC Kit (Vector Laboratories, Burlingame, CA, USA) for 30 min and rinsing with PBS, the tissues were stained with 3,3′-diaminobenzidine (DAB) (Vector Laboratories) for 2 min.
4.8. Blood Glucose and Insulin
Glucose Pilot Blood Glucose Monitoring System (Aventiir Biotech, LLC, Carlsbad, CA, USA) was used for measuring blood glucose concentrations in the UBIAD1-cKO and Floxmice before and after tamoxifen administration, according to the manufacturer’s recommendations. Blood was obtained from a tail cut (by removing the distal 2 mm of the tail) and assessed for baseline glucose levels. The remaining blood was processed to plasma and later used to determine the fasting insulin levels. All of the plasma samples were frozen after collection and assayed using the Mouse/Rat Insulin ELISA Kit (Morinaga Institute of Biological Science, Tokyo, Japan) according to the manufacturer’s recommendations.
4.9. OGTT
OGTT was performed after 4 h of fasting by oral administration of glucose (2 g/kg body weight). Blood was obtained from a tail cut and assessed for baseline glucose levels using the Glucose Pilot Blood Glucose Monitoring System. The remaining blood was processed to plasma and later used to determine the fasting insulin levels. Subsequently, the mice received 2 g/kg body weight of a 100 mg/mL glucose solution in sterile water delivered by oral gavage. At 15, 30, 60, and 120 min after the administration of glucose, dried blood and tissue were quickly removed from the tail wound, and blood was collected again to measure the glucose concentration and to prepare the plasma samples for measuring insulin levels. All plasma samples were frozen after collection for further analysis.
4.10. Statistical Analysis
Data are expressed as means ± standard error of mean. Differences between the mean values were analyzed using the unpaired Student’s t-test or Dunnett’s test. A p-value <0.05 was considered significant.
Authors: Jianyang Liu; Yan Huang; Jialin He; Yi Zhuo; Wei Chen; Lite Ge; Da Duan; Ming Lu; Zhiping Hu Journal: Front Cell Neurosci Date: 2020-11-12 Impact factor: 5.505
Authors: Youngah Jo; Steven S Kim; Kristina Garland; Iris Fuentes; Lisa M DiCarlo; Jessie L Ellis; Xueyan Fu; Sarah L Booth; Bret M Evers; Russell A DeBose-Boyd Journal: Elife Date: 2020-03-02 Impact factor: 8.140