Literature DB >> 31007778

KIF23 Promotes Gastric Cancer by Stimulating Cell Proliferation.

Xiao-Long Li1, Ya-Ming Ji2, Rui Song1, Xiao-Ning Li1, Lan-Shuan Guo1.   

Abstract

Gastric cancer (GC) is one of the most aggressive malignant tumors with low early diagnosis and high metastasis. Despite progress in treatment, to combat this disease, a better understanding of the underlying mechanisms and novel therapeutic targets is needed. KIF23, which belongs to the KIF family, plays a vital role in various cell processes, such as cytoplasm separation and axon elongation. Nowadays, KIF23 has been found to be highly expressed in multiple tumor tissues and cells, suggesting a potential link between KIF23 and tumorigenesis. Herein, we reported that KIF23 expression was correlated with poor prognosis of gastric cancer and found an association between KIF23 and pTNM stage. An in vitro assay proved that the proliferation of gastric cancer cells was significantly inhibited, which is caused by KIF23 depletion. Additionally, knockdown of KIF23 resulted in a marked inhibition of cell proliferation of gastric cancer in mice, with significant downregulation of Ki67 and PCNA expression. In conclusion, these data indicate that KIF23 is a potential therapeutic target for gastric cancer treatment.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31007778      PMCID: PMC6441499          DOI: 10.1155/2019/9751923

Source DB:  PubMed          Journal:  Dis Markers        ISSN: 0278-0240            Impact factor:   3.434


1. Introduction

Gastric cancer (GC) is an aggressive malignancy in the digestive system affecting humankind, with almost a million cases worldwide [1, 2]. GC becomes the second most commonly diagnosed cancer and sits in the second position in terms of mortality in China [3, 4]. Although surgical treatment can cure nearly 90% of patients with early gastric cancer and additionally the progress of radiotherapy, chemotherapy, and surgical therapy is significant [5-7], because of poor early diagnosis and high metastasis of GC, the therapeutic efficacy is low, with the 5-year overall survival rates actually less than a quarter [8]. Thus, novel therapeutic targets are needed to improve patient outcome. The kinesin family (KIFs) is a series of molecular motor proteins based on microtubules, which mediates various cell processes [9, 10]. The abnormal expression of KIFs could cause tumorigenesis and development of tumors [9, 11]. KIF23, a human homolog of mouse Kif23, is a member of kinesin motor protein involved in the regulation of cytokinesis and is found to play a critical role in the process of cytoplasm separation in mitosis, and the depletion of KIF23 can lead to the stagnation of mitosis [12, 13]. KIF23 could cross-bridge antiparallel microtubules and drive the movement of the microtubule [14]. In neuroblastoma cells, KIF23 depletion results in a significant increase in axon length [15]. Several studies have shown that KIF23 overexpression assessed by cDNA microarray or by quantitative reverse transcription-polymerase chain reaction (PCR) was recently shown in lung cancer, breast cancer, gliomas, paclitaxel-resistant gastric cancer, hepatocellular carcinomas, and pancreatic cancer [16, 17]. Here, we reported that the expression of KIF23 was associated with the pTNM stage and positively correlated with poor prognosis of gastric cancer patient. KIF23 depletion significantly inhibited gastric cancer cell proliferation in vitro and suppressed tumor formation in mice. Therefore, KIF23 may represent a potential therapeutic target to combat gastric cancer.

2. Materials and Methods

2.1. Antibodies and Primers

Rabbit anti-MKLP1 (1 : 200 dilution for immunohistochemistry, ab235955 plc, and 1 : 2000 dilution for western blot, ab168964 plc, Cambridge, UK), mouse anti-β-actin (1 : 5000 dilution, ab6276, Abcam plc, Cambridge, UK), rabbit anti-Ki67 (1 : 1000 dilution for western blot and 1 : 100 dilution for immunohistochemistry, ab16667, Abcam plc, Cambridge, UK), and rabbit anti-proliferating cell nuclear antigen (PCNA) (1 : 1000 dilution for western blot and 1 : 100 dilution for immunohistochemistry, ab18197, Abcam plc, Cambridge, UK) were used. The qRT-PCR primer sequences of KIF23 are as follows: forward, 5′-AGACAGAAGGCGAGGGATG-3′, and reverse, 5′-GGAGACGAATTGGTGGTGC-3′. The qRT-PCR primer sequences of GAPDH are as follows: 5′-CGACCACTTTGTCAAGCTCA-3′, and reverse, 5′-GGTTGAGCACAGGGTACTTTATT-3′. Ready-to-package AAV shRNA clones of KIF23 were bought from Addgene plc. The shRNA sequences targeting KIF23 were as follows: sense, 5′-AAACGAACCTTAAAGACCCAGTT-3′, and control shRNA did not match any known human coding cDNA.

2.2. Immunohistochemistry

Gastric cancer tissues were obtained from patients in Baoding First Central Hospital, and immunostaining was performed to analyze protein expression in clinical samples. Tissues were formalin-fixed and paraffin-embedded, and then sections were made in 5 μm. Those sections were deparaffinized in xylene and rehydrated in alcohol (100%, 100%, 95%, 85%, and 75%). The antigen was retrieved by citric acid buffer in a microwave for 15 min and then cooled at room temperature. Endogenous peroxidase was blocked using a blocking reagent for 5 minutes at room temperature and washed three times using PBS buffer. Then, sections were incubated with an anti-KIF23 antibody at 4°C overnight. On the second day, sections were washed three times in PBS and incubated with secondary antibody-HRP (Proteintech, Sanying, Wuhan, China, 1 : 1000) for 1 hour at room temperature, washed, and stained with diaminobenzidine (DAB, Cell Signaling Technology, Pudong, Shanghai, China) for 5 min. The images were collected with a microscope (Nikon, Tokyo, Japan). The KIF23 protein is mainly located in the cytoplasm and the nucleus of tumor cells. The tissues were scored according to the staining intensity of tumor cells. Positive cells were scored as follows: the proportion of positive tumor cells < 10%—score 0, the percentage of positive tumor cells being 10% to 30%—score 1, the positive percentage of tumor cells being 30%-70%—score 2, and the positive percentage of tumor cells > 70%—score 3. The positive staining was evaluated zero for negative staining, 1 for weak positive staining, 2 for moderate positive staining, and 3 for strong positive staining. The final scores were calculated by multiplying the proportion and intensity. According to the distributions of the final scores, we divided the expression of KIF23 into the high- (>3) and low- (0-3) expression groups. The sections of each patient were observed within 10 visual fields, and two experienced pathologists read the sections without getting the pathological grade and clinical data. The results were judged by a double-blind method.

2.3. Cell Culture and Transfection

The two types of human gastric cancer cell lines MGC-803 and SGC-7901 were bought from ATCC (Chicago, USA). Both of them were maintained in RPMI 1640 culture medium, supplemented with 10% of fetal bovine serum at 37°C in a 5% CO2 incubator. The KIF23 shRNA plasmids were transfected into cancer cell lines with Invitrogen Lipofectamine® 2000 (Thermo Fisher Scientific Inc.). The specific shRNA with the sequence of AAGCTGTGCCTATTGACATAGAC (Cat# SH817843, Vigene Biosciences, Rockville, USA) to target KIF23 and scrambled sequence was used as a negative control. 100,000 cells per well were plated in six-well plates according to the manufacturer's protocol, and 3 groups were set, including the shKIF23 group which was transfected with shRNA targeting KIF23, the negative control group which was transfected with a scrambled sequence, and the mock group which was treated without transfection (data not shown). Silencing efficiency was measured by RT-PCR and western blot after 48-hour transfection. These reduced cells were used to explore the association between KIF23 and cell proliferation and cell invasion. Then, the cell lines with stable depletion of KIF23 were screened and used for the in vitro and in vivo assays.

2.4. qRT-PCR Assay

Total RNA was extracted from MGC-803 and SGC-7901 cells using TRIzol Reagent (Invitrogen). Then, total RNA was reverse-transcribed by M-MLV reverse transcriptase (Promega). Quantitative real-time PCR was performed using SYBR mixture (Takara), and the relative expression of KIF23 was normalized to GAPDH.

2.5. Western Blot Assay

Protein samples extracted from cells or tumor tissues were separated by SDS-PAGE and sequentially transferred onto NC membranes, followed by blocking with 5% fat-free dry milk. The membranes were then incubated with primary antibodies for detection of KIF23, Ki67, PCNA, and β-actin for two hours. Subsequently, the membranes were incubated with HRP-conjugated secondary antibodies for 1 hour. Signals were visualized with an ECL kit.

2.6. Colony Formation

Both MGC-803 and SGC-7901 cells were plated in 6-well plates with a density of 4000 cells each well and grown for 14 days. The colonies were then fixed with methanol and stained with 0.1% crystal violet for 25 minutes. Images were then photographed, and colony numbers were sequentially calculated.

2.7. MTT Assay

MGC-803 and SGC-7901 cells were plated in 96-well plates with a density of 2000 cells per well and cultured for 48 hours. Subsequently, cells were incubated with MTT for 4 hours and removed from the medium. Then, cells were washed with PBS twice. MTT was then extracted by 150 μL DMSO, and the absorbance value at a wavelength of 570 nm was quantified.

2.8. In Vivo Tumor Growth Assay

The surgery of mice was approved by the Institutional Animal Care Committee of Baoding First Central Hospital. Nude BALB/c mice (6-8 weeks, 18-22 g) were purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd. (Beijing, China). To measure tumor growth in vivo, MGC-803 cells were stably transfected with the control or KIF23 shRNAs and injected subcutaneously into the right flank of female nude mice. After tumors (50-60 mm3) had established (about 2 weeks), the tumor volume was measured every 2, 3, or 4 days with a caliper and calculated as (length × width(2))/2.

2.9. Statistics

Data was analyzed using SPSS 22.0 software (SPSS Inc., IBM Corp., Armonk, NY). For immunohistochemistry experiments, the association between KIF23 expression and clinicopathological features was assessed using the χ2 test. The survival was correlated with tumor progression and KIF23 expression by the Kaplan-Meier method and log-rank test. Data are shown as mean ± standard deviation (SD) in in vitro and in vivo experiments. Student's t-test is used for statistical comparison. P < 0.05 was considered statistically significant.

3. Results

3.1. KIF23 Expression Was Associated with the Prognosis of Gastric Cancer

To explore the potential role of KIF23 in gastric cancer, we detected the expression of KIF23 in tumor tissues of gastric cancer patients who underwent surgical resection by immunohistochemistry. The surgical samples (n = 82) were classified into low- and high-KIF23 expression groups, according to the staining intensity of KIF23, while the expression of KIF23 was low in the normal paracancer tissues (Figures 1(a) and 1(b)). According to the results, 30 tumor tissues showed low expression levels of KIF23, whereas 52 of them showed a high expression level.
Figure 1

The expression level of KIF23 in tumor tissues was associated with the prognosis of patients who have gastric cancer. (a) Immunohistochemistry analysis of expression of KIF23 protein in gastric cancer tissues (×100 and ×200 magnifications, respectively). (b) Immunohistochemistry analysis of expression of KIF23 protein in the adjacent tissues (×100 and ×200 magnifications, respectively). (c) The difference analysis of the overall survival rate and disease-free survival rate between the low- and high-KIF23 expression groups: the median survival period of OS in the low- and high-KIF23 expression groups was 29.8 and 49.3 months, respectively, and the median survival period of DFS in the low- and high-KIF23 expression groups was 18.8 and 38.6 months, respectively.

The difference in clinicopathological characteristics was analyzed between the low-KIF23 expression and high-KIF23 expression groups. Data such as patient age, patient gender, tumor size, tumor grade, and lymph node metastasis were recorded, whereas no significant difference was found in these aspects between the KIF23 low-expression and high-expression groups, suggesting no marked association between KIF23 expression and these characteristics (Table 1). However, the KIF23 expression level in tumor tissues was remarkably correlated with the pTNM stage and recurrence (Table 1).
Table 1

Relationships of KIF23 and clinicopathological characteristics in 82 patients with gastric cancer.

FeatureAll (n = 82)KIF23 expression χ 2 P
Low (n = 30)High (n = 52)
Age (year)3.5770.059
 <50481434
 ≥50341618
Gender0.2160.642
 Male522032
 Female301020
Tumor grade2.3950.122
 Low501535
 High321517
Tumor size1.7080.191
 <5 cm361620
 ≥5 cm461432
pTNM stage4.3890.036
 I-II602634
 III-IV22418
Lymph node metastasis1.1770.278
 Yes28820
 No542232
Recurrence4.5180.034
 Yes401030
 No422022
We further explored the association between KIF23 and poor prognosis in gastric cancer patients. We found that the expression of KIF23 was associated with the overall survival rate and disease-free survival rate (Figure 1(c)). The patients with high expression of KIF23 had shorter OS and DFS time (P < 0.05, respectively). In conclusion, immunohistochemistry assays, clinicopathological characteristics, and survival analyses indicated that KIF23 was positively correlated with poor prognosis of gastric cancer.

3.2. KIF23 Suppression Could Inhibit Cell Proliferation of Gastric Cancer In Vitro

To explore the functional role of KIF23 in gastric cancer, we used shRNA targeting KIF23 to decrease the expression level of KIF23 in two types of gastric cancer cell lines, MGC-803 and SGC-7901. The qRT-PCR (Figure 2(a)) and western blot (Figure 2(b)) assay confirmed that the transfection of KIF23 shRNA effectively inhibited the expression of KIF23 in both MGC-803 and SGC-7901 cells, respectively.
Figure 2

KIF23 was adequately depleted in two types of human gastric cancer cells. (a) Results of the qRT-PCR assay showed that the expression level of KIF23 was sufficiently knocked down in the MGC-803 and SGC-7901 gastric cancer cells, respectively. (b) Results of the western blot assay revealed that the KIF23 gene was efficiently silenced in MGC-803 and SGC-7901 cells. Results are presented as mean ± SD (∗P < 0.05).

Cell proliferation is a vital process in cancer development. To explore the potential of KIF23 in the proliferation of gastric cancer cells, we performed colony formation assays. We found that the transfection of KIF23 shRNA plasmid significantly inhibited the proliferation of MGC-803 and SGC-7901 cells, respectively, consistent with significantly decreased cell colony numbers (Figure 3(a)). Furthermore, a significantly decreased absorbance value of 570 nm in MGC-803 and SGC-7901 cells was detected after performing MTT assays (Figure 3(b)). To further confirm the results about KIF23 ablation which inhibited the proliferation of gastric cancer, we then examined the expression levels of Ki67 and PCNA, respectively. Both Ki67 and PCNA could reflect the proliferation degree. Data indicated that the expression of Ki67 and PCNA resulted in a significant decrease in KIF23-depleted gastric cancer cells, compared with the control (Figures 3(c) and 3(d)). Thus, these results demonstrated that KIF23 depletion could inhibit cancer cell proliferation in vitro.
Figure 3

Knockdown of KIF23 significantly inhibited the proliferation in gastric cancer cells. (a) Photographs of the colony formation assay showed MGC-803 (a) and SGC-7901 cells (b) that were transfected with the control or KIF23 shRNA. Cultivation lasted 2 weeks. (b) The MTT assay revealed the difference between the control and KIF23-depleted gastric cancer cells. (c) The western blot assay showed that the expression level of Ki67 was markedly decreased in MGC-803 and SGC-7901 cells. (d) The western blot assay revealed that the PCNA expression was significantly downregulated in MGC-803 and SGC-7901 cells. Results are presented as mean ± SD (∗P < 0.05).

3.3. KIF23 Knockdown Could Inhibit Gastric Cancer Proliferation in Mice

In order to explore the protumor effect of KIF23 in vivo, MGC-803 cells were infected with shKIF23 lentivirus to stably knock down the expression of KIF23. shControl or shKIF23 cells were injected subcutaneously into nude mice, and then the tumor volume was measured per week and after 2 weeks following injection. The tumor volumes in the KIF23-depleted group were remarkably smaller than those in the control (Figure 4(a), left), and representative photographs of tumors from each group were shown (Figure 4(a), right). Additionally, we examined the KIF23 expression in tumor tissues of mice, performing western blot and immunohistochemistry assays. All these data confirmed that the expression of KIF23 in the shKIF23 group was markedly decreased compared with the control (Figures 4(b) and 4(c)).
Figure 4

The association between KIF23 and the proliferation of gastric cancer in mice. (a) MGC-803 cells were infected with shKIF23 or shControl lentivirus and subcutaneously implanted into nude mice. After 2 weeks, tumors were isolated and photographs were then taken every other week (n = 4 in each group). Tumor growth curves were calculated according to the average volume of 4 tumors for each group. (b, c) Immunohistochemistry and western blot analysis: the expression level of KIF23 in tissues of the shKIF23 and shControl groups. (d) Immunohistochemistry analysis: the difference in the expression of Ki67 and PCNA between the shKIF23 and shControl groups. Results are presented as mean ± SD (∗P < 0.05).

We further explored the potential mechanism about KIF23 and gastric cancer proliferation. Immunohistochemistry assays were performed using tumor tissues, and interestingly, the results showed that the expression level of Ki67 and PCNA in the KIF23-ablated group was significantly reduced, suggesting a significant inhibition of cell proliferation (Figure 4(d)). These data demonstrated that KIF23 was involved in the proliferation of gastric cancer in vivo.

4. Discussion

Gastric cancer is a malignant tumor that originated from the gastric mucosal epithelium, and its incidence ranks first among all kinds of malignant tumors in China [18, 19]. Most of the early gastric cancer can receive radical treatment under surgical therapy, and the 5-year survival rate is over 90% [20]. However, the diagnosis and treatment rate of early gastric cancer in China is less than 10%, far lower than that in other Southeast Asian countries, such as Japan (70%) and South Korea (50%) [21]. Early diagnosis and early treatment of cancer are the main strategies to reduce mortality and improve survival [22]. In recent years, many new therapeutic targets for gastric cancer, such as STK33 and HNF4, have been found, and their effectiveness needs to be further confirmed [23, 24]. In this study, we demonstrated the association between KIF23 and gastric cancer and considered it to be a new target for gastric cancer treatment. Of course, more elaborate mechanisms need to be confirmed by further experiments. As a member of the KIF family, KIF23 plays as a molecular motor, which is plus-end-directed and relied on the microtubule [14, 25]. Several studies suggest that KIF23 may play a potential role in cell proliferation [14]. During mitosis, KIF23 is involved in the formation of the midbody and further affects cytokinesis by recruiting regulatory factors involved in cell division [12, 26, 27]. KIF23 has the special localization in the nucleus. When the nuclear localization signal of KIF23 is mutated, the cell cycle is markedly blocked, suggesting that KIF23 may also influence the process of cell proliferation through transcription [26]. Although KIF23 may be involved in the regulation of cell proliferation, it is still unclear whether KIF23 regulates tumor cell proliferation and further affects the occurrence and development of tumor. Here, we found that KIF23 suppression could inhibit gastric cancer development by affecting cell proliferation, which confirmed the previous conclusion and provided a novel therapeutic target for the treatment of gastric cancer. KIF23 affects the progression of various tumors. Consistent with our data on the role of KIF23 in gastric cancer, KIF23 has been reported to affect the proliferation of glioma both in vivo and in vitro, which was regulated by TCF-4, suggesting a similar mechanism [28], whereas KIF23 could inhibit the development of lung cancer and promote apoptosis of lung cancer cells in vivo [13, 29]. We only examined its function on the proliferation of gastric cancer cells, and the effect on apoptosis needs further study. Previous data have shown that KIF23 is associated with the expression of a variety of oncogenes that influence tumor cell division, chromosome segregation, proliferation, and metastasis [30]. In hepatocellular carcinoma, KIF23 is found to be upregulated and correlated with poor prognosis [30]. KIF23 was also reported to be highly expressed in non-small-cell lung cancer, and patients with low expression of KIF23 tended to have better prognosis [17]. In conclusion, KIF23 is involved in the occurrence and development of various tumors, mainly through affecting the proliferation, invasion, and apoptosis of cancer cells [13, 28]. We demonstrated that KIF23 suppression could inhibit cancer development by affecting the proliferation of gastric cancer cells, but more detailed molecular mechanisms still needed to be further studied. Collectively, our data argued that the expression of KIF23 was increased in tumors of gastric cancer patients. KIF23 was correlated with the pTNM stage of gastric cancer, suggesting its role in the pathogenesis of gastric cancer. In fact, patients with gastric cancer with high KIF23 expression had worse prognosis. It has been confirmed by in vitro and in vivo assays that KIF23 was involved in the development of gastric cancer by affecting the proliferation of the cancer cells. Our data indicated that KIF23 might serve as a potential molecular target for personalized medicine in gastric cancer.
  19 in total

1.  Downregulation of KIF15 inhibits the tumorigenesis of non-small-cell lung cancer via inactivating Raf/MEK/ERK signaling.

Authors:  Yingbin Luo; Bo Zhang; Lili Xu; Minghua Li; Jianchun Wu; Yiyang Zhou; Yan Li
Journal:  Histol Histopathol       Date:  2021-12-15       Impact factor: 2.303

2.  KIF23 promotes triple negative breast cancer through activating epithelial-mesenchymal transition.

Authors:  Wei Jian; Xiao-Chong Deng; Amik Munankarmy; Oyungerel Borkhuu; Chang-Le Ji; Xue-Hui Wang; Wen-Fang Zheng; Yun-He Yu; Xi-Qian Zhou; Lin Fang
Journal:  Gland Surg       Date:  2021-06

3.  GSG2 (Haspin) promotes development and progression of bladder cancer through targeting KIF15 (Kinase-12).

Authors:  Yuhao Chen; Dian Fu; Hai Zhao; Wen Cheng; Feng Xu
Journal:  Aging (Albany NY)       Date:  2020-05-21       Impact factor: 5.682

4.  KIF11 and KIF15 mitotic kinesins are potential therapeutic vulnerabilities for malignant peripheral nerve sheath tumors.

Authors:  Ernest Terribas; Marco Fernández; Helena Mazuelas; Juana Fernández-Rodríguez; Josep Biayna; Ignacio Blanco; Gabriela Bernal; Irma Ramos-Oliver; Craig Thomas; Rajiv Guha; Xiaohu Zhang; Bernat Gel; Cleofé Romagosa; Marc Ferrer; Conxi Lázaro; Eduard Serra
Journal:  Neurooncol Adv       Date:  2020-01-04

5.  Knockdown of lncRNA PVT1 inhibits prostate cancer progression in vitro and in vivo by the suppression of KIF23 through stimulating miR-15a-5p.

Authors:  Huijuan Wu; Xin Tian; Chaoyang Zhu
Journal:  Cancer Cell Int       Date:  2020-07-02       Impact factor: 5.722

6.  Identification of circRNA-miRNA-mRNA regulatory network in gastric cancer by analysis of microarray data.

Authors:  Yong-Jun Guan; Jian-Ying Ma; Wei Song
Journal:  Cancer Cell Int       Date:  2019-07-16       Impact factor: 5.722

7.  KIF23 activated Wnt/β-catenin signaling pathway through direct interaction with Amer1 in gastric cancer.

Authors:  Yi Liu; Hui Chen; Ping Dong; Guohua Xie; Yunlan Zhou; Yanhui Ma; Xiangliang Yuan; Junyao Yang; Li Han; Lei Chen; Lisong Shen
Journal:  Aging (Albany NY)       Date:  2020-05-04       Impact factor: 5.682

8.  MCM2 and NUSAP1 Are Potential Biomarkers for the Diagnosis and Prognosis of Pancreatic Cancer.

Authors:  Yajun Deng; Hanyun Ma; Jinyong Hao; Qiqi Xie; Ruochen Zhao
Journal:  Biomed Res Int       Date:  2020-04-28       Impact factor: 3.411

9.  Construction of a Competitive Endogenous RNA Network for Pancreatic Adenocarcinoma Based on Weighted Gene Co-expression Network Analysis and a Prognosis Model.

Authors:  Jing Wang; Jinzhu Xiang; Xueling Li
Journal:  Front Bioeng Biotechnol       Date:  2020-05-28

10.  ZNF367-induced transcriptional activation of KIF15 accelerates the progression of breast cancer.

Authors:  Huijuan Zeng; Tianfu Li; Duanyang Zhai; Jiong Bi; Xiaying Kuang; Sihong Lu; Zhen Shan; Ying Lin
Journal:  Int J Biol Sci       Date:  2020-05-16       Impact factor: 6.580

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.