Literature DB >> 31000995

Influence of intrinsic microbes on phytochemical changes and antioxidant activity of the Ayurvedic fermented medicines: Balarishta and Chandanasava.

Annadurai Vinothkanna1, Soundarapandian Sekar1.   

Abstract

BACKGROUND: Balarishta and Chandanasava are polyherbal-fermented medicines of Ayurveda.
OBJECTIVE: Investigation of native microbes, understanding phytochemical changes and antioxidant activities in these medicines.
METHODS: Microbial populations were enumerated using selective media and standard plating methods. Yeast and bacteria were identified using classical and molecular methods. Qualitative phytochemical and gas chromatography-mass spectrometry (GC-MS) analyses were carried out. In vitro antioxidant assays were performed with different assay systems.
RESULTS: Balarishta and Chandanasava possess two yeasts (Saccharomyces cerevisiae and Schizosaccharomyces pombe) and six bacteria that are species of Bacillus, Paenibacillus, and Brevibacillus. These microbes identified biochemically were authenticated with 16S and 18S rDNA sequence analysis and NCBI accession numbers. GC-MS analysis indicated that several compounds disappear as a result of fermentation while many are retained. The presence of new phytochemical compounds in the final stages of fermentation could be ascribed from the parent molecules that either disappeared or retained during fermentation. It suggests the biotransformation of phytochemicals by the mediation of intrinsic microbes. These medicines possess antioxidant activities by the presence of phytochemicals such as phenolics, flavonoids, tannins and phytosterols, wherein bacteria also contribute.
CONCLUSION: The role of native microbial consortium in fermentation, biotransformation and antioxidant activity of these Arishta and Asava is demonstrated.

Entities:  

Keywords:  16S and 18S rDNA analysis; antioxidant activity; biotransformation; gas chromatography-mass spectrometry analysis; traditional knowledge

Year:  2018        PMID: 31000995      PMCID: PMC6454907          DOI: 10.4103/ayu.AYU_237_17

Source DB:  PubMed          Journal:  Ayu        ISSN: 0974-8520


Introduction

Ayurvedic pharmacopeia comprises various medicines including fermented traditional medicines (FTM), namely, Arishta (fermented decoctions) and Asava (fermented infusions). They are polyherbal preparations fermented by self-generated/intrinsic microbes. They are moderately alcoholic and prepared using herbal juices or their decoctions to undergo fermentation by the addition of sugar, jaggery or honey.[1] Conventionally, Arishta and Asava are considered as unique and valuable therapeutics[2] because of their better keeping quality, enhanced therapeutic properties, improvement in the extraction of drug molecules from the herbs and effectiveness of drug delivery in the body. There are at least 44 Arishta and 45 Asava preparations whose composition and medicinal properties were documented earlier.[123] Among them, Balarishta and Chandanasava are commonly used ones. Balarishta is recommended for paralysis, nervous disorders, gastric problems, autoimmune diseases and rheumatism. It contains 11 herbal ingredients. Chandanasava contains 24 herbal ingredients and is recommended for treating ailments such as gastric problems, urinary disorders, spermatorrhea, gonorrhea, autoimmune diseases and as diuretic, appetizer and to provide cooling effect in the body.[1] There are few reports on the isolation of microbes from this fermentation system. For example, Saccharomyces from Amritarishta,[4] yeasts, Aspergillus and Bacillus species from Dashamularishta,[5] Saccharomyces cerevisiae and Schizosaccharomyces pombe from Nimbarishta.[6] As in other medicaments of Ayurveda, investigation on the phytochemical composition of Arishta and Asava are also scanty and earlier reports indicate only the presence or absence of certain preliminary groups of phytochemicals.[789101112131415] There are also few reports on the specific phytochemical components in the group of phenolics, stilbenes, glucosides and non-volatile compounds.[1617] The situation in Arishta/Asava could be complex as microbial fermentation is involved and every feasibility of interaction of the herbal-oriented phytochemicals with the microbial catalyst exists. There are also few reports on the possibility of biotransformation of phytochemicals-phenolics biotransformation in Arjunarishta and Abhayarishta[1618] and glucoside biotransformation in Jirakadyarishta.[19] It is thus evident that microbiological studies in Ayurvedic Arishta and Asava are in the nascent stage. The range of microbial catalysts involved in the entire Arishta and Asava fermentations and their possible succession in different stages need systematic investigation. The analysis of sequence-based evolutionary relationship among the closely related species of 18S rDNA genes of yeasts and 16S rDNA genes of bacteria can be helpful to ascertain their identity.[20] Recently, the antioxidant activity of Balarishta,[82122] Saraswatarishta,[12] Ashwagandharishta[23] and Kumaryasava[24] were documented. Antioxidants have numerous pharmaceutical and therapeutic roles to play. Formation of free radicals is the causative factor for several diseases and quenching them by antioxidants leads to health.[25] However, synthetic antioxidants cause side effects and search for natural antioxidants that lack toxicity is the need of the hour.[25] Hence, this work is to evaluate the microbiota emerged during fermentation and their contribution to phytochemical changes and antioxidant property of Balarishta and Chandanasava.

Materials and Methods

Chemicals and reagents

The chemicals for phytochemical analysis, antioxidant assays and standards were purchased from Himedia (Mumbai, India), Sisco Research Lab (Mumbai, India) and Sigma–Aldrich (St. Louis, Missouri, USA). Chemicals, reagents and solvents used were of analytical grade.

Preparation of Balarishta and Chandanasava

The Ayurvedic samples were prepared from the manufacturing unit of M/S. Ashtanga Ayurvedics (P) Ltd, Tiruchirappalli, Tamil Nadu, India [Table 1]. The herbal ingredients were sourced directly from this Ayurvedic firm.
Table 1

Composition of Balarishta and Chandanasava

Sanskrit nameBotanical namePart usedQuantity

Balarishta
BalaSida rhombifolia L.Root11 kg
AshwagandhaWithania somnifera (L.) DunalRoot11 kg
GudaJaggery-75 kg
DhatakiWoodfordia fruticosa Kurz.Flower700 g
JivantiHolostemma ada-kodien Schult.Root360 g
ErandaRicinus communis L.Bark360 g
RasnaAlpinia galanga Willd.Root180 g
ElaElettaria cardamomum MatonFruit180 g
PrasariniMerremia tridentata (L.) Hallier f.Root180 g
LavangaSyzygium aromaticum (L.) Merr. and L.M.PerryFlower180 g
SugandhimulaVetiveria zizanioides StapfRoot180 g
GokshuraTribulus terrestris L.Fruit180 g
-Water-360 L

Chandanasava
ChandanaSantalum album L.Wood120 g
HriberaPlectranthus vettiveroides (Jacob) N.P.Singh and B.D.SharmaRoot120 g
MustaCyperus rotundus L.Tuber120 g
Kashmari Gmelina arborea Roxb.Wood120 g
IndivaraMonochoria vaginalis C. PreslTuber120 g
PriyanguCallicarpa macrophylla Vahl.Flower120 g
PadmakaPrunus cerasoides D. DonWood120 g
LodhraSymplocos cochinchinensis S.MooreBark120 g
ManjisthaRubia cordifolia L.Tuber120 g
RaktachandanaPterocarpus santalinus L.f.Wood120 g
PathaCyclea peltata (Lam.) Hook.f. and ThomsonTuber120 g
BhunimbaAndrographis paniculata NeesWhole plant120 g
VataFicus benghalensis L.Bark120 g
AshwatthaFicus religiosa L.Bark120 g
ShatiKaempferia galanga L.Tuber120 g
ParpataHedyotis corymbosa (L.) Lam.Whole plant120 g
MadhukaGlycyrrhiza glabra L.Rhizome120 g
RasnaAlpinia galanga Wid.Tuber120 g
PatolaTrichosanthes lobata Roxb.Stem120 g
KanchanaraBauhinia variegata L.Bark120 g
AmraMangifera indica L.Bark120 g
MocharasaBombax ceiba L.Gum120 g
MridvikaVitis vinifera L.Fruit2400 g
GudaJaggery-6 kg
DhatakiWoodfordia fruticosa Kurz.Flower1800 g
-Sugar-9 kg
-Water-70 L
Composition of Balarishta and Chandanasava Balarishta is made with decoctions of herbs in boiling water, while Chandanasava is prepared directly using fresh herbal juices.[1] In the preparation of Balarishta, decoction of drug is prepared and placed in an earthen fermentation vessel. Jaggery is dissolved, boiled and added into the fermentation vessel. Fermentation of worts of both the formulation is traditionally brought about by the addition of flowers of the plant, Woodfordia fruticosa (L.) kurz. Then, the earthen lid edges are closed with clay smeared cloth. Constant temperature (28°C) is maintained during fermentation. The fermented fluid is finally filtered and used. For Chandanasava preparation, the required quantity of water to which jaggery and sugar are added, boiled and cooled. This is poured into the fermentation vessel in that the fine powdered herbal drugs are added. Further processing is performed as in Balarishta.

Microbiological evaluation

Enumeration of microorganisms

The samples were decimally diluted (10−1, 10−2-10−5) using sterile 0.85% saline water in 1: 9 ratio. One milliliter of each diluted sample was pour plated using actidione-incorporated nutrient agar (for heterotrophic bacteria),[26] chloramphenicol-incorporated yeast extract-malt extract agar (for yeasts)[27] and chloramphenicol-incorporated dichloron rose bengal agar (for fungi).[28] The total heterotrophic bacterial population (grown at 37°C), yeast (grown at 28°C) and fungal (grown at 30°C) population were enumerated after 42-72 h of growth. Discrete microbial colonies were isolated and purified for further identification.

Biochemical and molecular identification of yeasts using 18S rDNA sequencing

The yeasts were identified using classical biochemical tests such as fermentation of carbohydrates (glucose, sucrose, melibiose, lactose, raffinose, maltose and cellobiose), growth in various carbohydrates and temperatures, urea hydrolysis and reproduction.[27] For 18S rDNA, genomic DNA was isolated with Fungal Genomic DNA Isolation Kit (RKT13, Chromous Biotech, Bengaluru) using pure cultures and amplified internal transcribed spacer (ITS) region of the 18S rDNA genes using universal primers ITS1 (5’-ACCCGCTGAACTTAAGC-3’) and ITS2 (5’- TACTACCACCAAGATCT-3’) by polymerase chain reaction (PCR).[2935] The PCR was carried out by denaturing DNA initially at 94°C for 5 min followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min and final extension at 72°C for 10 min). The presence or absence of PCR products was determined electrophoretically on 1% (w/v) agarose gel with ethidium bromide staining. The PCR products were purified using a Gel Extraction Kit (Qiagen, California, USA) and subcloned into pGEMT-Easy vector (Promega, Wisconsin, USA). The selected clone was subjected to sequencing of 18S rDNA gene fragment with universal primer SP6 (ATTTAGGTGACACTATAGAAGNG) and T7 (TAATACGACTCACTATAGGGAGA) using ABI prism 3130 sequencer (Perkin Elmer, California, USA). The sequence data were aligned with nucleotide PSI-BLAST[30] to identify the closely related organisms and to recognize the origin and evolution among them. Pair-wise and multiple sequence alignment were done by CLUSTAL W.[31] The construction of phylogenetic tree and computing the pair-wise genetic diversity for the yeast isolates was performed based on sequence similarities using molecular evolutionary genetics analysis (MEGA) Version 6.0 software[32] employing neighbor joining[33] method of Kimura two-parameter evolutionary model with 1000 bootstrap replicates.[34]

Biochemical and molecular identification of bacteria using 16S rDNA sequencing

The bacterial cultures were identified by biochemical tests (Bergey’s Manual of Systematic Bacteriology, 1984) such as ram staining, endospore staining, motility, catalase test, fermentation of carbohydrate, indole test, the hydrolysis of starch, casein and gelatin, Voges-Proskauer test, citrate utilization and nitrate reduction.[35] For 16S rDNA, genomic DNA was isolated from the pure culture[29] and 16S rDNA was amplified using universal primers (FD1-’-GAGTTTGATCCTGGCTCAG-3 ’ and RD1-5’-AAGGAGGTGATCCAGCC-3’). PCR was carried out by denaturing DNA initially at 94°C for 5 min followed by 30 cycles of amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 2 min). The PCR amplified products were electrophoresed on 1% agarose gel. The PCR products were purified using a Gel Extraction Kit (Qiagen, California, USA) and subcloned into pGEM-T Easy vector (Promega, Wisconsin, USA). The selected clone was subjected to sequencing of 16S rRNA gene fragment with universal primer SP6 (ATTTAGGTGACACTATAGAAGNG) and T7 (TAATACGACTCACTATAGGGAGA) using ABI prism 3130 sequencer (Perkin Elmer, California, USA).[36] Phylogenetic analysis of the sequence data (PSI-BLAST, CLUSTAL W and MEGA) was performed as in the case of yeasts.

Phytochemical evaluation

Qualitative analysis of phytochemicals

The preliminary phytochemicals were evaluated up to 35 days in 5-day intervals during the course of fermentation.[37] Alkaloids were analyzed using Dragendorff’s reagent and saponins by foaming test[38] glycosides were assessed by analyzing the total sugar content of the sample,[39] before and after hydrolysis with concentrated sulfuric acid,[38] tannins using lead acetate reagent, phenolic compounds using ferric chloride reagent, phytosterols using acetic anhydride-sulfuric acid reagent and flavonoids using lead acetate reagent.[40]

Gas chromatography-mass spectrometry analysis of phytochemicals

Arishta and Asava samples were concentrated in hot air oven at 80°C for 24-48 h. Fifteen milliliters of this sample was frozen using the deep freezer for 1 day at –20°C and then, the frozen sample was concentrated with the help of vacuum evaporator at –80°C. The freeze-dried sample was dissolved in 10 ml of HPLC grade methanol and gas chromatography-mass spectrometry (GC-MS) (PerkinElmer Clarus 500, Connecticut, USA) analysis was performed.[41] One micro liter of sample (Balarishta and Chandanasava separately) was injected (split ratio 1:8) into the GC-MS system on a 30-m capillary column with a film thickness of 0.25 μm (30 mm × 0.25 mm id coated with 5% phenyl 95% dimethylpolysiloxane). Helium was the carrier gas with a flow rate of 1 ml/min. The injection port temperature was 280°C. Two types of oven temperature were followed. Initial oven temperature of 50°C at 10°C/min to 150°C at 8°C/min to 280°C (10 min) and 60°C at 8°C/min to 200°C at 10°C/min to 300°C (5 min) (Scan type: full scan mode, Scan range: 40-450 Daltons). The peaks are matched with phytochemistry library: NIST (The National Institute of Standards and Technology) MS search library version 2.0.

Pharmaceutical evaluation

Antioxidant assays

The antioxidant activity of Balarishta, Chandanasava, and microbial cell-free supernatant (CFS) were measured by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity,[2342] hydroxyl radical scavenging,[4243] hydrogen peroxide scavenging,[23] reducing power,[2342] metal chelating assay,[4344] nitric oxide scavenging,[43] superoxide anion[4344] and 2,2’- azino-bis (3-ethylbenzothiazoline-6-sulfonic acid [ABTS]) radical scavenging assay.[45] (Jasco V-650, Tokyo, Japan).

Statistical analyses

The data were represented as mean ± standard error of mean of three determinations. Statistical analyses were performed using one-way analysis of variance. The IC50 values were calculated by linear-regression probit analysis. Results were calculated by employing the statistical software (SPSS for Windows, Version 16.0. Chicago, SPSS Inc.).

Results

The population of bacteria, yeast, and fungi was investigated during the entire course of fermentation of Balarishta [Figure 1a] and Chandanasava [Figure 1b]. In both Chandanasava and Balarishta, filamentous fungi were found only at the beginning stages of fermentation that too at low levels over the surface. They disappeared from the fifth day in Balarishta and tenth day in Chandanasava. In Balarishta, yeasts are the dominant population found throughout the course of fermentation (25,700 × 103 CFU/ml). The population was at its peak on the fifth day and subsequently decreased toward the end of fermentation [Figure 1a]. However, in Chandanasava, though yeasts were dominant (9500 × 103 CFU/ml), they disappeared after twenty fifth day. The peak of yeast population was found on fifth and tenth days. Next to yeasts, the presence of bacteria was also observed in this fermentation process [Figure 1b]. In Balarishta, the bacterial population gradually increased up to tenth day and subsequently maintained at steady level (71 × 103 CFU/ml) till the end of fermentation [Figure 1a]. But, in Chandanasava, the bacterial population was at its peak on the fifth day (188 × 103 CFU/ml). It decreased, but fluctuated till the end of fermentation [Figure 1b]. Investigation of yeast population indicated the presence of two kinds that are similar in both Balarishta and Chandanasava. Both organisms have the same colony morphology – creamy white and circular colonies. Microscopic examination revealed the presence of budding yeast and fission yeast.
Figure 1

Enumeration of microbial population during the course of fermentation of (a) Balarishta and (b) Chandanasava

Enumeration of microbial population during the course of fermentation of (a) Balarishta and (b) Chandanasava Identification of budding yeast (BY-03) by morphological and biochemical features [Table 2] revealed as S. cerevisiae. Similar identification of fission yeast (BY-10) revealed as S. pombe [Table 1]. The bacteria present in the Balarishta fermentation was investigated morphologically and biochemically [Table 3]. It revealed the presence of six species of Bacillus (Bacillus licheniformis, Bacillus macerans, Bacillus pumilus, Bacillus subtilis and Bacillus circulans). Similarly, in Chandanasava, six species of Bacillus (B. licheniformis, B. subtilis, B. polymyxa, B. coagulans, B. circulans and B. mycoides) were present [Table 3].
Table 2

Biochemical characterization leading to the identification of yeasts involved in the fermentation of Balarishta and Chandanasava

ParametersSaccharomyces cerevisiaeSchizosaccharomyces pombe
Glucose fermentation++
Sucrose fermentation++
Melibiose fermentation+-
Lactose fermentation--
Growth in glucose++
Growth in sucrose++
Growth in raffinose++
Growth in maltose++
Growth in melibiose+-
Growth in lactose--
Growth in cellobiose--
Growth at 25°C++
Growth at 30°C++
Growth at 35°C++
Growth at 37°C++
Urea hydrolysis-+
Growth in 50% glucose++
Growth in 10%NaCl++
Growth in 16% NaCl--
ReproductionBuddingFission

+: Positive for the test, -: Negative for the test

Table 3

Biochemical characterization leading to the identification of bacteria involved in the fermentation of Balarishta and Chandanasava

ParametersBalarishtaChandanasava


B. licheniformisB. subtilisB. circulansB. maceransB. pumilusB. brevisB. licheniformisB. subtilisB. circulansB. coagulansB. polymyxaB. mycoides
Gram’s staining++++++++++++
Spore staining++++++++++++
Catalase++++++++++++
Starch hydrolysis++++-+++++++
Casein hydrolysis+++-++++++++
Gelatin hydrolysis+++++++++-++
Indole production------------
VP test++--+-++-+++
pH of VP<6<6<6<6<6>7<6<6<6<6<6<6
Utilization of citrate++++++++++-+
Nitrate reduction++++-+++++++
Anaerobic growth+-++--+-++++
Acid from glucose++++++++++++
Acid from mannitol+++++++++++-
Acid from xylose+++++-+++++-
Gas from glucose---+------+-

+: Positive for the test, -: Negative for the test, B. licheniformis: Bacillus licheniformis, B. subtilis: Bacillus. subtilis, B. circulans: Bacillus circulans, B. macerans: Bacillus macerans, B. pumilus: Bacillus pumilus, B. brevis: Bacillus brevis

Biochemical characterization leading to the identification of yeasts involved in the fermentation of Balarishta and Chandanasava +: Positive for the test, -: Negative for the test Biochemical characterization leading to the identification of bacteria involved in the fermentation of Balarishta and Chandanasava +: Positive for the test, -: Negative for the test, B. licheniformis: Bacillus licheniformis, B. subtilis: Bacillus. subtilis, B. circulans: Bacillus circulans, B. macerans: Bacillus macerans, B. pumilus: Bacillus pumilus, B. brevis: Bacillus brevis Occurrence of bacterial flora in the suspension of Balarishta and Chandanasava during the entire course of fermentation was recorded. In Balarishta, B. pumilus was constantly present, while other five species had a sporadically present during the full course of fermentation. B. licheniformis was noticed in the fermentation mash on 0, 15, 20, 25 and 35 days. B. brevis was found on 0, 10 and 20 days. B. circulans was found on 5, 20 and 30 days. B. subtilis was observed on 5, 10 and 30 days. Finally, B. macerans was found on 0, 5 and 10 days. In Chandanasava, B. licheniformis and B. subtilis were constantly present while another four species showed the sporadic presence during the full course of fermentation. B. polymyxa and B. coagulans were found only at the initial day of fermentation and absent subsequently. B. mycoides was noticed only on twentieth day, while B. circulans was found only on 15, 20 and 30 days of fermentation. Budding yeast (BY-03) was identified by 18S rDNA as S. cerevisiae (Accession number: KJ562355) [Table 4]. Similarly, fission yeast (BY-10) was identified as S. pombe (Accession number: KJ562356) [Table 4]. The Homologs template sequences were retrieved from NCBI-BLAST based on the similarity analysis from our target isolates of 12 bacteria and 2 yeasts [Table 3]. Identification of 12 bacteria by 16S rDNA revealed some differences from the classical biochemical tests based approaches, [Table 4] wherein the organisms fit into species of Bacillus, Paenibacillu, or Brevibacillus. Using neighbor-joining algorithm, the phylogenetic tree was constructed with 1000 bootstrap replication [Figure 2]. The phylogenetic tree was grouped into two major clusters. Cluster one belongs to S. cerevisiae and cluster two belongs to S. pombe. The sequence-based evolutionary relationship among the strains of S. cerevisiae shows no diversity occurrence at the species level. Our target sequence S. cerevisiae BY-03 is closely related with S. cerevisiae Sc20. Whereas, S. pombe BY-10 are closely related with the genera Schizosaccharomyces UFLA [Figure 3]. From this result, the closely related species were placed as a reference model for the target species.
Table 4

Similarity search analysis of rRNA gene sequences of bacteria (16S) and yeasts (18S) isolated from Balarishta and Chandanasava using NCBI-BLAST

TargetTemplate


IdentificationAccessionHomology strainIdentity (%)

Bacteria
Bacillus licheniformis BB-01KP859547Bacillus spp. KPG91
Brevibacillus brevis BB-02KP859548Brevibacillus brevis strain ZFJ-2100
Paenibacillus macreans BB-03KP859549Bacillus spp. hb799
Bacillus pumilus BB-04KP859550Bacillus pumilus strain KBBI0898
Bacillus subtilis BB-14KP859551Bacillus spp. HSD00299
Bacillus circulans BB-24KP859552Bacillus circulans strain Q1196
Bacillus licheniformis CB-01KP859553Bacillus licheniformis strain 5NAP2398
Bacillus subtilis CB-03KP859554Bacillus subtilis strain ZJ-193
Paenibacillus polymyxa CB-05KP859555Bacillus spp. A-BT-nw99
Bacillus coagulans CB-24KP859556Bacillus spp. I7 (2011)99
Bacillus circulans CB-31KP859557Bacillus spp. D12 (2010)99
Bacillus mycoides CB-51KP859558Bacillus spp. AY898

Yeasts

Saccharomyces cerevisiae BY-03KJ562355Saccharomyces cerevisiae isolate AUS-LFB-MA-YC197
Schizosaccharomyces pombe BY-10KJ562356Schizosaccharomyces japonicus98

NCBI-BLAST: National Center for Biotechnology Information-Basic Local Alignment Search Tool

Figure 2

Phylogenetic tree based on 16S rDNA genes of the 12 bacterial isolates. The numbers at nodes are percentages indicating the levels of bootstrap support, based on neighbor joining method. ♦ Represents bacterial isolates from Balarishta. • Represents} bacterial isolates from Chandanasava

Figure 3

Phylogenetic tree based on 18S rDNA genes of the two yeast isolates (BY-03 and BY-10). The numbers at nodes are percentages indicating the levels of bootstrap support, based on neighbor joining method

Similarity search analysis of rRNA gene sequences of bacteria (16S) and yeasts (18S) isolated from Balarishta and Chandanasava using NCBI-BLAST NCBI-BLAST: National Center for Biotechnology Information-Basic Local Alignment Search Tool Phylogenetic tree based on 16S rDNA genes of the 12 bacterial isolates. The numbers at nodes are percentages indicating the levels of bootstrap support, based on neighbor joining method. ♦ Represents bacterial isolates from Balarishta. • Represents} bacterial isolates from Chandanasava Phylogenetic tree based on 18S rDNA genes of the two yeast isolates (BY-03 and BY-10). The numbers at nodes are percentages indicating the levels of bootstrap support, based on neighbor joining method

Preliminary phytochemical changes

Qualitative analysis of phytochemicals during the process of fermentation of Balarishta indicated some major changes, though alkaloids, tannins, phenolic compounds and glycosides were present during the entire course of fermentation. Flavonoids and saponins were found from fifth-day onward, whereas phytosterol from the tenth-day onward. Similar phytochemical changes in Chandanasava showed the presence of alkaloids, tannins, phenolic compounds, saponins and glycosides in the entire course of fermentation. Further, phytosterols and flavonoids were found from fifth day onward.

Specific phytochemical changes

To ascertain the nature of phytochemicals, GC-MS analysis was performed using two types of oven temperature programs, both at the initial and final stages of fermentation in Balarishta and Chandanasava. The compounds identified at the start of fermentation and at the end of fermentation are listed out, respectively, for Balarishta and Chandanasava. Analysis of these results indicated that certain compounds are retained during the entire course of fermentation while many disappear. Similarly, formation of new compounds can be traced. Based on this GC-MS analysis, there are 19 compounds retained during the entire course of fermentation of Balarishta. Further, 18 compounds are known to disappear and 23 compounds are newly formed as a result of fermentation [Table 5]. In the case of Chandanasava, 14 compounds are retained during the entire course of fermentation. Further, 30 compounds are known to disappear and 32 compounds are newly formed as a result of fermentation [Table 6].
Table 5

Phytochemicals that are retained, disappeared and newly formed as a result of fermentation of Balarishta

Retained compoundsDisappeared compoundsNewly formed compounds
2,4-Dihydroxy-2,5-dimethyl-3 (2H)-furan-3-one1,2,3-Propanetriol, monoacetate1,2-Epoxy-3-propyl acetate
2,5-Dimethyl-4-hydroxy-3 (2H)-furanone1,2-Benzenedicarboxylic acid, butyl octyl ester1H-Imidazole-4-ethanamine, N,5-dimethyl-
2-Furancarboxaldehyde, 5-(hydroxymethyl)-1,3-Dioxane, 2,4-dimethyl-2 (3H)-Furanone, dihydro-4-hydroxy-
2-Furancarboxaldehyde, 5-methyl-1b, 4a-Epoxy-2H 2,2’- Bioxirane, (R*, R*)-(ñ)-
2-Furanmethanolcyclopenta[3,4]cyclopropa[8,9]cycloundec [1,2- b] 2,3-Butanediol
2H-Pyran-2,6 (3H)-dioneoxiren-5 (6H)-one, 7 (acetyloxy) decahydro-2,9,10-2-Deoxy-D-galactose
2-Propanone, 1,3-dihydroxy-trihydroxy- 3,6,8,8,10a-pentamethyl-2-Formyl-9-[ α -d-ribofuranosyl]
4H-Pyran-4-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-2-Cyclopenten-1-one, 2-hydroxy-3-methyl- 3-Butyl-4-nitro-pent-4-enoic acid, methyl esterhypoxanthine
6-Oxa-bicyclo[3.1.0]hexan-3-one4H-Pyran-4-one, 3,5-dihydroxy-2-methyl-(s) 2-Hydroxypropanoic acid
α -D-Glucopyranose, 4-O- α -D-5-Acetoxymethyl-2-furaldehyde2-Propanone, 1-hydroxy-
galactopyranosyl-7-Methyl-Z-tetradecen-1-ol acetate2-Propanamine, N-methyl-N-nitroso-
α -D-Glucopyranoside, O- α -D-d-Mannose2-Propenoic acid, ethenyl ester
glucopyranosyl-(1.fwdarw. 3)- α -D-D-Streptamine, O-2-amino-2-deoxy- α -D-4-Aminoisoxazolidin-3-one
fructofuranosylglucopyranosyl-(14)-O-[O- 2,6-diamino-2,6-dideoxy- 6-Acetyl- α -d-mannose
Desulfosinigrinα -L-idopyranosyl-(13)- α -D- ribofuranosyl-(15)]-2-Acetic acid, 1-methylethyl ester
D-Glucose, 4-O- α -D-glucopyranosyl-deoxy-Carbonocyanidic acid, ethyl ester
d-Glycero-d-ido-heptoseEthanone, 1-(2-furanyl)-Dibutyl phthalate
DL-ArabinoseEthyl iso-allocholateGlycerin
FurfuralN-Methoxy-1-ribofuranosyl-4-imidazolecarboxylic Imidazole, 2-amino-5-[(2-carboxy) vinyl]-
Tetrahydropyrrole-3-amino-2,5-dioneamideIsosorbide Dinitrate
Uric acidN-Nitroso-2,4,4-trimethyloxazolidineLupeol
Pentanol, 5-amino-Oxirane, 2,3-dimethyl-, trans-
Hydrazinecarboxamide, Phthalic acid, butyl undecyl esterPentylamine, N-isobutyl-N-nitroso-
2-(2- methylcyclohexylidene)-Propanoic acid, 2-oxo-, methyl esterR-(-)-1,2-propanediol
Table 6

Phytochemicals that are retained, disappeared and newly formed as a result of fermentation of Chandanasava

Retained compoundsDisappeared compoundsNewly formed compounds
1,2,3-Benzenetriol1,2,3-Propanetriol, monoacetate1,2-Benzenediol
2,3-Butanediol, [S-(R*, R*)]-1,2,4-Benzenetriol1,2-Cyclopentanedione
2,5-Furandione, dihydro-3-methylene-1,3-Dioxol-2-one, 4,5-dimethyl-1,4-Anhydro-d-galactitol
2-Furancarboxaldehyde, 5-methyl-1,4-Dioxin, 2,3-dihydro-2,4-Dihydroxy-2,5-dimethyl-3 (2H)-
2-Furanmethanol1,6-Anhydro- α -D-glucopyranose (levoglucosan)furan-3-one
4H-Pyran-4-one, 2,3-dihydro-3,5-1-Isobutyl-7,7-dimethyl-octahydro-isobenzofuran- 3a-ol2,4-Hexanediol, 5-methyl-3-nitro-
dihydroxy-6-methyl-2,5-Dimethyl-4-hydroxy-3 (2H)-furanone2H-Pyran-2,6 (3H)-dione
4H-Pyran-4-one, 3,5-dihydroxy-2-methyl-2,5-Furandicarboxaldehyde2-Methoxy-4-vinylphenol
Benzeneethanol, 4-hydroxy-2,5-Methylene-d, l-rhamnitol3,4Dehydro-dl-proline
Diglycerol2-acetonyl-9-[3-deoxy-.beta.-d-ribouranosyl] hypoxanthine3-Furanacetic acid, 4-hexyl-2,5-
Glycerin2-Butanone, 4-methoxy-dihydro-2,5-dioxo-
Lactic acid2-Cyclopenten-1-one, 2-hydroxy-3-O-Methyl-d-glucose
Lactose2-Cyclopentene-1,4-dione4-(2-Hydroxyethyl) phenol
Squalene3-Deoxy-d-mannoic lactoneα-Copaen-11-ol
2-Furancarboxaldehyde,5-Hydrxoymethylfurfuralα -d-Lyxofuranoside, methyl
5- (hydroxymethyl)-5-Oxotetrahydrofuran-2-carboxylic acid, ethyl esterTrans-squalene
6-Acetyl-α -d-mannoseα -Sitosterol
Acetate, [4-hydroxy-4-(1-methylethyl)-5-methyl-2- hexynyl] esterBenzofuran, 2,3-dihydro-
α -D-Glucopyranoside, O-α -D-glucopyranosyl -(1.fwdarw. 3)- α -Carissanol
D- fructofuranosylCholesta-4,6-dien-3-ol, (3α)-
AndrographolideDianhydromannitol
d-Glycero-d-ido-heptosed-Mannitol, 1,4-anhydro-
Ether, 3-butenyl pentyld-Mannose
FurfuralErgost-5-en-3-ol, acetate, (3α,24R)-
Glucosamine, N-acetyl-N-benzoyl-Ethyl α -d-glucopyranoside
Glycero-d-ido-heptoseEthyl hydrogen succinate
Lactic acid, methyl esterIsosorbide
L-GlucoseL-xylose
Maltoln-Hexadecanoic acid
N-Nitroso-2,4,4-trimethyloxazolidinePhenol, 2,6-dimethoxy-
Tridecanoic acid, methyl esterPhenylethyl Alcohol
Stigmastan-3,5-diene
Stigmastan-6,22-dien, 3,5-
dedihydro-
Succinic anhydride
Phytochemicals that are retained, disappeared and newly formed as a result of fermentation of Balarishta Phytochemicals that are retained, disappeared and newly formed as a result of fermentation of Chandanasava

Antioxidant activity

Both Balarishta and Chandansava exhibited considerable antioxidant activities. It was assayed in terms of scavenging of free radicals (DPPH, HRSA, hydrogen peroxide, ABTS, nitric oxide and superoxide anion), inhibition of free radical generation by metal chelation [Table 7] and assessing the reducing power [Figure 4]. In DPPH assay, IC50 value of Balarishta (250.48 μl/ml) and Chandanasava (442.99 μl/ml) were higher when compared to the standard, L-ascorbic acid (210.31 μg/ml) [Table 7]. It indicated that Chandanasava has low DPPH scavenging activity compared to Balarishta. Similar trend was observed in hydroxyl, nitric oxide and superoxide anion radicals scavenging assays [Table 7]. However, in hydrogen peroxide scavenging assay, Chandanasava (56.57 μl/ml) performed better than Balarishta (69.22 μl/ml), yet their performance was less than the standard L-ascorbic acid (30.09 μg/ml). Similar trend was observed in ABTS scavenging and metal chelating assay also [Table 7]. However, the efficacy of Chandanasava in ABTS scavenging assay was comparable to the standard. In reducing power assay, both Balarishta and Chandasava were less compared to the standard. Among them, Balarishta exhibited better reducing power ability than Chandasava [Figure 4].
Table 7

Antioxidant activity of Balarishta and Chandanasava

AssaysIC50 value

Standard (µg/ml)Balarishta (µl/ml)Chandanasava (µl/ml)
Scavenging of free radicals
 DPPH210.31 (ascorbic acid)250.48442.99
 Hydroxyl radical30.31 (ascorbic acid)51.7667.62
 Hydrogen peroxide30.09 (ascorbic acid)69.2256.57
 ABTS28.50 (BHT)45.5526.35
 Nitric oxide29.00 (ascorbic acid)36.3052.95
 Superoxide anion25.08 (ascorbic acid)33.4536.74
Inhibition of free radical generation
Metal chelating22.75 (citric acid)63.4854.91

IC50 value was determined to be the effective concentration at which the particular free radical was scavenged by 50%. The IC50 value was obtained by linear-regression probit analysis. DPPH: 2,2-diphenyl-1-picrylhydrazyl, ABTS: 2,2’-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)

Figure 4

Reducing power of Balarishta and Chandanasava. Values are represented as mean ± standard error of mean (n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001 versus control. Ascorbic acid is the standard (μg/ml)

Antioxidant activity of Balarishta and Chandanasava IC50 value was determined to be the effective concentration at which the particular free radical was scavenged by 50%. The IC50 value was obtained by linear-regression probit analysis. DPPH: 2,2-diphenyl-1-picrylhydrazyl, ABTS: 2,2’-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) Reducing power of Balarishta and Chandanasava. Values are represented as mean ± standard error of mean (n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001 versus control. Ascorbic acid is the standard (μg/ml) It is important to note that CFSs of bacteria obtained from Balarishta and Chandansava also exhibited antioxidant property. However, the activity was less when compared to the standards in all the assays [Table 8]. In DPPH assay, among the bacterial isolates of Balarishta, BB-14 (62.6%) showed highest free radical scavenging ability. Similar trend was observed in hydroxyl radical scavenging assay also. In ABTS assay, BB-04 (75.56%) performed better in scavenging. In nitric oxide and metal chelating assays, BB-01 was better. Similarly, BB-24 was better in superoxide anion and reducing power [Table 8].
Table 8

Antioxidant activity of cell-free supernatant of bacteria isolated from Balarishta and Chandanasava

SamplesAntioxidants assay (%)

Scavenging of free radicalsInhibition of free radical generationH+ - donating ability Reducing power

DPPHHydroxyl radicalABTSNitric oxideSuper oxide anionMetal chelatingReducing power
Standard78.47±0.235 (AA 100 µg/ml)79.62±0.02 (AA 100 µg/ml)77.15±0.016 (BHT 100µg/ml)79.58±0.662 (AA 100 µg/ml)95.01±0.047 (AA 100 µg/ml)87.43±0.032 (CA 100 µg/ml)81.61±0.094 (AA 100 µg/ml)

Bacterial isolatesConcentration of culture filtrate

1 ml1 ml1 ml1 ml1 ml0.5 ml0.5 ml

Bacillus licheniformis BB-0152.69±0.39954.73±0.33554.41±0.04362.66±0.64973.91±0.09578.85±0.05834.03±0.184
Brevibacillus brevis BB-0246.03±0.04556.74±0.50463.67±0.34461.67±0.86774.68±0.33471.46±0.59638.30±0.040
Paenibacillus macreans BB-0361.78±0.14953.54±0.80472.82±1.05160.12±0.70876.33±0.17267.58±0.68640.60±0.126
Bacillus pumilus BB-0448.04±0.34155.35±0.61175.56±0.42761.76±0.70674.98±0.29058.65±0.74944.54±0.633
Bacillus subtilis BB-1462.60±0.26958.98±0.51159.62±0.51461.07±0.29876.14±0.31268.04±0.31939.49±0.228
Bacillus circulans BB-2452.66±0.32550.74±0.41462.47±0.55661.41±0.89176.69±1.50840.94±0.12044.76±0.938
Bacillus licheniformis CB-0164.32±0.23951.88±0.62942.32±0.81059.20±0.45868.70±0.31278.28±0.30245.32±0.051
Bacillus subtilis CB-0360.56±0.39961.34±0.53658.17±0.50460.14±0.59368.78±0.45579.64±0.89057.52±0.475
Paenibacillus polymyxa CB-0557.28±0.26059.47±0.77069.51±0.55260.33±0.26773.08±0.31274.24±0.75443.57±0.088
Bacillus coagulans CB-2466.86±0.53452.10±0.71575.62±0.22660.60±0.38770.90±1.57680.28±0.91545.10±0.203
Bacillus circulans CB-3170.03±0.57254.73±0.51162.52±0.58557.75±0.35273.99±0.25277.60±0.09361.26±0.088
Bacillus mycoides CB-5164.58±0.61350.92±0.00769.30±0.26955.71±0.18777.96±0.40778.72±0.13769.34±0.804

AA: Ascorbic Acid, BHT: Butylated hydroxyl toluene, CA: Citric acid. The presented values are expressed as mean±SEM of three independent experiments. DPPH: 2,2-diphenyl-1-picrylhydrazyl, ABTS: 2,2’-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid), SEM: Standard error of the mean

Antioxidant activity of cell-free supernatant of bacteria isolated from Balarishta and Chandanasava AA: Ascorbic Acid, BHT: Butylated hydroxyl toluene, CA: Citric acid. The presented values are expressed as mean±SEM of three independent experiments. DPPH: 2,2-diphenyl-1-picrylhydrazyl, ABTS: 2,2’-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid), SEM: Standard error of the mean In Chandanasava, scavenging of DPPH radical was better in CB-31 (70.03%). CB-03 showed better hydroxyl radical scavenging ability among the isolates. In ABTS, nitric oxide and metal chelating assays, CB-24 exhibited the highest activity followed by others [Table 8]. CB-51 had higher superoxide anion radical scavenging and H+ donating ability (reducing power).

Discussion

The profile of enumerated microorganisms reveals that yeasts and bacteria are the major players in the fermentation of both Balarishta and Chandanasava. The disappearance of filamentous fungi at the early stages of fermentation in both cases indicates that they have no role to play in the fermentation process. Moreover, yeasts are well known for their ability of alcohol production. It is possible that either yeasts or bacteria or their combination consortia could be the biocatalysts for the biotransformation of phytochemicals present in both preparations. It is important to note that there are two kinds of yeasts S. cerevisiae and S. pombe coupled with six different species of bacilli that are present in both Balarishta and Chandanasava. In this study, the profile of bacteria changes with the progression of fermentation. Although both yeasts are commonly present, the species of Bacillus showed dynamic changes during the course of fermentation. Similarly, in Kutajarishta, microbial composition at initial stages of fermentation was assessed by culture-independent 16S rDNA gene clone library approach.[14] At the initial stage of fermentation, Lactobacillus sp., Acinetobacter sp., Alcaligenes sp. and Methylobacterium sp. were recovered but were not detected on the eighth day of fermentation. Initially, microbial diversity increased after 8 days of fermentation with 11 Operational Taxonomic Units (OTUs), which further decreased to 3 OTUs at 30 days of fermentation. Aeromonas sp., Pseudomonas sp. and Klebsiella sp. dominated till the thirtieth day of fermentation. Herbal materials were indicated as a source of bacterial species.[46] Dried flower buds of W. fruticosa (an ingredient) were reported as a source of Aspergilus sp. cocci and rod-shaped bacilli[4] as well as Rhizopus nigricans and Aspergillus niger.[47] Addition of W. fruticosa was known to increase the content of alcohol.[4849] From commercial Nimbarishta, S. cerevisiae Hansen and S. pombe Lindner var. pombe were reported to be isolated.[6] Saccharomyces species were also isolated and characterized from Amritarishta.[4] Two species of yeasts were isolated from Dashamularishta along with Aspergillus and Bacillus species.[5] The phylogenetic analysis supported the identification of ancestral and closely related species of Saccharomyces, Schizosaccharomyces, and the different species of Bacillus, Paenibacillus or Brevibacillus in both Balarishta and Chandanasava. Qualitatively, Balarishta and Chandanasava have various secondary metabolites. Such phytochemical analysis in various Arishta and Asava indicated the presence of secondary plant metabolites such as phenols, flavonoids, terpenoids, glycosides, steroids, alkaloids, tannins, saponins and various alcohols and related compounds.[789101112131415] However, certain compounds such as flavonoids, saponins and phytosterols form at a later stage in the course of fermentation as evident in Balarishta and Chandanasava predicting the role of microorganisms present in. The plethora of chemicals present in the final product would also have been formed as a result of microbial biotransformation. It is supported by the observation that in Balarishta, 18 compounds disappeared as a result of fermentation while 23 compounds are newly formed. In addition, 19 compounds are retained from the beginning up to the final product. In the case of Chandanasava, 30 compounds disappeared as a result of fermentation while 32 compounds are newly formed. In addition to this, 14 compounds are retained from the beginning to the final product. Particularly, newly formed chemicals could have been formed from disappearing compounds or from the retained compounds In jujube Asava prepared in Japan, hydrolysis of glycosides is known as a result of fermentation (benzyl alcohol from zizybeoside I or II present in jujube).[50] In Abhayarishta, the major polyphenolics (Chebulagic and Chebulinic acid) were hydrolyzed to their respective monomers indicating biotransformation and consequently, there was an increase in the amount of chebulic acid, gallic acid, ellagic acid and ethyl gallate after fermentation.[18] In Jirakadyarishta, selective hydrolysis of 7-O-glucosides of luteolin and apigenin during fermentation resulted in an increase in the amount of luteolin and apigenin indicating biotransformation.[19] In Arjunarishta, the possible hydrolysis of ellagitannins and gallotannins during fermentation, resulting in an increase in the concentration of monomeric phenolics indicating biotransformation.[16] In our studies also, the possible biotransformation of phytochemicals and their reactions could be chemically assessed. In the case of Balarishta, for example, the formation of 2,3-butanediol from oxirane, 2,3-dimethyl-trans is feasible by hydroxylation. Similarly, the formation of three other biotransformed compounds in the final product could be chemically supported from the source compounds [Table 9]. It could be possible by reactions such as removal of water, hydrolysis of ester and reduction of the carbonyl group as warranted in the biotransformation reactions. Similarly, in the case of Chandanasava, the possible biotransformation of eight such phytochemicals with their reactions is indicated [Table 10]. Here also, chemical reactions involving removal of the hydroxyl group, ketoenol tautomerism, isomerization, deacetylation, ester hydrolysis etc., could be implicated as the basis for biotransformation reactions. Such reactions could have been mediated by the intrinsic microflora of microorganisms acquired during fermentation.
Table 9

Feasible biotransformation reactions in Balarishta based on the changes in the profile of compounds upon fermentation as identified by GC-MS analysis

Source compound (retained/disappeared/newly formed)Possible reaction(s)Biotransformed compound present in the final product
Oxirane, 2,3-dimethyl-, trans-Hydroxylation 2,3-Butanediol
1,2,3-Propanetriol, monoacetateRemoval of water 1,2-Epoxy-3-propyl acetate
1,2,3-Propanetriol, monoacetateHydrolysis of ester + Acetic acid Glycerin
Propanoic acid, 2-oxo-, methyl esterReduction of carbonyl group and hydrolysis of ester (S)-2-Hydroxypropanoic acid

GC-MS: Gas chromatography-mass spectrometry

Table 10

Feasible biotransformation reactions in Chandanasava based on the changes in the profile of compounds upon fermentation as identified by GC-MS analysis

Source compound (retained/disappeared/newly formed)Possible reaction(s)Biotransformed compound present in the final product
1,2,4-Benzenetriol or 1,2,3-BenzenetriolRemoval of hydroxyl group 1,2-Benzenediol
2-Cyclopenten-1-one, 2-hydroxy-Keto-enol tautomerism 1,2-Cyclopentanedione
4-(2-Hydroxyethyl) phenolRemoval of hydroxyl group Phenylethyl Alcohol
SqualeneConversion of CIS to trans isomer Trans squalene
6-Acetyl-β-d-mannoseDeacetylation d-Mannose
Succinic anhydrideAddition of ethanol Ethyl hydrogen succinate
Tridecanoic acid, methyl esterEster hydrolysis n-Hexadecanoic acid
Lactic acid methyl esterEster hydrolysis Lactic acid

GC-MS: Gas chromatography-mass spectrometry

Feasible biotransformation reactions in Balarishta based on the changes in the profile of compounds upon fermentation as identified by GC-MS analysis GC-MS: Gas chromatography-mass spectrometry Feasible biotransformation reactions in Chandanasava based on the changes in the profile of compounds upon fermentation as identified by GC-MS analysis GC-MS: Gas chromatography-mass spectrometry Antioxidants are molecules or systems that inhibit or quench free radicals or interrupt propagation of the free radicals generated by reactive species.[25] It is extensively reported that several diseases are caused due to the oxidative stress generated by reactive oxygen species (ROS). Endogenous antioxidants are very delicate because the imbalance between overproduction of ROS and less neutralization ability of free radicals which results cellular damage.[51] Researchers reported that synthetic antioxidants are helpful to inhibit the free radicals generation, but it causes side effects leading to several diseases.[25] In this regard, there is a need to search natural antioxidants which are believed to scavenge free radicals and also considered as safe. DPPH radical is a stable organic molecule and useful in the investigation of free radical scavenging by antioxidants and hence used primarily in the assay system.[52] Hydroxyl radicals are potent ROS that react with polyunsaturated fatty acid and moieties of cell membrane phospholipids and cause damage to cells.[53] Hydrogen peroxide generates extremely reactive hydroxyl radicals in the presence of transition metal ions such as iron and copper, rapidly cross the cell membranes and pose higher toxicity to cells.[24] ABTS radical scavenging activity is based on the transfer of hydrogen atoms and electrons.[45] Superoxide radicals are most harmful radical because they are the precursors for other major ROS.[45] Nitric oxide radical is generated from L-arginine metabolism by nitric oxide synthases and are toxic to biological tissues. The toxicity is increased, when NO radicals react with superoxide radical to form a highly reactive peroxynitrite anion (ONOO−).[52] Reduction of Fe3+ to Fe2+ indicates the presence of reductones (antioxidants) which reflects scavenging of free radicals by donating a hydrogen atom.[54] Iron is vital for carrying oxygen, respiration and for enzymatic activity. It can initiate lipid peroxidation by Haber–Weiss and Fenton reactions leading to the generation of superoxide anion and hydroxyl radicals.[53] Ferrous ion chelating agents inhibit lipid peroxidation (by stabilization of transition metal), free radical generation, and resultant oxidative damage.[54] Both the Arishta/Asava and bacterial CFS exhibited good amount of antioxidant activity in terms of scavenging the free radicals in the assay systems such as DPPH, hydroxyl, hydrogen peroxide, ABTS, nitric oxide and superoxide anion in addition to metal chelating and reducing power. The profile of phytochemicals present in both Balarishta and Chandanasava such as phenolic compounds, tannins, flavonoids and phytosterol can harbor antioxidant compounds. GC-MS analysis also showed the presence of antioxidant compounds such as squalene, trans-squalene and lupeol (triterpenes), ß-sitosterol, (20R)-cholest-4-en-3-on, stigmasterol (phytosterols), 2-methoxy-4-vinylphenol (phenolics) and n-hexadecanoic acid (saturated fatty acid). ROS, reactive nitrogen species and reactive sulfur species have been linked to several diseases such as cancer, atherosclerosis, stroke, neurological disorders, renal disorders, rheumatoid arthritis, autoimmune diseases, inflammation and gastric ulcers.[51] The antioxidant activity of Balarishta and Chandanasava was found to be less compared to the standards. It could be explained that standards are pure chemical forms, but the Balarishta and Chandanasava are chemically heterogeneous in nature. Moreover, the recommended dosage of consumption is around 15-30 ml twice per day. This may provide a considerable antioxidant support to the consumer of such Arishta and Asava.[2324] Interestingly, the intrinsic microbes involved in the fermentation of Balarishta and Chandanasava also contribute for the antioxidant property of these medicines.[42] This will explain the traditional claim on the medicinal properties of Balarishta and Chandanasava. In addition to this, antioxidant compounds such as lupeol present in Balarishta also demonstrated to exhibit bioactivities such as anti-inflammatory (ameliorates rheumatism), anti-arthritic (ameliorates autoimmunity),[55] anti-ulcerogenic action (ameliorates gastric problems) and antinociceptive (ameliorates nervous disorders).[56] Presence of such compounds additionally reasons out the therapeutic property of such Arishta. The better shelf-life-enhanced therapeutic properties, improvement in the extraction of drug molecules from the herbs and improvement in drug delivery of Arishta and Asava could be ascribed to the fermentation and biotransformation reactions mediated by the intrinsic microflora of these FTM. They also contribute to the antioxidant property of these medicines likely by the generation and sequestration of specific compounds. The plant materials act as a source of bioactive phytochemicals but microbes contribute for the increase in the bioactivity like antioxidant property.

Conclusion

The study indicated the presence of intrinsic microbes such as yeasts and bacilli that collectively function as a consortium. Dynamic changes in the profile of microbiota do occur during the course of this fermentation. These intrinsic microbes not only mediate fermentation but also perform biotransformation of phytochemicals. The profiles of phytochemicals are proven antioxidants. Moreover, the bacterial supernatants also exhibit antioxidant activity. Thus, the intrinsic microbes additionally contribute to the therapeutic efficacy of Arishta and Asava. Further studies are essential to demonstrate that the intrinsic microbes secrete specific compounds and contribute to the medicinal activities.

Financial support and sponsorship

The authors thank Bharathidasan University, Tiruchirappalli, India for the facilities and award of UGC for RGNF fellowship to AV. Authors are indebted to TN. Narayanan Varier and TR. Sasi Varier of Ashtanga Ayurvedics (P) Ltd, Tiruchirappalli, India.

Conflicts of interest

There are no conflicts of interest.
  19 in total

1.  Basic local alignment search tool.

Authors:  S F Altschul; W Gish; W Miller; E W Myers; D J Lipman
Journal:  J Mol Biol       Date:  1990-10-05       Impact factor: 5.469

2.  In vitro antioxidant and free radical scavenging activity of Nardostachys jatamansi DC.

Authors:  Surendra Kumar Sharma; Ajay Pal Singh
Journal:  J Acupunct Meridian Stud       Date:  2012-04-10

Review 3.  A review on antioxidants, prooxidants and related controversy: natural and synthetic compounds, screening and analysis methodologies and future perspectives.

Authors:  Márcio Carocho; Isabel C F R Ferreira
Journal:  Food Chem Toxicol       Date:  2012-09-24       Impact factor: 6.023

4.  Dichloran as an inhibitor of mold spreading in fungal plating media: effects on colony diameter and enumeration.

Authors:  O E Henson
Journal:  Appl Environ Microbiol       Date:  1981-10       Impact factor: 4.792

5.  Chemical changes during fermentation of Abhayarishta and its standardization by HPLC-DAD.

Authors:  Uma Ranjan Lal; Shailendra Mani Tripathi; Sanjay M Jachak; Kamlesh Kumar Bhutani; Inder Pal Singh
Journal:  Nat Prod Commun       Date:  2010-04       Impact factor: 0.986

6.  Anti-inflammatory activity of lupeol and lupeol linoleate in rats.

Authors:  T Geetha; P Varalakshmi
Journal:  J Ethnopharmacol       Date:  2001-06       Impact factor: 4.360

7.  RP-HPLC analysis of Jirakadyarishta and chemical changes during fermentation.

Authors:  Uma Ranjan Lal; Shailendra Mani Tripathi; Sanjay M Jachak; Kamlesh Kumar Bhutani; Inder Pal Singh
Journal:  Nat Prod Commun       Date:  2010-11       Impact factor: 0.986

8.  In vitro antioxidant and antimicrobial activities of Merremia emarginata using thio glycolic acid-capped cadmium telluride quantum dots.

Authors:  A Rameshkumar; T Sivasudha; R Jeyadevi; B Sangeetha; D Arul Ananth; G Smilin Bell Aseervatham; N Nagarajan; R Renganathan; A Kathiravan
Journal:  Colloids Surf B Biointerfaces       Date:  2012-06-07       Impact factor: 5.268

9.  Experimental studies on the fermentation of aravindasava.

Authors:  M Alam; K K Dasan; B Rukmani; H Veni; R G Purushothaman; K K Purushothaman
Journal:  Anc Sci Life       Date:  1986-04

10.  Simple spectrophotometric methods for standardizing ayurvedic formulation.

Authors:  N Vador; B Vador; Rupali Hole
Journal:  Indian J Pharm Sci       Date:  2012-03       Impact factor: 0.975

View more
  1 in total

1.  Protocol based management of common sports injuries by integrated approach of Sandhi Marmabhighata - An open labeled clinical trial.

Authors:  Sudhanshu Sharma; Ramesh Killedar; Deepti Bagewadi; Pradeep Shindhe
Journal:  J Ayurveda Integr Med       Date:  2021-02-05
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.