Literature DB >> 30957634

The PARK10 gene USP24 is a negative regulator of autophagy and ULK1 protein stability.

Julia A Thayer1, Ola Awad2, Nivedita Hegdekar1, Chinmoy Sarkar1, Henok Tesfay1, Cameran Burt1, Xianmin Zeng3, Ricardo A Feldman2, Marta M Lipinski1,4.   

Abstract

Recent studies indicate a causative relationship between defects in autophagy and dopaminergic neuron degeneration in Parkinson disease (PD). However, it is not fully understood how autophagy is regulated in the context of PD. Here we identify USP24 (ubiquitin specific peptidase 24), a gene located in the PARK10 (Parkinson disease 10 [susceptibility]) locus associated with late onset PD, as a novel negative regulator of autophagy. Our data indicate that USP24 regulates autophagy by affecting ubiquitination and stability of the ULK1 protein. Knockdown of USP24 in cell lines and in human induced-pluripotent stem cells (iPSC) differentiated into dopaminergic neurons resulted in elevated ULK1 protein levels and increased autophagy flux in a manner independent of MTORC1 but dependent on the class III phosphatidylinositol 3-kinase (PtdIns3K) activity. Surprisingly, USP24 knockdown also improved neurite extension and/or maintenance in aged iPSC-derived dopaminergic neurons. Furthermore, we observed elevated levels of USP24 in the substantia nigra of a subpopulation of idiopathic PD patients, suggesting that USP24 may negatively regulate autophagy in PD.Abbreviations: Bafilomycin/BafA: bafilomycin A1; DUB: deubiquitinating enzyme; iPSC: induced pluripotent stem cells; MTOR: mechanistic target of rapamycin kinase; MTORC1: MTOR complex 1; nt: non-targeting; PD: Parkinson disease; p-ATG13: phospho-ATG13; PtdIns3P: phosphatidylinositol 3-phosphate; RPS6: ribosomal protein S6; SNPs: single nucleotide polymorphisms; TH: tyrosine hydroxylase; USP24: ubiquitin specific peptidase 24.

Entities:  

Keywords:  Autophagy; Parkinson disease; USP24; dopaminergic neurons; induced-pluripotent stem cells

Mesh:

Substances:

Year:  2019        PMID: 30957634      PMCID: PMC6984603          DOI: 10.1080/15548627.2019.1598754

Source DB:  PubMed          Journal:  Autophagy        ISSN: 1554-8627            Impact factor:   16.016


Introduction

Macroautophagy (from here referred to as autophagy) is a catabolic process mediating turnover of bulk cytoplasmic constituents including organelles and protein aggregates in a lysosome-dependent manner [1]. Although under some circumstances, especially when lysosomal degradation is blocked, autophagy may contribute to cell death [1], under most physiological and pathological conditions it is a protective mechanism. In fact, autophagy has been shown to play an essential function in protecting organisms from a variety of diseases, including neurodegeneration [2,3] and aging [4]. Parkinson disease (PD) is the second most common age-associated neurodegenerative disease. It is caused by progressive degeneration and death of dopaminergic neurons in the substantia nigra [5] leading to disruption of motor control and manifestations such as tremors, bradykinesia and gait dysfunction [6]. Recent studies indicate a causative relationship between defects in autophagy and PD. In animal models inhibition of autophagy in dopaminergic neurons causes protein aggregation and progressive neuronal loss, leading to decrease in dopamine levels and age-dependent motor deficits [7,8]. Furthermore, dopaminergic neurons with inhibited autophagy become sensitized to stress conditions, which may contribute to PD-like symptoms induced by drugs and environmental toxins [9]. On the other hand, increasing autophagy in dopaminergic neurons is protective in both genetic and neurotoxin-induced PD models [10,11]. Consistent with these data, defects in autophagy are observed in both idiopathic and familial PD patients. Wild-type forms of several genes involved in familial PD, including PRKN/PARK2 (parkin RBR E3 ubiquitin protein ligase), PINK1, LRRK2 and SNCA/α-synuclein [12-16] regulate autophagy. Conversely, disease associated mutations in many of these genes directly lead to autophagy defects. This is thought to contribute to accumulation of pathological protein aggregates and defective organelles such as depolarized mitochondria, and subsequent neuronal cell death [17]. Thus, modulation of autophagy represents an attractive prevention and intervention strategy against PD. However, better understanding of the mechanisms contributing to perturbation of autophagy in both familial and idiopathic PD will be necessary for development of safe and effective treatments. USP24 (ubiquitin specific peptidase 24) is a poorly characterized gene located on chromosome 1p in the PARK10 (Parkinson disease 10 [susceptibility]) locus associated with late-onset PD [18-22]. Consistent with a potential function for USP24 in PD, non-synonymous single nucleotide polymorphisms (SNPs) in the coding region of this gene affect predisposition to and/or age of onset of PD in diverse populations [20-22]. Based on its sequence, USP24 protein is a deubiqiuitinating enzyme (DUB). Recent data indicate that it may be involved in regulation of DNA damage responses in cancer cells, at least in part by regulating protein stability of p53 [23,24]. However, the mechanism by which USP24 or the PARK10 locus may affect predisposition to PD remains unknown. In a high-throughput screen of human genome-wide siRNA library we previously identified USP24 as one of the candidate genes involved in mediation and regulation of cellular autophagy [25,26]. Here we demonstrate that USP24 is a negative regulator of autophagy flux. Our data indicate that inhibition of USP24 results in increased stability of the ULK1 (unc-51 like autophagy activating kinase 1) protein, an essential autophagy mediator downstream of MTOR and the adenosine monophosphate-activated protein kinase (AMPK) [27-29]. Increased ULK1 kinase complex activity in turn results in augmented activity of the class III phosphatidylinositol 3-kinase (PtdIns3K) and increased autophagy flux. Importantly, USP24 is able to regulate autophagy in many cell types, including human dopaminergic neurons derived from induced-pluripotent stem cells (iPSC), the cell type most affected in PD. Furthermore, our data demonstrate elevated levels of USP24 in some cases of idiopathic PD, suggesting that USP24 may negatively regulate autophagy in PD.

Results

Ubiquitin-specific peptidase 24 (USP24) is a negative regulator of autophagy

In order to identify genes regulating and mediating mammalian autophagy, we previously performed a high-throughput screen of human genome-wide siRNA library. We identified a total of 236 genes, whose knockdown led to increase or decrease in the levels of cellular autophagy based on quantification of the GFP-LC3 puncta [25,26]. One of the identified hits was the PARK10 gene USP24. The extent of autophagosome accumulation following USP24 knockdown was similar to that observed after knockdown of the known negative regulator of autophagy, MTOR (mechanistic target of rapamycin kinase), suggesting USP24 as a putative negative regulator of autophagy (Figure S1(a)). In order to confirm the screen data, we used three independent siRNAs to knockdown USP24 in human H4 neuroglioma cells. All three siRNAs led to significant decrease in USP24 mRNA (Figure 1(a-b)) and protein expression as compared to non-targeting (nt) siRNA control (Figure 1(c-d)). Knockdown of USP24 also led to increase in levels of the autophagosome-associated lipidated form of LC3 (LC3-II) [30] (Figure 1(c,e)), confirming increase in autophagy. None of the USP24 siRNAs caused decrease in cell viability as compared to nt, suggesting induction of autophagy following knockdown of USP24 is not associated with cell death (Figure S1(b-c)). In agreement with previous reports indicating that USP24 may de-ubiquitinate the pro-apoptotic BH3 protein BAX [31], we also observed a decrease in BAX protein levels in USP24 knockdown cells (Figure S1(d-e)). Similar data were obtained in HeLa and HEK 293 cells (data not shown).
Figure 1.

USP24 is a negative regulator of autophagy. (a) Semi-quantitative RT-PCR demonstrating knockdown of USP24 mRNA with 3 independent siRNA oligonucleotides (# 3, 6, 7, nt – non-targeting siRNA control) in H4 cells 72h after transfection. (b) Quantification of USP24:ACTB from figure (a). (c) Western blot demonstrating decreased USP24 protein levels and accumulation of LC3-II following USP24 knockdown in H4 cells. (d) Quantification of USP24:ACTB from figure (c). (e) Quantification of LC3-II:ACTB from figure (c). (f) Representative images of stable GFP-LC3 expressing H4 cells 72h following USP24 siRNA knockdown demonstrating accumulation of GFP-LC3 positive autophagosomes. Images were acquired at 20X; bar: 25 μm. (g) Quantification of autophagosome intensity per cell area from figure (f). All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n = 4–18 (median cell number 568.5/group).

USP24 is a negative regulator of autophagy. (a) Semi-quantitative RT-PCR demonstrating knockdown of USP24 mRNA with 3 independent siRNA oligonucleotides (# 3, 6, 7, nt – non-targeting siRNA control) in H4 cells 72h after transfection. (b) Quantification of USP24:ACTB from figure (a). (c) Western blot demonstrating decreased USP24 protein levels and accumulation of LC3-II following USP24 knockdown in H4 cells. (d) Quantification of USP24:ACTB from figure (c). (e) Quantification of LC3-II:ACTB from figure (c). (f) Representative images of stable GFP-LC3 expressing H4 cells 72h following USP24 siRNA knockdown demonstrating accumulation of GFP-LC3 positive autophagosomes. Images were acquired at 20X; bar: 25 μm. (g) Quantification of autophagosome intensity per cell area from figure (f). All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n = 4–18 (median cell number 568.5/group). The ability of USP24 to regulate autophagy was confirmed in H4 cells stably expressing the GFP-LC3 reporter. Similar to MTOR, knockdown of USP24 led to significant accumulation of GFP-LC3 positive autophagosomes as compared to nt controls (Figures 1(f-g) and S1(f)). As a control for dependence of GFP-LC3 puncta formation on autophagy machinery, knockdown of the essential autophagy mediator ATG5 significantly decreased the GFP-LC3 autophagosomes. (Figures 1(g) and S1(f)). These data confirm that USP24 is a negative regulator of autophagy in mammalian cells.

USP24 regulates autophagy flux upstream of lysosomes

Accumulation of autophagosomes can be caused by an increase in autophagy initiation or a result of decrease in autophagosome degradation [30]. In order to distinguish between these two possibilities, we performed an autophagy flux assay using lysosomal ATPase inhibitor, bafilomycin A1 (bafilomycin), which blocks lysosomal acidification. USP24 knockdown led to an increase in LC3-II levels as compared to nt control, that were further augmented by bafilomycin treatment (100 nM for 2 or 4 h) (Figures 2(a-b) and S2(a-b)). These data suggest that USP24 knockdown increases formation of autophagosomes upstream of the lysosomes.
Figure 2.

USP24 regulates autophagy flux upstream of the lysosomes. (a) Accumulation of LC3-II following USP24 knockdown is further increased in the presence of autophagy inhibitor bafilomycin (BafA). H4 cells were transfected with indicated siRNA for 72h and treated with BafA (100 nM) for 4–6 h; nt – non-targeting siRNA. (b) Quantification of LC3-II:ACTB from figure (a). (c) Representative images of H4 GFP-LC3 cells following USP24 knockdown ± BafA treatment demonstrating increased accumulation of GFP-LC3 autophagosomes. Images were acquired at 20X; bar: 25 μm. (d) Quantification of autophagosome intensity from figure (c). (e) Rate of autophagosome-lysosome fusion in increased following USP24 knockdown. Representative images of stable H4 mCHerry-GFP-LC3 dual reporter cells with USP24 knockdown, ± bafilomycin treatment. pH neutral autophagosomes are positive for both GFP and mCherry; acidified autolysosomes are positive for mCherry only. Treatment with BafA was used as a control for dependence on lysosomal acidification. Images were acquired at 60X; bar: 10 μm (f) Quantification of mCherry:GFP intensity from figure (e). Increased mCherry:GFP ratio is indicative of higher autophagy flux. (g) Stability assay demonstrating increased rate of SQSTM1 (p62) protein degradation in cells with USP24 knockdown. Cells were treated with cycloheximide (50 μg/μL) to inhibit protein synthesis. (h) Quantification of SQSTM1:ACTB from figure (g), for the 3-hour time point. All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n = 4–9 (median cell number for 20X images 568.5/group median cell number for 60X images 21.5/group).

USP24 regulates autophagy flux upstream of the lysosomes. (a) Accumulation of LC3-II following USP24 knockdown is further increased in the presence of autophagy inhibitor bafilomycin (BafA). H4 cells were transfected with indicated siRNA for 72h and treated with BafA (100 nM) for 4–6 h; nt – non-targeting siRNA. (b) Quantification of LC3-II:ACTB from figure (a). (c) Representative images of H4 GFP-LC3 cells following USP24 knockdown ± BafA treatment demonstrating increased accumulation of GFP-LC3 autophagosomes. Images were acquired at 20X; bar: 25 μm. (d) Quantification of autophagosome intensity from figure (c). (e) Rate of autophagosome-lysosome fusion in increased following USP24 knockdown. Representative images of stable H4 mCHerry-GFP-LC3 dual reporter cells with USP24 knockdown, ± bafilomycin treatment. pH neutral autophagosomes are positive for both GFP and mCherry; acidified autolysosomes are positive for mCherry only. Treatment with BafA was used as a control for dependence on lysosomal acidification. Images were acquired at 60X; bar: 10 μm (f) Quantification of mCherry:GFP intensity from figure (e). Increased mCherry:GFP ratio is indicative of higher autophagy flux. (g) Stability assay demonstrating increased rate of SQSTM1 (p62) protein degradation in cells with USP24 knockdown. Cells were treated with cycloheximide (50 μg/μL) to inhibit protein synthesis. (h) Quantification of SQSTM1:ACTB from figure (g), for the 3-hour time point. All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n = 4–9 (median cell number for 20X images 568.5/group median cell number for 60X images 21.5/group). We confirmed results of the flux assay in H4 GFP-LC3 cells. Blocking lysosomal function with bafilomycin led to significant increase in accumulation of GFP-LC3 positive autophagosomes in USP24 knockdown cells, indicating that USP24 is negatively regulating autophagy flux without affecting lysosomal degradation (Figure 2(c-d)). Additionally, we used a tandem mCherry-GFP-LC3 reporter to evaluate autophagy flux. This assay takes advantage of the fact that GFP but not mCherry fluorescence is pH sensitive. Therefore, while pH-neutral autophagosomes are both red and green, pH drop upon fusion with lysosomes causes quenching of the GFP signal and appearance of red-only autolysosomes. USP24 knockdown resulted in significant increase in the ratio of mCherry to GFP signal as compared to nt controls, indicating increased conversion of autophagosomes to autolysosomes (Figure 2(e-f)). This was prevented by addition of bafilomycin, confirming dependence on low lysosomal pH. Finally, we evaluated the ability of USP24 knockdown to increase autophagic degradation. Knockdown of USP24 increased the rate of degradation of the autophagy adaptor protein SQSTM1/p62 (Figure 2(g-h)). It also decreased steady state protein levels of SQSTM1 and OPTN, as assessed by western blot and immunofluorescence (Figure S2(c-f)). Decrease in SQSTM1 levels following USP24 knockdown was attenuated in the presence of bafilomycin, confirming dependence on lysosomal degradation (Figure 2S(g-h)). SQSTM1 mRNA levels were not altered in USP24 knockdown cells (Figure S2(i)). All together our data identify USP24 as a negative regulator of autophagy flux.

p53 is not required for regulation of autophagy by USP24

USP24 has been reported to deubiquitinate p53 and thus regulate cellular response to DNA damage [24]. Since p53 can be involved in the regulation of autophagy [32], we investigated whether p53 is necessary for regulation of autophagy by USP24. Knockdown of USP24 failed to prevent stabilization of p53 following etoposide treatment of H4 cells (Figure S3(a)), suggesting that in this cell type USP24 may be dispensable for DNA damage responses or that the very low residual USP24 protein may be sufficient. Levels of TP53 mRNA were also not affected by USP24 knockdown (Figure S3(b)). To determine if USP24 can regulate autophagy in the absence of p53, we used TP53 deficient K562 human myelogenous leukemia cells. Following USP24 knockdown we observed an increase in the LC3-II levels as well as a decrease in SQSTM1 (Figure S3(c-d)). Accumulation of LC3-II was further enhanced following lysosomal inhibition with bafilomycin (Figure S3(c-d)). Therefore, p53 is not required for induction of autophagy following USP24 knockdown.

USP24 regulates autophagy upstream of the class III PtdIns3K

MTOR complex 1 (MTORC1) kinase is an upstream negative regulator of autophagy in response to nutrient deprivation and other extracellular stimuli [33]. In order to determine whether USP24 functions upstream or downstream of MTOR, we investigated the effects of USP24 knockdown on phosphorylation of the MTORC1 target, the ribosomal protein S6 (RPS6). Unlike MTOR, knockdown of USP24 failed to affect intensity of immunostaining with antibodies against phospho-RPS6 (Figure 3(a-b)). Similar results were obtained by western blot against phospho-RPS6 (Figure S4(a)), suggesting that USP24 regulates autophagy downstream or independently of the MTORC1 complex. Knockdown of USP24 was also unable to further increase levels of autophagy in cells treated with MTOR inhibitor, rapamycin (100 nM for 4 hours) (Figure S4(b-c)), consistent with function downstream of MTOR.
Figure 3.

USP24 regulates the class III PtdIns3K activity. (a) Representative images of phosopho-RPS6 (P-RPS6) staining in H4 cells following USP24 knockdown, MTOR knockdown, or treatment with 100 nM rapamycin, demonstrating that USP24 does not regulate MTORC1 activity. (b) Quantification of P-RPS6 intensity from (a) (2 independent experiments, 6–12 replicates). (c) Representative images of H4 cells stably expressing the FYVE-dsRed reporter following USP24 knockdown, demonstrating increased accumulation of the class III PtdIns3K product, PtdIns3P. All images were acquired at 20X; bar: 25 μm. (d) Quantification of FYVE-dsRed accumulation in cells with USP24 knockdown from a representative experiment (4–8 replicates). (e) Western blot demonstrating that LC3-II accumulation in USP24 knockdown cells is attenuated following inhibition of the class III PtdIns3K with spautin (20 μM). (f) Quantification of LC3-II:ACTB from figure (e). (g) Representative fluorescence images demonstrating attenuated accumulation of autophagosomes in H4 GFP-LC3 cells with USP24 knockdown after spautin treatment. All images were acquired at 20X; bar: 25 μm. (h) Quantification of autophagosome intensity from figure (g). All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n = 3–8 (median cell number 421/group).

USP24 regulates the class III PtdIns3K activity. (a) Representative images of phosopho-RPS6 (P-RPS6) staining in H4 cells following USP24 knockdown, MTOR knockdown, or treatment with 100 nM rapamycin, demonstrating that USP24 does not regulate MTORC1 activity. (b) Quantification of P-RPS6 intensity from (a) (2 independent experiments, 6–12 replicates). (c) Representative images of H4 cells stably expressing the FYVE-dsRed reporter following USP24 knockdown, demonstrating increased accumulation of the class III PtdIns3K product, PtdIns3P. All images were acquired at 20X; bar: 25 μm. (d) Quantification of FYVE-dsRed accumulation in cells with USP24 knockdown from a representative experiment (4–8 replicates). (e) Western blot demonstrating that LC3-II accumulation in USP24 knockdown cells is attenuated following inhibition of the class III PtdIns3K with spautin (20 μM). (f) Quantification of LC3-II:ACTB from figure (e). (g) Representative fluorescence images demonstrating attenuated accumulation of autophagosomes in H4 GFP-LC3 cells with USP24 knockdown after spautin treatment. All images were acquired at 20X; bar: 25 μm. (h) Quantification of autophagosome intensity from figure (g). All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n = 3–8 (median cell number 421/group). The class III PtdIns3K is an essential upstream regulator of cellular autophagy [1]. Its activity is negatively regulated by MTORC1 and is necessary for autophagosome formation. In order to investigate the effect of USP24 on class III PtdIns3K activity, we utilized H4 cells stably expressing FYVE-dsRED reporter, which binds the class III PtdIns3K product, phosphatidylinositol 3-phosphate (PtdIns3P). USP24 knockdown lead to a significant increase in FYVE-dsRed puncta formation as compared to nt control (Figures 3(c-d) and S4(d)). These data suggest that USP24 knockdown stimulates PtdIns3P production. To determine if activity of the class III PtdIns3K is necessary for the ability of USP24 to regulate autophagy, we treated H4 cells with inhibitors of the class III PtdIns3K activity, spautin and 3-MA. USP24 knockdown lead to increase in the LC3-II levels, which was attenuated in the presence of spautin (20 μM for 5 hours) (Figure 3(e-f)) or 3-MA (10 mM for 5 hours) (Figure S4(e)). This was further confirmed by imaging of H4 GFP-LC3 cells, where spautin treatment prevented accumulation of GFP-LC3 positive autophagosomes following USP24 knockdown (Figure 3(g-h)). Consistently, in the original screen [25] USP24 knockdown failed to upregulate autophagy in cells overexpressing BCL-2, which binds and inhibits activity of the class III PtdIns3K subunit BECN1 [34] (Figure S4(f)). Together, our data indicate that USP24 regulates autophagy via the class III PtdIns3K but downstream or independently of MTOR.

USP24 regulates stability and activity of ULK1

Since USP24 is a deubiquitinating enzyme, we hypothesized that it may regulate activity of the class III PtdIns3K by affecting the stability of its components. However, we did not detect any changes in protein expression levels of any of the core components of the class III PtdIns3K complex (BECN1, PIK3C3/VPS34, ATG14, data not shown) upon USP24 knockdown. Since stability of the subunits of this complex is coordinately regulated [35], it is unlikely that levels of other components are significantly affected by USP24. The class III PtdIns3K activity can be positively regulated by the ULK1 protein kinase complex, an essential mediator of autophagy downstream of the MTOR and AMPK pathways [27-29]. Consistent with the involvement of this kinase, knockdown of USP24 led to increase in the levels of the ULK1 protein (Figure 4(a-b)). Additionally, we detected increased auto-phosphorylation of the complex subunit ATG13 (Figure 4(a,c)), indicating increased kinase activity of the ULK1 complex upon USP24 knockdown.
Figure 4.

USP24 regulates protein stability of ULK1. (a) Western blot demonstrating increased levels of ULK1 and phospho-ATG13 (P-ATG13) in cells with USP24 knockdown. (b) Quantification of ULK1:ACTB from figure (a). (c) Quantification of P-ATG13:ACTB from figure (a). (d) Real time q-PCR quantification of ULK1:GAPDH mRNA expression following USP24 knockdown (e) Protein stability assay illustrating that USP24 knockdown decreases the rate of ULK1 degradation. Cells were treated with cycloheximide (50μg/μL) to inhibit protein synthesis. (f) Quantification of ULK1:ACTB from figure (e) at 0 and 3-hour time points. (g) IP demonstrating increased ubiquitination of ULK1 after USP24 knockdown. (h) Quantification of the ubiquitin (HA):ULK1 in figure (g). (i) Western blot demonstrating decreased levels of LC3-II in H4 cells with USP24 knockdown treated with ULK1 inhibitor MRT67307 (10 μM, 4 h) and BafA (100 nM, 3 h), as compared to BafA treatment alone. (j) Quantification of LC3-II:ACTB in BafA and BafA+MRT67307 conditions from figure (i). (k) Western blot demonstrating decreased levels of LC3-II in Hela cells with USP24 knockdown treated with MRT67307 (10 μM, 4 h) and BafA (100 nM, 3 h) as compared to BafA treatment alone. (l) Quantification of LC3-II:ACTB in BafA and BafA+MRT67307 conditions from figure (k). (m) Representative fluorescent images demonstrating attenuated accumulation of autophagosomes in H4 GFP-LC3 cells with USP24 knockdown after MRT68921 treatment. All images were acquired at 20X; bar: 25 μm. (n) Quantification of autophagosome intensity from figure (m). All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n = 3–14 (median cell number 43/group).

USP24 regulates protein stability of ULK1. (a) Western blot demonstrating increased levels of ULK1 and phospho-ATG13 (P-ATG13) in cells with USP24 knockdown. (b) Quantification of ULK1:ACTB from figure (a). (c) Quantification of P-ATG13:ACTB from figure (a). (d) Real time q-PCR quantification of ULK1:GAPDH mRNA expression following USP24 knockdown (e) Protein stability assay illustrating that USP24 knockdown decreases the rate of ULK1 degradation. Cells were treated with cycloheximide (50μg/μL) to inhibit protein synthesis. (f) Quantification of ULK1:ACTB from figure (e) at 0 and 3-hour time points. (g) IP demonstrating increased ubiquitination of ULK1 after USP24 knockdown. (h) Quantification of the ubiquitin (HA):ULK1 in figure (g). (i) Western blot demonstrating decreased levels of LC3-II in H4 cells with USP24 knockdown treated with ULK1 inhibitor MRT67307 (10 μM, 4 h) and BafA (100 nM, 3 h), as compared to BafA treatment alone. (j) Quantification of LC3-II:ACTB in BafA and BafA+MRT67307 conditions from figure (i). (k) Western blot demonstrating decreased levels of LC3-II in Hela cells with USP24 knockdown treated with MRT67307 (10 μM, 4 h) and BafA (100 nM, 3 h) as compared to BafA treatment alone. (l) Quantification of LC3-II:ACTB in BafA and BafA+MRT67307 conditions from figure (k). (m) Representative fluorescent images demonstrating attenuated accumulation of autophagosomes in H4 GFP-LC3 cells with USP24 knockdown after MRT68921 treatment. All images were acquired at 20X; bar: 25 μm. (n) Quantification of autophagosome intensity from figure (m). All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n = 3–14 (median cell number 43/group). Real time qPCR data revealed no significant change in ULK1 mRNA levels following knockdown of USP24. In fact, we observed a trend towards lower ULK1 mRNA levels in USP24 knockdown cells, however this failed to reach significance (p = 0.21, Figure 4(d)). These data indicate that the observed increase in ULK1 protein levels following USP24 knockdown is not due to transcriptional upregulation. To determine whether increase in the ULK1 protein is caused by its increased stability, we investigated the rate of its degradation. USP24 knockdown decreased degradation of the ULK1 protein in the presence of protein synthesis inhibitor, cycloheximide (Figure 4(e-f)). Therefore, stability of ULK1 protein increases in the absence of USP24. ULK1 protein stability and activity are positively regulated by TRAF6-dependent K63 ubiquitination [36]. To determine if USP24 may affect ULK1 ubiquitination we immunoprecipitated myc-tagged ULK1 from HeLa cells co-expressing HA-tagged ubiquitin. We detected increased levels of ULK1 ubiquitination following USP24 knockdown as compared to nt controls (Figure 4(g-h)). These data suggest USP24 regulates ULK1 protein stability by affecting its ubiquitination. To verify that the ability of USP24 to regulate autophagy is dependent on ULK1 function, we treated H4 cells with inhibitors of ULK1 kinase activity, MRT67307 or MRT68921 [28]. As expected, both drugs decreased ULK1 activity as assessed by ATG13 phosphorylation (Figure S4(g)). Both inhibitors attenuated induction of autophagy following USP24 knockdown (Figures 4(i-j) and S4(h-i)) as assessed by LC3-II western blot, confirming that ULK1 activity was required. Similar data were obtained in HeLa cells (Figure 4(k-l)). Furthermore, MRT68921 attenuated accumulation of autophagosomes in USP24 knockdown GFP-LC3 H4 cells (Figure 4(m-n)), further confirming dependence on ULK1 activity.

USP24 can regulate autophagy in human dopaminergic neurons

Our data indicate that USP24 is a negative regulator of autophagy. To determine if this may be relevant to PD, we assessed the ability of USP24 to regulate autophagy in iPSC-derived dopaminergic neurons, the cell type most relevant to PD [37-39]. Transduction of iPSC-derived dopaminergic neurons [39,40] with USP24 shRNA lentivirus led to approximately 50% decrease in USP24 protein expression (Figure 5(a-b)). This was accompanied by an increase in the levels of LC3-II (Figure 5(a,c)) and a decrease in the autophagy adaptor protein, NBR1 (Figure 5(a,d)). Accumulation of LC3-II following knockdown of USP24 was further enhanced by the treatment with lysosomal inhibitor chloroquine (Figure 5(e-f)). Therefore, USP24 negatively regulates autophagy flux in human iPSC-derived dopaminergic neurons, similarly to what we observed in cell lines. Similar to cell lines, we also observed increase in activating phosphorylation of the class III PtdIns3K subunit ATG14 (Figure 5(a)), indicating that USP24 likely regulates autophagy in iPSC-derived neurons through the ULK1-class III PtdIns3K pathway.
Figure 5.

USP24 regulates autophagy and neurite length in human iPSC-derived dopaminergic neurons. (a) Western blot illustrating the changes in LC3-II, NBR1, and phospho-ATG14 (P-ATG14) in human iPSC-derived dopaminergic neurons following USP24 knockdown. Dopaminergic precursor cells were differentiated into dopaminergic neurons for 2 wk, transduced with indicated lentiviral shRNAs and evaluated after an additional week in culture. (b) Quantification of USP24:tubulin levels from figure (a). (c) Quantification of LC3-II:tubulin levels from figure (a) (d) Quantification of NBR1:tubulin levels from figure (a) (2 independent experiments; 4–6 replicates) (e and f) Levels of LC3-II following USP24 knockdown are further increased with 100 μM chloroquine (chq) treatment (overnight). (e) Western blot illustrating change in LC3-II levels in human iPSC-derived dopaminergic neurons following USP24 knockdown. (f) Quantification of LC3-II:loading control from figure (e) (4–6 replicates). (g) Representative images of human iPSC-derived neurons at 6 wk after lentiviral transduction, showing increased neurite density in cultures with USP24 knockdown. Cells were transduced with indicated shRNAs; after additional 6 wk cultures were fixed and stained with antibodies against TUBB3/tubulin B3/TUJ1; all neurons) and TH (tyrosine hydroxylase; dopaminergic neurons). Images were acquired at 20X; bar: 25 μm. (h) Quantification of length of neuronal processes over time after lentiviral transduction with indicated shRNAs. All data are normalized to nt shRNA at 1-week time point. Statistical analysis at 1-week time point is presented in Figure S4 and at 6-weeks in (i-j). (i) Quantification of neurite length:neuron from figure (h) at 6-week time point. Data are normalized to nt shRNA at 6-week time point. (j) Quantification of neurite length:neuron for the dopaminergic neurons (TH positive) at 6-week time point. Data are normalized to nt shRNA at 6-week time point. All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001 n = 3–10 (median cell number 634/group).

USP24 regulates autophagy and neurite length in human iPSC-derived dopaminergic neurons. (a) Western blot illustrating the changes in LC3-II, NBR1, and phospho-ATG14 (P-ATG14) in human iPSC-derived dopaminergic neurons following USP24 knockdown. Dopaminergic precursor cells were differentiated into dopaminergic neurons for 2 wk, transduced with indicated lentiviral shRNAs and evaluated after an additional week in culture. (b) Quantification of USP24:tubulin levels from figure (a). (c) Quantification of LC3-II:tubulin levels from figure (a) (d) Quantification of NBR1:tubulin levels from figure (a) (2 independent experiments; 4–6 replicates) (e and f) Levels of LC3-II following USP24 knockdown are further increased with 100 μM chloroquine (chq) treatment (overnight). (e) Western blot illustrating change in LC3-II levels in human iPSC-derived dopaminergic neurons following USP24 knockdown. (f) Quantification of LC3-II:loading control from figure (e) (4–6 replicates). (g) Representative images of human iPSC-derived neurons at 6 wk after lentiviral transduction, showing increased neurite density in cultures with USP24 knockdown. Cells were transduced with indicated shRNAs; after additional 6 wk cultures were fixed and stained with antibodies against TUBB3/tubulin B3/TUJ1; all neurons) and TH (tyrosine hydroxylase; dopaminergic neurons). Images were acquired at 20X; bar: 25 μm. (h) Quantification of length of neuronal processes over time after lentiviral transduction with indicated shRNAs. All data are normalized to nt shRNA at 1-week time point. Statistical analysis at 1-week time point is presented in Figure S4 and at 6-weeks in (i-j). (i) Quantification of neurite length:neuron from figure (h) at 6-week time point. Data are normalized to nt shRNA at 6-week time point. (j) Quantification of neurite length:neuron for the dopaminergic neurons (TH positive) at 6-week time point. Data are normalized to nt shRNA at 6-week time point. All data are presented as ±SEM. *p < 0.05, **p < 0.01, ***p < 0.001 n = 3–10 (median cell number 634/group).

Long-term knockdown of USP24 increases length of neuronal processes

Since PD is an age-related disease, we investigated the influence of inhibiting USP24 on long-term neuronal cell viability and health. Differentiated iPSC-derived dopaminergic neurons were transduced with USP24 or control nt shRNA and evaluated for up to 6 additional weeks in culture. In young neurons (1 wk after transduction) we did not observe any differences in total cell numbers, numbers of all neurons (stained with TUBB3/TUJ1) or numbers of dopaminergic neurons (stained with antibodies against tyrosine hydroxylaseTH) (Figure S5(a-b)). There were also no significant differences in cell or neuron numbers between the groups as neurons aged (evaluated at 4 and 6 wk after transduction), confirming that similarly to cell lines knockdown of USP24 in iPSC-derived neurons has no negative influence on cell viability (Figures 5(g) and S5(c-d)). The length of neuronal processes decreases over time in iPSC-derived dopaminergic neurons from PD patients as compared to healthy controls [41]. Therefore, we evaluated influence of USP24 knockdown on maintenance of neuronal processes. We observed no differences in average neurite lengths between groups of all (TUBB3+) or dopaminergic (TH+) neurons at 1 wk after transduction (Figures 5(h) and S5(e-f)). Neurite length in neurons transduced with nt shRNA increased slightly at 4 wk, then stabilized and remained unchanged at 6 wk (Figure 5(h)). However, the length of all TUBB3+ neurites as well as of TH+ neurites continued to increase throughout duration of the experiment in the USP24 knockdown cultures, becoming significantly greater at 6-weeks (Figure 5(h-j)). This suggests that inhibition of USP24 may increase long-term neurite outgrowth and/or maintenance.

Expression of USP24 is elevated in idiopathic PD patient substantia nigra

To determine if USP24 may be also involved in idiopathic PD, we evaluated its expression in the brains of PD patients as compared to age matched unaffected controls. Analysis of gene expression array data (NCBI GEO repository [42-44]) revealed increased expression of USP24 mRNA in affected brain regions from subpopulation of PD patients (Figure S6(a-b)). Consistently, quantification of our real time qPCR data confirmed significantly elevated USP24 mRNA expression in the substantia nigra of 1 out of 4 non-familial PD patients as compared to age matched unaffected controls (Figure 6(a)). At the protein level, increase in USP24 was observed in 2 out of 4 PD patient substantia nigra as compared to controls (Figure 6(b-c)). Therefore, elevated USP24 levels are observed in a subpopulation of idiopathic PD.
Figure 6.

USP24 is differentially expressed in PD patient substantia nigra. (a) q-PCR quantification of USP24:GAPDH mRNA expression in PD patient SN versus unaffected control substantia nigra. All data points correspond to individuals (n = 4); group means are indicated with horizontal lines; error bars are SE; red circle marks a major statistical outlier (defined as a value above Q1-Q3 outer fence) with significantly increased expression of USP24 mRNA (z-score = 4.6). (b) Western blot illustrating USP24 protein levels in 4 PD patient and 4 unaffected age matched control human substantia nigra. (c) Quantification of USP24:ACTB levels from figure (b). Red circles mark major statistical outliers with significantly increased USP24 protein expression (z-scores = 4.5 and 11.0).

USP24 is differentially expressed in PD patient substantia nigra. (a) q-PCR quantification of USP24:GAPDH mRNA expression in PD patient SN versus unaffected control substantia nigra. All data points correspond to individuals (n = 4); group means are indicated with horizontal lines; error bars are SE; red circle marks a major statistical outlier (defined as a value above Q1-Q3 outer fence) with significantly increased expression of USP24 mRNA (z-score = 4.6). (b) Western blot illustrating USP24 protein levels in 4 PD patient and 4 unaffected age matched control human substantia nigra. (c) Quantification of USP24:ACTB levels from figure (b). Red circles mark major statistical outliers with significantly increased USP24 protein expression (z-scores = 4.5 and 11.0).

Discussion

While dysregulation of autophagy has been clearly linked to PD etiology, the mechanisms by which levels of autophagy are altered in PD are not fully understood [45]. Our data demonstrate that the PARK10 gene USP24 is a negative regulator of autophagy flux in cell lines and human iPSC-derived dopaminergic neurons. Together with altered expression of USP24 in PD substantia nigra, this suggests USP24 as a potential novel regulator of autophagy with relevance to PD. Our data demonstrate that USP24 is an upstream negative regulator of autophagy, acting at the level of autophagosome formation rather than affecting lysosomal function. Furthermore, we determined that USP24 functions downstream or independently of MTOR and regulates autophagy via the ULK1-class III PtdIns3K pathway. Specifically, inhibition of USP24 leads to stabilization of the ULK1 protein and consequent increase in ULK1 kinase activity. As a DUB USP24 is responsible for removing polyubiquitin chains from target proteins [46]. The ULK1-ATG13 and BECN1-PIK3C3/VPS34-AMBRA1 complexes necessary for initiation of autophagosome formation are linked together by a scaffold platform and known to cross regulate each other. When autophagy is induced by the inhibition of MTOR, AMBRA1 becomes dephosphorylated, leading to its activation and interaction with the ubiquitin ligase TRAF6. ULK1 is then ubiquitinated by the TRAF6/AMBRA1 complex with regulatory K-63 chains, leading to its stabilization and activation [36]. ULK1 in turn further phosphorylates and activates components of both its own and the class III PtdIns3K complexes, resulting in a positive regulatory loop. Our data indicate that USP24 knockdown leads to increase in ULK1 ubiquitination, increased ULK1 protein stability and kinase activity. These data suggest that USP24 normally negatively regulates ubiquitination and stability of ULK1, therefore interrupting the positive feed-back amplifying induction of autophagy. Dysregulation of the both major protein degradation pathways, the autophagy-lysosome system and the ubiquitin proteasome system, has been linked to neurodegeneration. Although initially the two pathways were thought to work independently, recent work has revealed many layers of both positive and negative interaction [47-49]. This includes a number of DUBs such as USP14 that have been implicated in regulation of autophagy and coordination of autophagy and proteasomal function [49]. There is also substantial data demonstrating that ubiquitination and deubiquitination is involved in regulation of the class III PtdIns3K activity and several DUBs have been identified [35,50]. Much less is known about how removal of ubiquitin from ULK1 is controlled. To our knowledge, our data identify USP24 as the first candidate regulator of ULK1 deubiquitination, adding another layer of complexity to the control of ULK1 activity, initiation of cellular autophagy and its interaction with the ubiquitin-proteasome pathway in a context relevant to neurodegeneration. Further experiments will be necessary to determine if this regulation is direct and dependent of USP24 DUB activity. Our iPSC neuron data demonstrate that USP24 is able to regulate autophagy not only in cell lines but also in human dopaminergic neurons, the cell type most relevant to PD. This suggests USP24 as a potential regulator of autophagy in the context of this disease. The USP24 gene is located on chromosome 1p in the PARK10 locus, which has been associated with PD predisposition and age of onset [21]. Although a number of candidate genes have been identified in the PARK10 locus, the mechanisms of its involvement or a specific gene responsible for the association with PD has not been identified. Our data suggest that USP24 could be a possible candidate gene that, through its effects on cellular autophagy, could mechanistically link the PARK10 locus to the pathology of PD. Both coding and non-coding SNPs in the USP24 gene have been associated with predisposition to PD [21]. Interestingly, some of these polymorphisms are also found in human lung cancer and have been shown to increase USP24 mRNA stability and consequently protein levels [31]. Thus, PD-associated USP24 SNPs could similarly increase USP24 expression, leading to lowering of autophagy flux. Our data indicate that USP24 mRNA and protein levels are also elevated in the substantia nigra of a subset of idiopathic PD patients, suggesting that suppression of autophagy by USP24 could also occur in at least some cases of non-familial PD. In addition to increasing levels of autophagy, USP24 knockdown also increased neurite length in long-term cultures of human iPSC-derived neurons. Since ULK1 is known to regulate axonal outgrowth in vitro and in vivo [51-53], the effect on neurite outgrowth and/or maintenance could be directly dependent on the increased levels and activity of ULK1 kinase observed following USP24 knockdown. Alternatively, since autophagy is necessary for the maintenance of neuronal health, the increased neurite length could be a result of increased levels of autophagy flux observed following USP24 knockdown. Since neurite length is negatively affected in iPSC-derived dopaminergic neurons from PD patients [41], we hypothesize that inhibiting USP24 may be potentially beneficial for dopaminergic neurite maintenance in PD. However, future experiments will be necessary to evaluate the influence of USP24 on PD patient iPSC-derived neurons.

Materials & methods

Cell culture and treatments

Cell lines

H4 human neuroglioma cells [25,26] were cultured in DMEM (Gibco, 11995065) with 10% heat inactivated Newborn Calf Serum (Sigma-Aldrich, N4762-500ML) and 1% antibiotic-antimycotic (Thermo Fisher Scientific, 15240062). K562 cells were cultured in RPMI 1640 w/L-gln medium (Lonza, 12-702F), 10% fetal bovine serum (Gibco, 10082147), antibiotic-antimycotic (Thermo Fisher Scientific, 15240062). The following drugs were used: bafilomycin A1 (Sigma-Aldrich,B1793: 100 nM: 4–6 h), spautin 1 (R&D Systems, 5197; 20 μM; 4–6 h), rapamycin (Sigma-Aldrich, 37094; 100 nM; 4–6 h), etoposide (Enzo, BML-GR307; 50 μM; 1–6 h), 3-MA (Sigma-Aldrich, M9281; 10 mM; 2–6 h), MRT67307 (Sigma-Aldrich, SML0702-5MG; 10 μM; 1 or 4 h), MRT68921 (Sigma-Aldrich, SML1644-5M; 1 μM; 1 or 4 h). H4-mCherry-GFP-LC3 dual reporter cells were constructed by transducing H4 cells with a mCherry-GFP-LC3 (Addgene, plasmid 22418; Jayanta Debnath Lab) construct cloned into the lentiviral pLESIP vector with NheI and BamHI restriction sites (available through Addgene, plasmid 104941). Routine laboratory tests for mycoplasma were negative.

siRNA transfections

H4 cells were transiently transfected using reverse transfection with HiPerfect Transfection Reagent (Qiagen, 301705) following manufacturer’s instructions, with siRNA at 40 nM final concentration and 1:1 HiPerfect:siRNA vol:vol ratio. K562 cells were double transfected using Lipofectamine 2000 (Invitrogen, 11668027) following the manufacturer’s instructions, with 1ug plasmid and 50 nM final concentration siRNA with a 2:1 Lipofectamine:siRNA vol:vol ratio.

siRNAs

MTOR (Sigma-Aldrich, SASI_Hs01_00203144), MTOR (Dharmacon, D-003008–23) USP24 #3 (Dharmacon, D-006073–03), USP24 #6 (Dharmacon, D-006073–06), USP24 #7 (Dharmacon, D-006073–07), ATG5 (Dharmacon, D-004374–01); control siRNA: Non-Targeting siRNA #5 (Dharmacon, D-001210-05-05) MISSION siRNA Universal Negative Control #1 (Sigma-Aldrich, 45-SIC001).

Lentivirus

Lentivirus was produced in 293T cells following published protocol [54]. Virus was precipitated with PEG-it Virus Precipitation Solution (System Biosciences, LV825A-1).

iPSC dopaminergic precursors culture and treatment

Cell culture and differentiation

Glass bottom plates (MatTek, P35G-1.0–14-C) were coated with Poly-L-ornithine hydrobromide (Sigma-Aldrich, P3655) followed by laminin (Life Technologies, 23017–015). Dopaminergic neuronal precursor cells kit was purchased from XCell Science (XCell Science,DK-001-1V). Cells were plated and differentiated according to the company’s instructions. For long-term cultures cells were maintained in DOPA maturation media with supplement provided in the kit (XCell Science, DM-001-SB50).

Lentiviral transduction

3 wk post-plating differentiated cells were transduced with the GFP-LC3 shRNA (0.5 μL) along with nt, USP24 or MTOR shRNA (0.5 μL), in the presence of 6 μg/mL polybrene (Millipore Sigma, TR-1003-G). Cells were cultured for 1, 3 or 6 wk post transduction, then fixed for staining or lysed for western blot analysis. shRNA: nt (Sigma-Aldrich, SHC016), pooled USP24 (Sigma-Aldrich, SHCLNG-NM_015306; Clone IDs- 1624; 1023; 2314; 4671), MTOR (Sigma-Aldrich, SHCLNG-NM_004958). GFP-LC3 lentiviral construct was as described [40].

Collecting cell lysates

Where indicated, cells were treated with 100 μM chloroquine overnight (Invitrogen, L10382- component B) before lysis. Samples were lysed in RIPA buffer (TEKnova, R3792) that had 1x mini EDTA-free Protease Inhibitor Cocktail (Sigma-Aldrich, 11836170001) and Phosphatase Inhibitor Cocktail 2 and 3 (Sigma-Aldrich, P5726-5ML; P0044-5ML). Cells were sonicated on ice and centrifuged at 4°C at 20,000 g for 20 min, followed by a BCA assay (Thermo Fisher Scientific, 23225) for protein concentrations.

PCR

Total RNA was extracted using RNeasy mini kit (Qiagen, 74104) followed by cDNA synthesis using the SuperScript III First Strand Synthesis System for RT-PCR (Invitrogen,18080–51). For semi-quantitative PCR the following primers were used: USP24 primers- USP24_4594_r (Integrated DNA Technologies, GCA-ACCCGGCGAATCTCAGCA), USP24_4275_f (Integrated DNA Technologies, CGGCTGCAGGACGGCTTGAT). Actin primers- actin_R (Integrated DNA Technologies, AGACA-GCACTGTGTTGGCTA), actin_F (Integrated DNA Technologies, GACCTGACAGACTACCTCAT). TP53 primers- p53-1234-R (Sigma-Aldrich, CATTCAGCTCTCGGAACATC-TC), p53-526-F (Sigma-Aldrich, GTCTGGGCTTCTTGCAT-TCT). SQSTM1/p62 primers- p62-1691-R (Sigma-Aldrich, CTGGAAGAAGGCAGAGAAACT), p62-1228-F (Sigma-Aldrich, GGAACAGATGGAGTCGGATAAC). For real time q-PCR the following primers were used: ULK1 (Thermo Fisher Scientific, Assay ID Hs00177504_m1) and GAPDH (Thermo Fisher Scientific, Assay ID Hs02786624_g1).

Western blot analysis

Western blotting was performed as described [55,56]. All cell lysates were prepared in Laemmli sample buffer (with Β-mercaptoethanol; Sigma-Aldrich, M6250-250ML), run out on a 4–20% SDS-PAGE gel (Bio-Rad, 4561096) and transferred to a PVDF membrane (Millipore Sigma, IPVH00010). The membranes were blocked in 5% non-fat milk (american bio, AB10109-01000) in TBS (Corning, 46-012-CM) with 0.05% tween 20 buffer (Thermo Fisher Scientific, BP337-500) for 1 h and then incubated with primary antibody overnight at 4°C. Primary antibodies were prepared in 1% BSA (Sigma-Aldrich, A7906-100G) in TBS with 0.05% tween 20. Membranes were incubated for 2 h in HRP-conjugated secondary antibodies (Seracare) in 5% milk at room temperature. The blots were developed using SuperSignal West Dura Extended Duration Substrate (Thermo Fisher Scientific, 34076), SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34095), or SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific, 34080) and imaged on the ChemiDoc developer system (Bio-Rad). The band intensity was quantified by Image Lab Software (Bio-Rad). Primary antibodies: LC3 (Novus Biologicals, NB100-220; 1:1000), USP24 (Proteintech, 13126–1-AP, 1:1000), ACTB/β-Actin (Sigma-Aldrich, A1978; 1:10,000), SQSTM1 (BD Biosciences, 610832; 1:1000), ULK1 (Cell Signaling Technology, 8054; 1:1000), phospho-ATG13 (Rockland antibodies & assays, 600–401-C49S; 1:1000), NBR1 (Cell Signaling Technology, 9891; 1:1000), phospho-ATG14 (Cell Signaling Technology, 13155; 1:1000), TUBB3/tubulin B3 (TUJ1; BioLegend, 801202; 1:1000), SNCA/α-synuclein (Cell Signaling Technology, 2642; 1:1000), BAX (Cell Signaling Technology, 2772; 1:1000), OPTN (Proteintech, 10837-1-AP; 1:1000), TP53/p53 (Cell Signaling Technology, 9282; 1:1000), USP24 (Bethyl Laboratories, A300-938A; 1:1000), HA-Tag (Cell Signaling Technology, 3724S; 1:1000), ATG13 (Cell Signaling Technology, 13273S; 1:1000). Secondary antibodies: goat anti-rabbit IgG (H + L) (Seracare, 5450–0010; 1:2500) and goat anti-mouse IgG (H + L) (Seracare, 5450–0011; 1:2500).

Stability assay

Seventy-two h after siRNA transfection the cells were treated with 50 μg/mL cycloheximide (Sigma Aldrich, C1988) for 0, 1, 3 or 4 h and lysed for western blot analysis.

Immunoprecipitation (IP)

HeLa cells were transfected with siRNA as above, followed 48 h later by transfections with plasmids using Lipofectamine (Invitrogen, 11668027) and total 1ug of plasmid DNA per manufacturer’s instructions. After additional 24 h in culture cells were lysed in IP buffer, pre-cleared with with Pierce Protein A/G/Agarose Beads (Thermo Fisher Scientific, 20421) for 1 h and incubated with primary antibody rotating overnight at 4 degrees C. Agarose beads were added and incubated for 1–2 h rotating at 4 degrees C. Beads were washed 4 times and samples were eluted in Laemmli sample buffer followed by western blot analysis. The following plasmids were used: myc-hULK1 (Addgene, 31961; Do-Hyung Kim Lab) and pRK5-HA-Ubiquitin-WT (Addgene, 17608; Ted Dawson Lab). IP antibody: MYC-Tag (Cell Signaling Technology, 2276S; 1:1000).

Immunocytochemistry

Cells were cultured on glass coverslips or glass bottom chamber plates for the iPSC and fixed with 4% PFA. They were incubated in 8% FBS in PBS (Corning, 21–040-CMR) for 1 hour at room temperature followed by permeabilization with 0.2% saponin (Sigma-Aldrich, S7900) and addition of primary antibodies. Cells were incubated at 4°C overnight in the primary antibodies and in the secondary antibodies in the blocking solution + 0.2% saponin for 2 h at room temperature [40]. Nuclei were stained with DAPI (Sigma-Aldrich, D9542). Primary antibodies: Tubulin B3 (TUBB3) TUJ1 (BioLegend, 801202; 1:200), Tyrosine Hydroxylase (Novus Biologicals, NB300-109; 1:200), Phospho-S6 (Cell Signaling Technology, 5364; 1:100). Secondary antibodies: Alexa Fluor 633 goat anti-rabbit IgG (H + L) (Invitrogen, A21071; 1:500), Alexa Fluor 546 goat anti-rabbit IgG (H + l) (Invitrogen, A11035; 1:500), Alexa Fluor 633 goat anti- mouse IgG (H + L) (Invitrogen, A21052; 1:500).

Image acquisition and quantification

All images were acquired on a fluorescent Nikon Ti-E inverted microscope at 20X (CFI Plan APO VC 20X NA 0.75 WD 1 mm) or at 60X (CFI Plan APO VC 60X NA 1.4 Oil) as z-stacks and focused using extended depth of focus module of the Nikon Elements software. All images within each experiment were acquired at the same microscope settings (magnification, exposure times, light source settings, etc). Images were quantified using automated unbiased algorithms (General Analysis + macros for automation) in Elements (NIS-Elements AR Analysis 4.2.01 64-bit) as described [55]. Briefly, nuclei were identified using Spot Detection; cell area was identified using Detect Regional Maxima followed by global thresholding; intracellular puncta (GFP-LC3, FYVE-dsRed, etc) were identified using Spot Detection and normalized to cell area. All quantification measurements were performed on original unaltered images. Median cell number for 20x images was 494.75 analyzed cells/group and for 60x images 21.5 cells/group. All iPSC quantification was preformed blindly.

Cell viability

MTT assay

Cell viability was determined by a MTT assay (Invitrogen, V13154) according to the manufacturer’s instructions [57]. Propidium iodide: Cell viability was determined by propidium iodide (PI) staining according to the manufacturer’s instructions (Thermo Fisher,00-6990-50), followed by FACS analysis [58].

Human brain samples

A total of 8 de-identified substantia nigra samples (4 PD patient and 4 unaffected control) were obtained from the Maryland Brain Bank. The age of the PD patients ranged from 63 to 76 y old (average 72 y old) and comprised 3 males and 1 female. The age of the control donors ranged from 79 to 86 y old (average age of 83 y old), all male.

Western blot

Samples were re-suspended in RIPA buffer and homongenized on ice. Protein concentrations were normalized by BCA assay. Samples were diluted in appropriate amounts of RIPA and Laemmli sample buffer.

q-PCR

Total RNA was isolated using the RNeasy Mini Kit (Qiagen, QGN-74104) and converted into cDNA using the Verso™ cDNA Kit (Thermo Scientific, AB1453B) as per the manufacturers’ instructions. cDNA TaqMan® Universal Master Mix II (Applied Biosystems, 4440040) was used to perform quantitative real-time PCR amplification. Briefly, reactions were performed in duplicate by mixing 2 × TaqMan® Universal Master Mix II, 1μL of cDNA (corresponding to 50ng RNA/reaction) and 20 × TaqMan® Gene Expression Assay, in a final volume of 20μL. TaqMan® Gene Expression assays for the following genes were used for human: Gapdh (Applied Biosystems, Hs02786624_g1) and USP24 (Applied Biosystems, Hs00420009_m1). Reactions were amplified and quantified by using a QuantStudio 6 Flex (Applied Biosystems). The PCR profile consisted of 1 cycle at 50°C for 2 min and 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Gene expression was normalized to Gapdh, and the relative quantity of mRNA was calculated based on the comparative Ct method.

Statistical analysis

All results are expressed as mean ± SEM. Unless otherwise specified, each experiment was repeated independently at least 3 times; ‘n’ is the number of experimental replicates. Statistical analysis was performed on GraphPad Prism7 for Windows (GraphPad Software, La Jolla, CA). ANOVA followed by the appropriate post hoc (Tukey’s multiple comparisons test, Dunnett’s multiple comparison test, Newman-Keuls multiple comparisons test, or Holm-Sidak’s multiple comparisons test) was performed on experiments with more than 2 groups. For experiments with only 2 groups two-tailed unpaired Student’s t-test was performed. A p-value ≤ 0.05 was considered significant [55,59]. Statistical outliers were identified using the quartile method with values above Q3+(Q3-Q1)x3 considered significant (major outliers). Z-scores were calculated based on unaffected population mean and SD [25].
  57 in total

1.  Analysis of apoptosis by propidium iodide staining and flow cytometry.

Authors:  Carlo Riccardi; Ildo Nicoletti
Journal:  Nat Protoc       Date:  2006       Impact factor: 13.491

Review 2.  Does autophagy worsen or improve the survival of dopaminergic neurons?

Authors:  Livia Pasquali; Stefano Ruggieri; Luigi Murri; Antonio Paparelli; Francesco Fornai
Journal:  Parkinsonism Relat Disord       Date:  2009-12       Impact factor: 4.891

3.  Dopaminergic Neuron-Specific Autophagy-Deficient Mice.

Authors:  Shigeto Sato; Nobutaka Hattori
Journal:  Methods Mol Biol       Date:  2018

4.  Genetic evidence for ubiquitin-specific proteases USP24 and USP40 as candidate genes for late-onset Parkinson disease.

Authors:  Yonghong Li; Steven Schrodi; Charles Rowland; Kristina Tacey; Joseph Catanese; Andrew Grupe
Journal:  Hum Mutat       Date:  2006-10       Impact factor: 4.878

5.  Neuroprotective effects of Kukoamine A on neurotoxin-induced Parkinson's model through apoptosis inhibition and autophagy enhancement.

Authors:  XiaoLong Hu; Qi Song; Xin Li; DanDan Li; Qiao Zhang; WeiHong Meng; QingChun Zhao
Journal:  Neuropharmacology       Date:  2017-02-24       Impact factor: 5.250

6.  Guidelines for the use and interpretation of assays for monitoring autophagy.

Authors:  Daniel J Klionsky; Fabio C Abdalla; Hagai Abeliovich; Robert T Abraham; Abraham Acevedo-Arozena; Khosrow Adeli; Lotta Agholme; Maria Agnello; Patrizia Agostinis; Julio A Aguirre-Ghiso; Hyung Jun Ahn; Ouardia Ait-Mohamed; Slimane Ait-Si-Ali; Takahiko Akematsu; Shizuo Akira; Hesham M Al-Younes; Munir A Al-Zeer; Matthew L Albert; Roger L Albin; Javier Alegre-Abarrategui; Maria Francesca Aleo; Mehrdad Alirezaei; Alexandru Almasan; Maylin Almonte-Becerril; Atsuo Amano; Ravi Amaravadi; Shoba Amarnath; Amal O Amer; Nathalie Andrieu-Abadie; Vellareddy Anantharam; David K Ann; Shailendra Anoopkumar-Dukie; Hiroshi Aoki; Nadezda Apostolova; Giuseppe Arancia; John P Aris; Katsuhiko Asanuma; Nana Y O Asare; Hisashi Ashida; Valerie Askanas; David S Askew; Patrick Auberger; Misuzu Baba; Steven K Backues; Eric H Baehrecke; Ben A Bahr; Xue-Yuan Bai; Yannick Bailly; Robert Baiocchi; Giulia Baldini; Walter Balduini; Andrea Ballabio; Bruce A Bamber; Edward T W Bampton; Gábor Bánhegyi; Clinton R Bartholomew; Diane C Bassham; Robert C Bast; Henri Batoko; Boon-Huat Bay; Isabelle Beau; Daniel M Béchet; Thomas J Begley; Christian Behl; Christian Behrends; Soumeya Bekri; Bryan Bellaire; Linda J Bendall; Luca Benetti; Laura Berliocchi; Henri Bernardi; Francesca Bernassola; Sébastien Besteiro; Ingrid Bhatia-Kissova; Xiaoning Bi; Martine Biard-Piechaczyk; Janice S Blum; Lawrence H Boise; Paolo Bonaldo; David L Boone; Beat C Bornhauser; Karina R Bortoluci; Ioannis Bossis; Frédéric Bost; Jean-Pierre Bourquin; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan R Brady; Claudio Brancolini; Andreas Brech; Jay E Brenman; Ana Brennand; Emery H Bresnick; Patrick Brest; Dave Bridges; Molly L Bristol; Paul S Brookes; Eric J Brown; John H Brumell; Nicola Brunetti-Pierri; Ulf T Brunk; Dennis E Bulman; Scott J Bultman; Geert Bultynck; Lena F Burbulla; Wilfried Bursch; Jonathan P Butchar; Wanda Buzgariu; Sergio P Bydlowski; Ken Cadwell; Monika Cahová; Dongsheng Cai; Jiyang Cai; Qian Cai; Bruno Calabretta; Javier Calvo-Garrido; Nadine Camougrand; Michelangelo Campanella; Jenny Campos-Salinas; Eleonora Candi; Lizhi Cao; Allan B Caplan; Simon R Carding; Sandra M Cardoso; Jennifer S Carew; Cathleen R Carlin; Virginie Carmignac; Leticia A M Carneiro; Serena Carra; Rosario A Caruso; Giorgio Casari; Caty Casas; Roberta Castino; Eduardo Cebollero; Francesco Cecconi; Jean Celli; Hassan Chaachouay; Han-Jung Chae; Chee-Yin Chai; David C Chan; Edmond Y Chan; Raymond Chuen-Chung Chang; Chi-Ming Che; Ching-Chow Chen; Guang-Chao Chen; Guo-Qiang Chen; Min Chen; Quan Chen; Steve S-L Chen; WenLi Chen; Xi Chen; Xiangmei Chen; Xiequn Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Zhixiang Chen; Alan Cheng; Christopher H K Cheng; Yan Cheng; Heesun Cheong; Jae-Ho Cheong; Sara Cherry; Russ Chess-Williams; Zelda H Cheung; Eric Chevet; Hui-Ling Chiang; Roberto Chiarelli; Tomoki Chiba; Lih-Shen Chin; Shih-Hwa Chiou; Francis V Chisari; Chi Hin Cho; Dong-Hyung Cho; Augustine M K Choi; DooSeok Choi; Kyeong Sook Choi; Mary E Choi; Salem Chouaib; Divaker Choubey; Vinay Choubey; Charleen T Chu; Tsung-Hsien Chuang; Sheau-Huei Chueh; Taehoon Chun; Yong-Joon Chwae; Mee-Len Chye; Roberto Ciarcia; Maria R Ciriolo; Michael J Clague; Robert S B Clark; Peter G H Clarke; Robert Clarke; Patrice Codogno; Hilary A Coller; María I Colombo; Sergio Comincini; Maria Condello; Fabrizio Condorelli; Mark R Cookson; Graham H Coombs; Isabelle Coppens; Ramon Corbalan; Pascale Cossart; Paola Costelli; Safia Costes; Ana Coto-Montes; Eduardo Couve; Fraser P Coxon; James M Cregg; José L Crespo; Marianne J Cronjé; Ana Maria Cuervo; Joseph J Cullen; Mark J Czaja; Marcello D'Amelio; Arlette Darfeuille-Michaud; Lester M Davids; Faith E Davies; Massimo De Felici; John F de Groot; Cornelis A M de Haan; Luisa De Martino; Angelo De Milito; Vincenzo De Tata; Jayanta Debnath; Alexei Degterev; Benjamin Dehay; Lea M D Delbridge; Francesca Demarchi; Yi Zhen Deng; Jörn Dengjel; Paul Dent; Donna Denton; Vojo Deretic; Shyamal D Desai; Rodney J Devenish; Mario Di Gioacchino; Gilbert Di Paolo; Chiara Di Pietro; Guillermo Díaz-Araya; Inés Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Ivan Dikic; Savithramma P Dinesh-Kumar; Wen-Xing Ding; Clark W Distelhorst; Abhinav Diwan; Mojgan Djavaheri-Mergny; Svetlana Dokudovskaya; Zheng Dong; Frank C Dorsey; Victor Dosenko; James J Dowling; Stephen Doxsey; Marlène Dreux; Mark E Drew; Qiuhong Duan; Michel A Duchosal; Karen Duff; Isabelle Dugail; Madeleine Durbeej; Michael Duszenko; Charles L Edelstein; Aimee L Edinger; Gustavo Egea; Ludwig Eichinger; N Tony Eissa; Suhendan Ekmekcioglu; Wafik S El-Deiry; Zvulun Elazar; Mohamed Elgendy; Lisa M Ellerby; Kai Er Eng; Anna-Mart Engelbrecht; Simone Engelender; Jekaterina Erenpreisa; Ricardo Escalante; Audrey Esclatine; Eeva-Liisa Eskelinen; Lucile Espert; Virginia Espina; Huizhou Fan; Jia Fan; Qi-Wen Fan; Zhen Fan; Shengyun Fang; Yongqi Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Jean-Claude Farré; Mathias Faure; Marcus Fechheimer; Carl G Feng; Jian Feng; Qili Feng; Youji Feng; László Fésüs; Ralph Feuer; Maria E Figueiredo-Pereira; Gian Maria Fimia; Diane C Fingar; Steven Finkbeiner; Toren Finkel; Kim D Finley; Filomena Fiorito; Edward A Fisher; Paul B Fisher; Marc Flajolet; Maria L Florez-McClure; Salvatore Florio; Edward A Fon; Francesco Fornai; Franco Fortunato; Rati Fotedar; Daniel H Fowler; Howard S Fox; Rodrigo Franco; Lisa B Frankel; Marc Fransen; José M Fuentes; Juan Fueyo; Jun Fujii; Kozo Fujisaki; Eriko Fujita; Mitsunori Fukuda; Ruth H Furukawa; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Brigitte Galliot; Vincent Galy; Subramaniam Ganesh; Barry Ganetzky; Ian G Ganley; Fen-Biao Gao; George F Gao; Jinming Gao; Lorena Garcia; Guillermo Garcia-Manero; Mikel Garcia-Marcos; Marjan Garmyn; Andrei L Gartel; Evelina Gatti; Mathias Gautel; Thomas R Gawriluk; Matthew E Gegg; Jiefei Geng; Marc Germain; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Pradipta Ghosh; Anna M Giammarioli; Alexandra N Giatromanolaki; Spencer B Gibson; Robert W Gilkerson; Michael L Ginger; Henry N Ginsberg; Jakub Golab; Michael S Goligorsky; Pierre Golstein; Candelaria Gomez-Manzano; Ebru Goncu; Céline Gongora; Claudio D Gonzalez; Ramon Gonzalez; Cristina González-Estévez; Rosa Ana González-Polo; Elena Gonzalez-Rey; Nikolai V Gorbunov; Sharon Gorski; Sandro Goruppi; Roberta A Gottlieb; Devrim Gozuacik; Giovanna Elvira Granato; Gary D Grant; Kim N Green; Aleš Gregorc; Frédéric Gros; Charles Grose; Thomas W Grunt; Philippe Gual; Jun-Lin Guan; Kun-Liang Guan; Sylvie M Guichard; Anna S Gukovskaya; Ilya Gukovsky; Jan Gunst; Asa B Gustafsson; Andrew J Halayko; Amber N Hale; Sandra K Halonen; Maho Hamasaki; Feng Han; Ting Han; Michael K Hancock; Malene Hansen; Hisashi Harada; Masaru Harada; Stefan E Hardt; J Wade Harper; Adrian L Harris; James Harris; Steven D Harris; Makoto Hashimoto; Jeffrey A Haspel; Shin-ichiro Hayashi; Lori A Hazelhurst; Congcong He; You-Wen He; Marie-Joseé Hébert; Kim A Heidenreich; Miep H Helfrich; Gudmundur V Helgason; Elizabeth P Henske; Brian Herman; Paul K Herman; Claudio Hetz; Sabine Hilfiker; Joseph A Hill; Lynne J Hocking; Paul Hofman; Thomas G Hofmann; Jörg Höhfeld; Tessa L Holyoake; Ming-Huang Hong; David A Hood; Gökhan S Hotamisligil; Ewout J Houwerzijl; Maria Høyer-Hansen; Bingren Hu; Chien-An A Hu; Hong-Ming Hu; Ya Hua; Canhua Huang; Ju Huang; Shengbing Huang; Wei-Pang Huang; Tobias B Huber; Won-Ki Huh; Tai-Ho Hung; Ted R Hupp; Gang Min Hur; James B Hurley; Sabah N A Hussain; Patrick J Hussey; Jung Jin Hwang; Seungmin Hwang; Atsuhiro Ichihara; Shirin Ilkhanizadeh; Ken Inoki; Takeshi Into; Valentina Iovane; Juan L Iovanna; Nancy Y Ip; Yoshitaka Isaka; Hiroyuki Ishida; Ciro Isidoro; Ken-ichi Isobe; Akiko Iwasaki; Marta Izquierdo; Yotaro Izumi; Panu M Jaakkola; Marja Jäättelä; George R Jackson; William T Jackson; Bassam Janji; Marina Jendrach; Ju-Hong Jeon; Eui-Bae Jeung; Hong Jiang; Hongchi Jiang; Jean X Jiang; Ming Jiang; Qing Jiang; Xuejun Jiang; Xuejun Jiang; Alberto Jiménez; Meiyan Jin; Shengkan Jin; Cheol O Joe; Terje Johansen; Daniel E Johnson; Gail V W Johnson; Nicola L Jones; Bertrand Joseph; Suresh K Joseph; Annie M Joubert; Gábor Juhász; Lucienne Juillerat-Jeanneret; Chang Hwa Jung; Yong-Keun Jung; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Motoni Kadowaki; Katarina Kagedal; Yoshiaki Kamada; Vitaliy O Kaminskyy; Harm H Kampinga; Hiromitsu Kanamori; Chanhee Kang; Khong Bee Kang; Kwang Il Kang; Rui Kang; Yoon-A Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Arthi Kanthasamy; Vassiliki Karantza; Gur P Kaushal; Susmita Kaushik; Yoshinori Kawazoe; Po-Yuan Ke; John H Kehrl; Ameeta Kelekar; Claus Kerkhoff; David H Kessel; Hany Khalil; Jan A K W Kiel; Amy A Kiger; Akio Kihara; Deok Ryong Kim; Do-Hyung Kim; Dong-Hou Kim; Eun-Kyoung Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; John K Kim; Peter K Kim; Seong Who Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Jason S King; Timothy J Kinsella; Vladimir Kirkin; Lorrie A Kirshenbaum; Katsuhiko Kitamoto; Kaio Kitazato; Ludger Klein; Walter T Klimecki; Jochen Klucken; Erwin Knecht; Ben C B Ko; Jan C Koch; Hiroshi Koga; Jae-Young Koh; Young Ho Koh; Masato Koike; Masaaki Komatsu; Eiki Kominami; Hee Jeong Kong; Wei-Jia Kong; Viktor I Korolchuk; Yaichiro Kotake; Michael I Koukourakis; Juan B Kouri Flores; Attila L Kovács; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Carole Kretz-Remy; Anna M Krichevsky; Guido Kroemer; Rejko Krüger; Oleg Krut; Nicholas T Ktistakis; Chia-Yi Kuan; Roza Kucharczyk; Ashok Kumar; Raj Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Tino Kurz; Ho Jeong Kwon; Albert R La Spada; Frank Lafont; Trond Lamark; Jacques Landry; Jon D Lane; Pierre Lapaquette; Jocelyn F Laporte; Lajos László; Sergio Lavandero; Josée N Lavoie; Robert Layfield; Pedro A Lazo; Weidong Le; Laurent Le Cam; Daniel J Ledbetter; Alvin J X Lee; Byung-Wan Lee; Gyun Min Lee; Jongdae Lee; Ju-Hyun Lee; Michael Lee; Myung-Shik Lee; Sug Hyung Lee; Christiaan Leeuwenburgh; Patrick Legembre; Renaud Legouis; Michael Lehmann; Huan-Yao Lei; Qun-Ying Lei; David A Leib; José Leiro; John J Lemasters; Antoinette Lemoine; Maciej S Lesniak; Dina Lev; Victor V Levenson; Beth Levine; Efrat Levy; Faqiang Li; Jun-Lin Li; Lian Li; Sheng Li; Weijie Li; Xue-Jun Li; Yan-bo Li; Yi-Ping Li; Chengyu Liang; Qiangrong Liang; Yung-Feng Liao; Pawel P Liberski; Andrew Lieberman; Hyunjung J Lim; Kah-Leong Lim; Kyu Lim; Chiou-Feng Lin; Fu-Cheng Lin; Jian Lin; Jiandie D Lin; Kui Lin; Wan-Wan Lin; Weei-Chin Lin; Yi-Ling Lin; Rafael Linden; Paul Lingor; Jennifer Lippincott-Schwartz; Michael P Lisanti; Paloma B Liton; Bo Liu; Chun-Feng Liu; Kaiyu Liu; Leyuan Liu; Qiong A Liu; Wei Liu; Young-Chau Liu; Yule Liu; Richard A Lockshin; Chun-Nam Lok; Sagar Lonial; Benjamin Loos; Gabriel Lopez-Berestein; Carlos López-Otín; Laura Lossi; Michael T Lotze; Peter Lőw; Binfeng Lu; Bingwei Lu; Bo Lu; Zhen Lu; Frédéric Luciano; Nicholas W Lukacs; Anders H Lund; Melinda A Lynch-Day; Yong Ma; Fernando Macian; Jeff P MacKeigan; Kay F Macleod; Frank Madeo; Luigi Maiuri; Maria Chiara Maiuri; Davide Malagoli; May Christine V Malicdan; Walter Malorni; Na Man; Eva-Maria Mandelkow; Stéphen Manon; Irena Manov; Kai Mao; Xiang Mao; Zixu Mao; Philippe Marambaud; Daniela Marazziti; Yves L Marcel; Katie Marchbank; Piero Marchetti; Stefan J Marciniak; Mateus Marcondes; Mohsen Mardi; Gabriella Marfe; Guillermo Mariño; Maria Markaki; Mark R Marten; Seamus J Martin; Camille Martinand-Mari; Wim Martinet; Marta Martinez-Vicente; Matilde Masini; Paola Matarrese; Saburo Matsuo; Raffaele Matteoni; Andreas Mayer; Nathalie M Mazure; David J McConkey; Melanie J McConnell; Catherine McDermott; Christine McDonald; Gerald M McInerney; Sharon L McKenna; BethAnn McLaughlin; Pamela J McLean; Christopher R McMaster; G Angus McQuibban; Alfred J Meijer; Miriam H Meisler; Alicia Meléndez; Thomas J Melia; Gerry Melino; Maria A Mena; Javier A Menendez; Rubem F S Menna-Barreto; Manoj B Menon; Fiona M Menzies; Carol A Mercer; Adalberto Merighi; Diane E Merry; Stefania Meschini; Christian G Meyer; Thomas F Meyer; Chao-Yu Miao; Jun-Ying Miao; Paul A M Michels; Carine Michiels; Dalibor Mijaljica; Ana Milojkovic; Saverio Minucci; Clelia Miracco; Cindy K Miranti; Ioannis Mitroulis; Keisuke Miyazawa; Noboru Mizushima; Baharia Mograbi; Simin Mohseni; Xavier Molero; Bertrand Mollereau; Faustino Mollinedo; Takashi Momoi; Iryna Monastyrska; Martha M Monick; Mervyn J Monteiro; Michael N Moore; Rodrigo Mora; Kevin Moreau; Paula I Moreira; Yuji Moriyasu; Jorge Moscat; Serge Mostowy; Jeremy C Mottram; Tomasz Motyl; Charbel E-H Moussa; Sylke Müller; Sylviane Muller; Karl Münger; Christian Münz; Leon O Murphy; Maureen E Murphy; Antonio Musarò; Indira Mysorekar; Eiichiro Nagata; Kazuhiro Nagata; Aimable Nahimana; Usha Nair; Toshiyuki Nakagawa; Kiichi Nakahira; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Naweed I Naqvi; Derek P Narendra; Masashi Narita; Miguel Navarro; Steffan T Nawrocki; Taras Y Nazarko; Andriy Nemchenko; Mihai G Netea; Thomas P Neufeld; Paul A Ney; Ioannis P Nezis; Huu Phuc Nguyen; Daotai Nie; Ichizo Nishino; Corey Nislow; Ralph A Nixon; Takeshi Noda; Angelika A Noegel; Anna Nogalska; Satoru Noguchi; Lucia Notterpek; Ivana Novak; Tomoyoshi Nozaki; Nobuyuki Nukina; Thorsten Nürnberger; Beat Nyfeler; Keisuke Obara; Terry D Oberley; Salvatore Oddo; Michinaga Ogawa; Toya Ohashi; Koji Okamoto; Nancy L Oleinick; F Javier Oliver; Laura J Olsen; Stefan Olsson; Onya Opota; Timothy F Osborne; Gary K Ostrander; Kinya Otsu; Jing-hsiung James Ou; Mireille Ouimet; Michael Overholtzer; Bulent Ozpolat; Paolo Paganetti; Ugo Pagnini; Nicolas Pallet; Glen E Palmer; Camilla Palumbo; Tianhong Pan; Theocharis Panaretakis; Udai Bhan Pandey; Zuzana Papackova; Issidora Papassideri; Irmgard Paris; Junsoo Park; Ohkmae K Park; Jan B Parys; Katherine R Parzych; Susann Patschan; Cam Patterson; Sophie Pattingre; John M Pawelek; Jianxin Peng; David H Perlmutter; Ida Perrotta; George Perry; Shazib Pervaiz; Matthias Peter; Godefridus J Peters; Morten Petersen; Goran Petrovski; James M Phang; Mauro Piacentini; Philippe Pierre; Valérie Pierrefite-Carle; Gérard Pierron; Ronit Pinkas-Kramarski; Antonio Piras; Natik Piri; Leonidas C Platanias; Stefanie Pöggeler; Marc Poirot; Angelo Poletti; Christian Poüs; Mercedes Pozuelo-Rubio; Mette Prætorius-Ibba; Anil Prasad; Mark Prescott; Muriel Priault; Nathalie Produit-Zengaffinen; Ann Progulske-Fox; Tassula Proikas-Cezanne; Serge Przedborski; Karin Przyklenk; Rosa Puertollano; Julien Puyal; Shu-Bing Qian; Liang Qin; Zheng-Hong Qin; Susan E Quaggin; Nina Raben; Hannah Rabinowich; Simon W Rabkin; Irfan Rahman; Abdelhaq Rami; Georg Ramm; Glenn Randall; Felix Randow; V Ashutosh Rao; Jeffrey C Rathmell; Brinda Ravikumar; Swapan K Ray; Bruce H Reed; John C Reed; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; John J Reiners; Russel J Reiter; Jun Ren; José L Revuelta; Christopher J Rhodes; Konstantinos Ritis; Elizete Rizzo; Jeffrey Robbins; Michel Roberge; Hernan Roca; Maria C Roccheri; Stephane Rocchi; H Peter Rodemann; Santiago Rodríguez de Córdoba; Bärbel Rohrer; Igor B Roninson; Kirill Rosen; Magdalena M Rost-Roszkowska; Mustapha Rouis; Kasper M A Rouschop; Francesca Rovetta; Brian P Rubin; David C Rubinsztein; Klaus Ruckdeschel; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Nelson Ruiz-Opazo; Rossella Russo; Tor Erik Rusten; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Junichi Sadoshima; Tapas Saha; Tatsuya Saitoh; Hiroshi Sakagami; Yasuyoshi Sakai; Ghasem Hoseini Salekdeh; Paolo Salomoni; Paul M Salvaterra; Guy Salvesen; Rosa Salvioli; Anthony M J Sanchez; José A Sánchez-Alcázar; Ricardo Sánchez-Prieto; Marco Sandri; Uma Sankar; Poonam Sansanwal; Laura Santambrogio; Shweta Saran; Sovan Sarkar; Minnie Sarwal; Chihiro Sasakawa; Ausra Sasnauskiene; Miklós Sass; Ken Sato; Miyuki Sato; Anthony H V Schapira; Michael Scharl; Hermann M Schätzl; Wiep Scheper; Stefano Schiaffino; Claudio Schneider; Marion E Schneider; Regine Schneider-Stock; Patricia V Schoenlein; Daniel F Schorderet; Christoph Schüller; Gary K Schwartz; Luca Scorrano; Linda Sealy; Per O Seglen; Juan Segura-Aguilar; Iban Seiliez; Oleksandr Seleverstov; Christian Sell; Jong Bok Seo; Duska Separovic; Vijayasaradhi Setaluri; Takao Setoguchi; Carmine Settembre; John J Shacka; Mala Shanmugam; Irving M Shapiro; Eitan Shaulian; Reuben J Shaw; James H Shelhamer; Han-Ming Shen; Wei-Chiang Shen; Zu-Hang Sheng; Yang Shi; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Takahiro Shintani; Orian S Shirihai; Gordon C Shore; Andriy A Sibirny; Stan B Sidhu; Beata Sikorska; Elaine C M Silva-Zacarin; Alison Simmons; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Anne Simonsen; David A Sinclair; Rajat Singh; Debasish Sinha; Frank A Sinicrope; Agnieszka Sirko; Parco M Siu; Efthimios Sivridis; Vojtech Skop; Vladimir P Skulachev; Ruth S Slack; Soraya S Smaili; Duncan R Smith; Maria S Soengas; Thierry Soldati; Xueqin Song; Anil K Sood; Tuck Wah Soong; Federica Sotgia; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Srinivasa M Srinivasula; Leonidas Stefanis; Joan S Steffan; Ruediger Stendel; Harald Stenmark; Anastasis Stephanou; Stephan T Stern; Cinthya Sternberg; Björn Stork; Peter Strålfors; Carlos S Subauste; Xinbing Sui; David Sulzer; Jiaren Sun; Shi-Yong Sun; Zhi-Jun Sun; Joseph J Y Sung; Kuninori Suzuki; Toshihiko Suzuki; Michele S Swanson; Charles Swanton; Sean T Sweeney; Lai-King Sy; Gyorgy Szabadkai; Ira Tabas; Heinrich Taegtmeyer; Marco Tafani; Krisztina Takács-Vellai; Yoshitaka Takano; Kaoru Takegawa; Genzou Takemura; Fumihiko Takeshita; Nicholas J Talbot; Kevin S W Tan; Keiji Tanaka; Kozo Tanaka; Daolin Tang; Dingzhong Tang; Isei Tanida; Bakhos A Tannous; Nektarios Tavernarakis; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Lance S Terada; Alexei Terman; Gianluca Tettamanti; Karin Thevissen; Craig B Thompson; Andrew Thorburn; Michael Thumm; FengFeng Tian; Yuan Tian; Glauco Tocchini-Valentini; Aviva M Tolkovsky; Yasuhiko Tomino; Lars Tönges; Sharon A Tooze; Cathy Tournier; John Tower; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Ting-Fen Tsai; Mario P Tschan; Takeshi Tsubata; Allan Tsung; Boris Turk; Lorianne S Turner; Suresh C Tyagi; Yasuo Uchiyama; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Vivek K Unni; Maria I Vaccaro; Enza Maria Valente; Greet Van den Berghe; Ida J van der Klei; Wouter van Doorn; Linda F van Dyk; Marjolein van Egmond; Leo A van Grunsven; Peter Vandenabeele; Wim P Vandenberghe; Ilse Vanhorebeek; Eva C Vaquero; Guillermo Velasco; Tibor Vellai; Jose Miguel Vicencio; Richard D Vierstra; Miquel Vila; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Olga V Voitsekhovskaja; Clarissa von Haefen; Marcela Votruba; Keiji Wada; Richard Wade-Martins; Cheryl L Walker; Craig M Walsh; Jochen Walter; Xiang-Bo Wan; Aimin Wang; Chenguang Wang; Dawei Wang; Fan Wang; Fen Wang; Guanghui Wang; Haichao Wang; Hong-Gang Wang; Horng-Dar Wang; Jin Wang; Ke Wang; Mei Wang; Richard C Wang; Xinglong Wang; Xuejun Wang; Ying-Jan Wang; Yipeng Wang; Zhen Wang; Zhigang Charles Wang; Zhinong Wang; Derick G Wansink; Diane M Ward; Hirotaka Watada; Sarah L Waters; Paul Webster; Lixin Wei; Conrad C Weihl; William A Weiss; Scott M Welford; Long-Ping Wen; Caroline A Whitehouse; J Lindsay Whitton; Alexander J Whitworth; Tom Wileman; John W Wiley; Simon Wilkinson; Dieter Willbold; Roger L Williams; Peter R Williamson; Bradly G Wouters; Chenghan Wu; Dao-Cheng Wu; William K K Wu; Andreas Wyttenbach; Ramnik J Xavier; Zhijun Xi; Pu Xia; Gengfu Xiao; Zhiping Xie; Zhonglin Xie; Da-zhi Xu; Jianzhen Xu; Liang Xu; Xiaolei Xu; Ai Yamamoto; Akitsugu Yamamoto; Shunhei Yamashina; Michiaki Yamashita; Xianghua Yan; Mitsuhiro Yanagida; Dun-Sheng Yang; Elizabeth Yang; Jin-Ming Yang; Shi Yu Yang; Wannian Yang; Wei Yuan Yang; Zhifen Yang; Meng-Chao Yao; Tso-Pang Yao; Behzad Yeganeh; Wei-Lien Yen; Jia-jing Yin; Xiao-Ming Yin; Ook-Joon Yoo; Gyesoon Yoon; Seung-Yong Yoon; Tomohiro Yorimitsu; Yuko Yoshikawa; Tamotsu Yoshimori; Kohki Yoshimoto; Ho Jin You; Richard J Youle; Anas Younes; Li Yu; Long Yu; Seong-Woon Yu; Wai Haung Yu; Zhi-Min Yuan; Zhenyu Yue; Cheol-Heui Yun; Michisuke Yuzaki; Olga Zabirnyk; Elaine Silva-Zacarin; David Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Zahra Zakeri; Herbert J Zeh; Scott O Zeitlin; Hong Zhang; Hui-Ling Zhang; Jianhua Zhang; Jing-Pu Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xu Dong Zhang; Mantong Zhao; Yi-Fang Zhao; Ying Zhao; Zhizhuang J Zhao; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Cong-Zhao Zhou; Changlian Zhu; Wei-Guo Zhu; Xiao-Feng Zhu; Xiongwei Zhu; Yuangang Zhu; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Jürgen Zschocke; Brian Zuckerbraun
Journal:  Autophagy       Date:  2012-04       Impact factor: 16.016

7.  The medial and lateral substantia nigra in Parkinson's disease: mRNA profiles associated with higher brain tissue vulnerability.

Authors:  D C Duke; L B Moran; R K B Pearce; M B Graeber
Journal:  Neurogenetics       Date:  2007-01-09       Impact factor: 2.660

8.  Whole genome expression profiling of the medial and lateral substantia nigra in Parkinson's disease.

Authors:  L B Moran; D C Duke; M Deprez; D T Dexter; R K B Pearce; M B Graeber
Journal:  Neurogenetics       Date:  2006-01-12       Impact factor: 2.660

9.  Impaired autophagy flux is associated with neuronal cell death after traumatic brain injury.

Authors:  Chinmoy Sarkar; Zaorui Zhao; Stephanie Aungst; Boris Sabirzhanov; Alan I Faden; Marta M Lipinski
Journal:  Autophagy       Date:  2014       Impact factor: 16.016

10.  Altered Differentiation Potential of Gaucher's Disease iPSC Neuronal Progenitors due to Wnt/β-Catenin Downregulation.

Authors:  Ola Awad; Leelamma M Panicker; Rania M Deranieh; Manasa P Srikanth; Robert A Brown; Antanina Voit; Tejasvi Peesay; Tea Soon Park; Elias T Zambidis; Ricardo A Feldman
Journal:  Stem Cell Reports       Date:  2017-11-30       Impact factor: 7.294

View more
  8 in total

1.  Genetic analysis of the PCSK9 locus in psychological, psychiatric, metabolic and cardiovascular traits in UK Biobank.

Authors:  Rachel Hay; Breda Cullen; Nicholas Graham; Donald M Lyall; Alisha Aman; Jill P Pell; Joey Ward; Daniel J Smith; Rona J Strawbridge
Journal:  Eur J Hum Genet       Date:  2022-05-02       Impact factor: 4.246

Review 2.  The Emerging Roles of E3 Ligases and DUBs in Neurodegenerative Diseases.

Authors:  Na Liu; Miao-Miao Lin; Yan Wang
Journal:  Mol Neurobiol       Date:  2022-10-19       Impact factor: 5.682

3.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

Review 4.  Autophagy and Redox Homeostasis in Parkinson's: A Crucial Balancing Act.

Authors:  Natalia Jimenez-Moreno; Jon D Lane
Journal:  Oxid Med Cell Longev       Date:  2020-11-10       Impact factor: 6.543

5.  Negative Modulation of Macroautophagy by Stabilized HERPUD1 is Counteracted by an Increased ER-Lysosomal Network With Impact in Drug-Induced Stress Cell Survival.

Authors:  Gabriela Vargas; Omar Cortés; Eloisa Arias-Muñoz; Sergio Hernández; Cristobal Cerda-Troncoso; Laura Hernández; Alexis E González; Michael H Tatham; Hianara A Bustamante; Claudio Retamal; Jorge Cancino; Manuel Varas-Godoy; Ronald T Hay; Alejandro Rojas-Fernández; Viviana A Cavieres; Patricia V Burgos
Journal:  Front Cell Dev Biol       Date:  2022-03-02

6.  Deubiquitinase USP19 extends the residual enzymatic activity of phenylalanine hydroxylase variants.

Authors:  Neha Sarodaya; Apoorvi Tyagi; Hyun-Jin Kim; Ju-Seop Kang; Vijai Singh; Seok-Ho Hong; Woo Jin Kim; Kye-Seong Kim; Suresh Ramakrishna
Journal:  Sci Rep       Date:  2022-08-20       Impact factor: 4.996

Review 7.  Autophagy and beyond: Unraveling the complexity of UNC-51-like kinase 1 (ULK1) from biological functions to therapeutic implications.

Authors:  Ling Zou; Minru Liao; Yongqi Zhen; Shiou Zhu; Xiya Chen; Jin Zhang; Yue Hao; Bo Liu
Journal:  Acta Pharm Sin B       Date:  2022-06-11       Impact factor: 14.903

Review 8.  The role of ubiquitination and deubiquitination in cancer metabolism.

Authors:  Tianshui Sun; Zhuonan Liu; Qing Yang
Journal:  Mol Cancer       Date:  2020-10-01       Impact factor: 27.401

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.