Sex identification using ZFX and ZFY genes in leopard cats (Prionailurus bengalensis euptilurus) in Korea.

In this study, we used multiplex polymerase chain reaction (PCR) to determine the sex of leopard cats (Prionailurus bengalensis euptilurus) in Korea. When we applied PCR using primers based on the intronic region between ZFX and ZFY, only one DNA band of 143 bp was detected in females, compared with two specific bands of 143 and 310 bp in males, indicating that the band patterns were clearly different between females and males. Since the set of primers also proved compatible with tissue and fecal samples, the results of the present study demonstrate that the present PCR could be a convenient tool for identifying the sex of leopard cats.

The Asian leopard cat (Felidae: Prionailurus bengalensis Kerr, 1792) is found mainly in forests in the far east of Asia to western Indonesia and the Philippines [8]. Prionailurus bengalensis euptilurus, a subspecies of P. bengalensis, is distributed across Korea, the Russian Far East, and Northeast China [12]. However, this subspecies has been classified as endangered by the Korean Ministry of Environment [9].

Leopard cat has been intermittently rescued and referred to wildlife centers because of traffic accidents and starvation. It is so fierce that it is difficult for veterinarians and medical staffs to access it for capturing, restraint for treatment, and handling for care and rehabilitation. It is generally not accessible enough to distinguish the sex without anesthesia. However, anesthesia can put a stress on patients, especially those with severe wound and starvation. Also, the distinction between males and females after recovery is very important in terms of management, rehabilitation, and restoration research. This study was conducted to avoid risk factors for anesthesia and using noninvasive method with feces for sex differentiation in very fierce leopard cats. Therefore, we attempted to evaluate leopard cats’ specific primers for PCR to identify the sex from fecal samples collected from the field.

MATERIAL AND METHODS

Samples

Four muscle (n=4) and five fecal (n=5) samples were collected from leopard cats in Gyeongnam Wildlife Center (GNWLC) in Korea. All samples were collected in sterilized plastic vials with approximately 30 ml of absolute alcohol. The samples were then stored in absolute ethanol at 4°C until DNA extraction.

DNA extraction

Genomic DNA of leopard cats was extracted from fecal and muscle samples using the QIAamp DNA Stool Mini Kit (Qiagen Inc., Valencia, CA, U.S.A.). DNA was stored at −20°C until use. In order to analyze the integrity of genomic DNA, all samples were subjected to 3% agarose gel electrophoresis. The quantity and quality of the DNA were measured using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, U.S.A.).

Primer design

Two male and two female reference leopard cats were used to confirm the PCR product size (males 194, 214 bp; females 214 bp), as described previously [10]. Following individual identification, their sexes were ascertained using amelogenin gene primers (Fig. 1). A check was also performed in order to determine whether the sex assignment was consistent for each individual that was recaptured multiple times in this study (Fig. 2). We developed a new primer set for ZFX and ZFY, as shown in Table 1. In addition, the SRY gene was analyzed using a primer set designed on the basis of the leopard cats’ (P. bengalensis) SRY gene (GenBank accession no. DQ095184.1) [5]. Amplification of the ZFX and ZFY genes was performed on the basis of the leopard cats’ ZFX and ZFY genes (GenBank accession nos. AB211420.1 and AB211428.1, respectively) [15]. By comparing the sequence information, primer sets of ZFX-LF/ZFX-LR for the X-chromosome and ZFY-LF/ZFY-LR for the Y-chromosome were developed, and their fragment sizes were 308, 143, and 551 bp, respectively. Multiplex PCR using these two primer pairs was expected to amplify two bands (143 and 308 bp) for males and a single band (143 bp) for females, as indicated in Table 1.

Fig. 1.

Sex identification of leopard cats by analyzing the fragments of ZFX and ZFY with a zinc finger primer set and an amelogenin primer set, respectively [11]. (A) M: 100 bp markers, Lanes 1–3: zinc finger primer set. Lanes 4–6: amelogenin primer set. Lanes 1, 3, 4, and 6: female leopard cat fragments. Lanes 2 and 5: male leopard cat fragments. (B) A close-up of Lanes 4 and 5 in (A). Females showed a single band, whereas males revealed double bands. Electrophoresis was performed on a 2% agarose gel and visualized with ethidium bromide.

Fig. 2.

Sequence alignments of ZFX (A) and ZFY (B) genes. The accession numbers of ZFX and ZFY in each species are as follows: ZFX-LF and ZFY-LF primers are each boxed. Prionailurus bengalensis AB211420.1, AB211428.1; Catopuma temminckii DQ086454.1, AY518666.1; Lynx canadensis DQ086447.1, AY518645.1; Lynx rufus DQ086448.1, AY518.646.1; Lynx lynx DQ6446.1, AY518644.1; Oncifelis colocolo DQ086428.1, AY518654.1; Panthera tigris AB211419.1, AY18650.1.

Table 1.

Primer set and sequence information in the study

Name	Primer sequence (5–3′)	Amplicon length (bp)	Annealing temperature	References
Zn-finger	F: CAAGTTTACACAACCACCTGG	Male: 163, 166	54	[11]
	R: CACAGAATTTACACTTGTGCA	Female: 166
Amelogenin	F: CGAGGTAATTTTTCTGTTTACT	Male: 194, 214	54	[11]
	R: GAAGCTGAGTCAGAGAGGC	Female: 214
ZFX-L1	F: TGGAGGGACTGAGGTTGGTA	Male, Female: 143	59.5	This study
	R: GCAAGTGTTCCTACGTTAATC
ZFX-L2	F: CGGCAAAGCAGGAATTGTGA	Male, Female 263	59.5	This study
	R: AAGCAAGTGTTCCTACGTTAAGC
ZFY-L	F: GTGCACAAGTTCCACAGTGC	Male: 308	59.5	This study
	R: AAGCCCTGCTTATGCTGACA
SRY	F: TATCCTCGCTGTGGAGGGAA	Male: 551	59.5	This study
	R: GTTGTGGAGGTCCTGTGAGG

DNA amplification

PCR was performed in a total volume of 20 µl containing 100 ng of genomic DNA, four 10 pM primers, 10x PCR buffer, 1.5 mM MgCl2, 200 mM dNTPs, and one unit of Taq Polymerase (Takara Inc., Otsu, Japan). The PCR reaction included an initial denaturation cycle at 94°C for 5 min; 29 cycles with a denaturation step at 94°C for 1 min, an annealing step at 59.5°C for 30 sec, and an extension step at 72°C for 30 sec; and a final extension step at 72°C for 10 min in a thermocycler (Bio-Rad, Foster City, CA, U.S.A.). The PCR products were then extracted for sequencing using the QIAquick Gel Extraction Kit (Qiagen Inc.).

RESULTS

Initially, PCR products were produced using muscle DNA with newly designed primers. When the new primer set for the leopard SRY gene was tested, a PCR product of the expected size (551 bp) was successfully amplified for males, but not for females, as demonstrated in Figs. 3 and 4. However, since it is practically difficult to determine the sex of females without any signal, a reference male sample is required as a positive control along with test samples in order to confirm the validity of PCR in this experiment. In this perspective, it is necessary to detect the X-chromosome gene(s) specific for females. Therefore, we attempted to establish novel genotyping methods using the ZFX and ZFY genes because they have been successfully used to discriminate sexes in mammals [1, 4, 7]. With primers based on the sequence information of leopard cats’ ZFX and ZFY, the production of the ZFX gene was 143 bp and the production of the ZFY gene was 308 bp, as shown in Fig. 4. Sequence alignment with amplified products also supported the specificity of the present PCR in this study. Moreover, we conducted the PCR using DNA extracted from fecal samples, for which the original species were known. Figure 5 shows the results of PCR amplification of fecal samples collected from western parts of Gyeongnam. In this experiment, the fragment length of the ZFX gene was 143 bp and that of the ZFY gene was 308 bp, as indicated in Fig. 5. As expected, the sequence from the fecal samples obtained through PCR revealed partial sequence identity of the leopard cats’ ZFX and ZFY. The specificity of the Y-chromosome from the PCR was also confirmed by the presence of the expected product in males, but not in females. Taking the obtained findings together, the difference in length between ZFX and ZFY PCR products using the ZFX-LF/R primer was 165 bp. Notably, these eight species of leopard cats belong to the same order of Carnivora, family Felidae, subfamily Felidae, but they are within different genera.

Fig. 3.

PCR of the SRY gene. Lane 1: female leopard cat DNA. Lane 2: male leopard cat DNA. The male PCR products show amplification of a 551 bp SRY fragment. M: 100 bp molecular weight markers.

Fig. 4.

PCR products of the SRY, ZFX, and ZFY genes. The SRY (551 bp) and ZFY (308 bp) bands were only present for males, but not for females. The ZFX band was positive in both males and females. M: 100 bp molecular weight markers.

Fig. 5.

PCR amplification of partial fragments of ZFX and ZFY genes using DNA extracted from leopard cats (reference muscles) and unknown fecal samples. (A) Lanes 1 and 2: leopard cats’ reference muscles; Lanes 3 and 4: leopard cats’ unknown fecal samples. (B) Unknown fecal samples.

DISCUSSION

In this study, we used polymerase chain reaction (PCR) for sex identification of leopard cats on the basis of the sex-determining Y (SRY) gene located on the Y-chromosome. Actually, the fact that sex is determined by the SRY gene has been used in sex identification using PCR in various mammals [2, 3, 11, 13, 14, 18]. Therefore, genetic sex identification can be induced by investigating the SRY gene. However, the analysis of the SRY gene can be problematic if low-quality DNA samples are used; this analysis can be confirmed by failure in PCR amplification in female samples [10]. In addition, King et al. reported that the SRY gene was inconsistent in some species [5]. To overcome this problem, co-amplification of orthologous sexual chromosome genes, such as zinc finger proteins ZFX and ZFY, has been suggested to improve the precision and quality of sex identification [1]. PCR restriction fragment length polymorphism (RFLP) in various species has also been used to determine the sex with ZFX and ZFY on the X- and Y-chromosomes, respectively [1, 4, 7].

Generally, the size difference between ZFX and ZFY was too small to be used to differentiate the sexes in many mammals [10]. Although Sugimoto et al. reported the use of sex-specific primers (ZFX-PF/PR and DBY7-PF/R) for the leopard cats to generate large differences in PCR, this method required two primer pairs and RFLP analysis [15]. Since the zinc finger gene and the amelogenin gene resulted in similar sized PCR products between males and females, with sizes within 4 and 10 bp, respectively, it was practically difficult to differentiate them during gel electrophoresis. In this study, it was revealed that multiplex PCR based on ZFX-LF/R and ZFY-LF/R could conveniently identify two genes specific for the sex in leopard cats. In fact, the sequence alignment from the PCR products also confirmed the specificity of the primers, indicating that this protocol would presumably be feasible for other Felidae species. Moreover, it was also revealed that the DNA obtained from the fecal samples could be employed as a suitable specimen for sex identification along with muscle or blood samples in the field. Although the DNA extracted from feces showed drawbacks in terms of quality, the utilization of fecal samples as a DNA resource has several advantages, such as there being no risk of injury or death associated with capturing or handling endangered species and the fact that one can obtain various types of important information on a target population [6, 16, 17]. Also, obtaining a good fecal sample from the specimens can help preserve the quality of the DNA and produce accurate results. Therefore, the results of this study demonstrate that PCR for sex identification can provide a convenient approach for breeding-related distribution and relationship studies for endangered leopard cats in Korea.