Min Chen1, Jin-Min Wang2, Dong Wang2, Rong Wu2, Hong-Wei Hou2. 1. Department of Radiology, Nanjing Second Hospital, Nanjing University of Chinese Medicine, Nanjing, Jiangsu 210009, P.R. China. 2. Department of General Surgery, Southeast University Medical School, Nanjing, Jiangsu 210009, P.R. China.
Abstract
Anastomotic fibrosis is highly likely to lead to reoperation in Crohn's disease (CD) patients. Triptolide (TPL) is considered to have anti‑inflammatory and antifibrotic effects in a variety of autoimmune diseases, including CD. The present study aimed to investigate the effects of TPL on fibroblasts from strictured ileocolonic anastomosis of patients with CD and its underlying mechanism. Primary fibroblasts were obtained from strictured anastomosis tissue (SAT) samples and matched anastomosis‑adjacent normal tissue (NT) samples which were collected from 10 CD patients who underwent reoperation because of anastomotic stricture. Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) was used to measure miR‑16‑1 and heat shock protein 70 (HSP70) levels. Western blotting was conducted to determine expression of HSP70, collagen I (Col‑I), collagen III (Col‑III) and α‑smooth muscle actin (α‑SMA) proteins. Agomir‑16‑1 and antagomir‑16‑1 were used to up and downregulate the expression of miR‑16‑1, respectively. Small interfering RNA (siRNA) was employed to inhibit the expression of HSP70. A wound healing assay was performed to measure the migration of fibroblasts. Cell proliferation was evaluated by MTT and 5‑bromo‑2‑deoxyrudidine assays. Cell apoptosis was determined by caspase‑3 activity and TUNEL assays. The results demonstrated that the levels of Col‑I, Col‑III and α‑SMA were all significantly upregulated in SAT compared with NT. miR‑16‑1 levels in the SAT group were significantly compared with the NT group; conversely, the expression levels of HSP70 mRNA and protein in the SAT group were significantly lower compared with the NT group. Next, fibroblasts were treated with TPL to examine its effect on the miR‑16‑1/HSP70 pathway. The results demonstrated that the elevated expression of miR‑16‑1 in the SAT group was effectively inhibited by TPL treatment. Compared with the NT group, both the mRNA and protein levels of HSP70 were significantly downregulated in the SAT group cells, while TPL exhibited a strong promoting effect on HSP70 synthesis. Furthermore, upregulation of miR‑16‑1 reversed the effect of TPL on the miR‑16‑1/HSP70 pathway in fibroblasts from SAT. Overexpression of miR‑16‑1 significantly reversed the inhibitory effects of TPL treatment on migration, proliferation and extracellular matrix (ECM)‑associated protein expression of fibroblasts from SAT. Finally, downregulation of miR‑16‑1 caused similar effects to the fibroblasts as the TPL treatment; however, the inhibitory effects on cell biological functions induced by antagomir‑16‑1 were all significantly reversed by HSP70 silencing. The present findings indicated that TPL may be a potential therapeutic option for postoperative anastomosis fibrosis of patients with CD. The miR‑16‑1/HSP70 pathway had a substantial role in the inhibitory effects of TPL on migration, proliferation and ECM synthesis rate of fibroblasts from strictured anastomosis tissues.
Anastomotic fibrosis is highly likely to lead to reoperation in Crohn's disease (CD) patients. Triptolide (TPL) is considered to have anti‑inflammatory and antifibrotic effects in a variety of autoimmune diseases, including CD. The present study aimed to investigate the effects of TPL on fibroblasts from strictured ileocolonic anastomosis of patients with CD and its underlying mechanism. Primary fibroblasts were obtained from strictured anastomosis tissue (SAT) samples and matched anastomosis‑adjacent normal tissue (NT) samples which were collected from 10 CDpatients who underwent reoperation because of anastomotic stricture. Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) was used to measure miR‑16‑1 and heat shock protein 70 (HSP70) levels. Western blotting was conducted to determine expression of HSP70, collagen I (Col‑I), collagen III (Col‑III) and α‑smooth muscle actin (α‑SMA) proteins. Agomir‑16‑1 and antagomir‑16‑1 were used to up and downregulate the expression of miR‑16‑1, respectively. Small interfering RNA (siRNA) was employed to inhibit the expression of HSP70. A wound healing assay was performed to measure the migration of fibroblasts. Cell proliferation was evaluated by MTT and 5‑bromo‑2‑deoxyrudidine assays. Cell apoptosis was determined by caspase‑3 activity and TUNEL assays. The results demonstrated that the levels of Col‑I, Col‑III and α‑SMA were all significantly upregulated in SAT compared with NT. miR‑16‑1 levels in the SAT group were significantly compared with the NT group; conversely, the expression levels of HSP70 mRNA and protein in the SAT group were significantly lower compared with the NT group. Next, fibroblasts were treated with TPL to examine its effect on the miR‑16‑1/HSP70 pathway. The results demonstrated that the elevated expression of miR‑16‑1 in the SAT group was effectively inhibited by TPL treatment. Compared with the NT group, both the mRNA and protein levels of HSP70 were significantly downregulated in the SAT group cells, while TPL exhibited a strong promoting effect on HSP70 synthesis. Furthermore, upregulation of miR‑16‑1 reversed the effect of TPL on the miR‑16‑1/HSP70 pathway in fibroblasts from SAT. Overexpression of miR‑16‑1 significantly reversed the inhibitory effects of TPL treatment on migration, proliferation and extracellular matrix (ECM)‑associated protein expression of fibroblasts from SAT. Finally, downregulation of miR‑16‑1 caused similar effects to the fibroblasts as the TPL treatment; however, the inhibitory effects on cell biological functions induced by antagomir‑16‑1 were all significantly reversed by HSP70 silencing. The present findings indicated that TPL may be a potential therapeutic option for postoperative anastomosis fibrosis of patients with CD. The miR‑16‑1/HSP70 pathway had a substantial role in the inhibitory effects of TPL on migration, proliferation and ECM synthesis rate of fibroblasts from strictured anastomosis tissues.
CD is a chronic inflammatory disease that has challenged clinicians for decades because of its variability of patient presentation, complex pathophysiology, and as yet incurable nature. This disease eventually leads to surgical intervention in the majority of patients. Between 70–90% of patients with CD require intestinal resection (1,2), and the majority will subsequently experience disease recurrence and require further surgery during their lifetime (3). CD is present most often in the terminal ileum; thus, the most common operation is ileocolectomy and anastomosis (1,4,5). However, surgery for CD is rarely curative and is associated with a high likelihood of recurrence, especially of anastomotic fibrosis and stricture (3). Therefore, while repeated surgical interventions may be necessary, repeated ileocolonic resection will reduce the length of the small bowel and may eventually lead to short gut syndrome (1,6). Unfortunately, there remain many obstacles that preclude the identification of patients at high risk for postoperative relapse and the elucidation of the optimal treatment of anastomotic recurrence.As a traditional Chinese medicine, Tripterygium wilfordii Hook F (TWHF) has been used for the treatment of a variety of immunological disorders for a long time (7). However, numerous adverse effects have been observed during its therapeutic use, which has restricted its application (7). Thus, clarifying the active components that are the primary contributors to reducing its toxicity, will help reduce its side effects. As the most potent bioactive substance in TWHF extract, triptolide (TPL) has been reported to exert immunosuppressive and antifibrotic therapeutic effects in the treatment of several autoimmune diseases, including CD (8–10). Nevertheless, it remains unclear how TPL acts on the intestinal fibrosis of CDpatients. We have previously reported that TPL exerts protective effects against postoperative anastomotic fibrosis in interleukin (IL)-10-deficient mice (an animal model of CD) (11). However, there are no reports concerning the effects of TPL on fibroblasts from anastomoses of CDpatients with anastomotic fibrosis, so the potential mechanism of the TPL therapeutic effect warrants further study.microRNAs (miRNAs) are small (~18–22 nucleotides) noncoding RNA molecules that negatively regulate posttranscriptional gene expression, mainly by binding to complementary sites on the 3′untranslated region (3′UTR) of target mRNAs. miR-16-1, which was first reported to be aberrantly expressed in chronic lymphocytic lymphoma in 2002, has been confirmed to regulate a large variety of cellular processes, including cell proliferation, differentiation, cell cycle and apoptosis (12). Aberrant regulation of miR-16-1 has been reported in pituitary adenomas, colon cancer and prostate carcinoma (13–15). Recent studies have reported that miR-16-1 is closely associated with CD and its prognosis (16,17).Heat shock proteins (HSPs) are a family of highly conserved proteins found in all eukaryotes and prokaryotes, and they have significant roles in cell proliferation, differentiation and oncogenesis (18,19). They are constitutively and gradually expressed in a broad range of normal tissues and neoplasms. The primary function of HSPs is to repair aberrantly folded or mutated proteins through folding/unfolding steps to achieve the correct functional configuration of proteins or, if necessary, degrade proteins to maintain cellular homeostasis (20–22). The HSP70 family, which is located in the cytosol and the nucleus of various cell types, is a core member of the HSP family and is released in response to cellular stressors, including heat, ischemia-reperfusion, inflammation and microbial infection (23). Overexpression of HSP70 is believed to prevent the development of tissue fibrosis provoked by various damaging factors (24–26).A previous study from our group has demonstrated that TPL is an effective substance against postsurgical anastomotic fibrosis in a model of IL-10-deficient mice that underwent ileocecal resection (11). In the present study, the effects of TPL on cell proliferation, migration and extracellular matrix (ECM) protein expression were investigated in fibroblasts derived from the anastomoses of CDpatients with postoperative anastomotic stricture and the related mechanisms were discussed. The results revealed that miR-16-1 was upregulated in tissues from CDpatients with postoperative anastomosis stricture and that it may promote ECM synthesis by targeting HSP70 (27). Notably, TPL treatment of primary fibroblasts in vitro downregulated the expression of miR-16-1, thus further upregulating HSP70 expression and preventing ECM accumulation, suggesting that TPL may contribute to the prevention of postoperative anastomotic fibrosis.
Materials and methods
Collection of human clinical samples
Anastomosis tissue samples and matched anastomosis-adjacent normal tissue samples were collected from 10 patients with CD (female to male ratio, 3:7; age range, 31–51 years) who underwent reoperation because of anastomotic stricture at the Southeast University Affiliate Zhongda Hospital from January 2013 to June 2016. The use of clinical tissue samples for research purposes was approved by the Medical Ethics Committee of the Southeast University Affiliate Zhongda Hospital. All experimental procedures were strictly based on the Helsinki Declaration. Written informed consent was obtained from all patients or their families. The tissues were resected from the patients and frozen at −80°C in liquid nitrogen for further use.
Isolation, culture and management of human intestinal fibroblasts
Primary fibroblasts were isolated and purified from small intestinal tissues by trypsin digestion and differential adherence method (28–30). The principle of this method is to eliminate non-target cells by the time lag of adherence between different types of cells. Briefly, the intestinal tissues were flushed three times with double distilled water (DDW) and cut into 1×1×1 mm pieces. The tissue was then digested in digestion media (0.25% trypsin-0.01% EDTA; Sigma Aldrich; Merck KGaA) for 20 min at room temperature. After removing the supernatant, the tissue was further digested for 20 min with 20 ml of digestion media at 37°C with a 5% CO2 concentration. Dulbecco's-modified Eagle's medium (DMEM)/10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) was used to inactivate the digestion media, and the cell suspension was collected and centrifuged at 250 × g for 5 min to harvest the dispersed cells. A total of 4 ml of DMEM with 10% FBS was added to the tube, and the cells were resuspended to 105 cells/ml and seeded into 25 cm culture flasks. The cells were cultured in DMEM containing 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin and incubated at 37°C in atmosphere of 5% CO2 and 95% relative humidity. The culture medium was changed 2 h later to depurate the fibroblasts, which adhere to the culture flask. Fibroblasts from the second to third passage were used for all experiments. Immunofluorescence staining of vimentin was employed to identify the cell type (the detail experiment protocol is provided below).For transfection, HSP70-targeting small interfering (si) RNA and negative control (NC) scrambled siRNA, agomir-16-1 and antagomir-16-1 were synthesized from Guangzhou RiboBio Co., Ltd. Briefly, cells were seeded into 6-well plates and incubated at 37°C and 5% CO2 for 24 h, and then they were transfected with the following reagents: HSP70 siRNA forward, 5′-UUUAUAUAUGAAUGAAGAGUG-3′ and reverse, 5′-CUCUUCAUUCAUAUAUAAACA-3′ (100 nM); control forward, 5′-UUCUCCGAACGUGUCACGU-3′ and reverse, 5′-ACGUGACACGUUCGGAGAA-3′ (100 nM); agomir-16-1, 5′-UUAUUGCUUAAGAAUACGCGUAGACGCGUAUUCUUAAGCAAUAAUU-3′ (75 nM); or antagomir-16-1, 5′-CAGUACUUUUGUGUAGUACAA-3′ (75 nM). Transfection was performed using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. After 24 h, cells were collected for further experiments. The dosage of TPL used in the present experiments was 20 ng/ml, which has been previously confirmed in vitro to be safe and active (31,32). TPL treatment and transfection with agomir-16-1 were performed simultaneously.
RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
RT-qPCR was performed as described in our previous study (11). Briefly, total RNA was extracted from cells using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. qPCR was performed using the SYBR Premix Ex Taq II PCR kit (Takara Bio, Inc.).A total of 4 mg of DNase-treated (Ambion; Thermo Fisher Scientific, Inc.) RNA was reverse transcribed into cDNA using oligo(dT) primers and reverse transcriptase (Promega Corporation) under standard conditions. β-actin was used as a control. qPCR was performed using the StepOne and StepOnePlus Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). Cycle thresholds for each test mRNA were recorded and normalized to the control. The qPCR conditions were as follows: Initial denaturation at 95°C for 2 min, then 40 cycles of 95°C for 15 sec and elongation at 60°C for 1 min. The 2−ΔΔCq method (33) was used to measure the relative expression of miR-16-1 or HSP70 using β-actin as internal control. The levels of miR-16-1 or HSP70 were expressed as the fold change from the mean expression levels in normal or NC group. The sequences of the primers are listed in Table I.
Table I.
Primer sequences used for polymerase chain reaction.
Gene
Forward primer (5′-3′)
Reverse primer (5′-3′)
miR-16-1
UAGCAGCACGUAAAUAUUGGCG
CCAAUAUUUACGUGCUGCUAUU
HSP70
TCCCGGTGCTGGCTAGGAGACAGATA
CAGGGAAGATAAAGCCCACGTGCA
β-actin
CAGGGCGTGATGGTGGGCA
CAAACATCATCTGGGTCATCTTCTC
miR, microRNA; HSP70, heat shock protein 70.
Immunofluorescence staining
The cells were rinsed three times with PBS and fixed with 4% formalin for 20 min at room temperature, and then permeabilized with 1% Triton X-100 in PBS for 10 min at room temperature. After a brief rinse, the cells were blocked in 1% dry milk in PBS for 30 min at room temperature and then incubated with anti-vimentin (cat. no. ab92547; Abcam) diluted to 1:400 in blocking reagent at 37°C for 1 h. After three washes in PBS for 10 min each, the cells were incubated with Cy3-conjugated anti-goat immunoglobulin (Ig) G antibody (cat. no. c2821; Sigma-Aldrich; Merck KGaA), diluted to 1:2,000 in blocking reagent at 37°C for 1 h. Finally, the slides were washed three times for 10 min each in PBS and then mounted in VECTASHIELD mounting medium with DAPI (Roche Diagnostics). The slides were observed under a fluorescence microscope (Nikon Eclipse E800; Nikon Corporation).
Western blot analysis
As previously described (11), protein was extracted from cells using lysis buffer supplemented with a protease inhibitor cocktail (Bioss) on ice. The supernatants were collected and centrifuged at 15,000 × g for 20 min at 4°C. The protein concentrations were measured using a bicinchoninic acid assay (BCA) protein assay kit (Bioss). A total of 20 µg of protein extract was separated by 10% SDS-PAGE, followed by electroblotting to polyvinylidene difluoride (PVDF) membranes at 4°C. The membranes were blocked with 5% skim milk for 2 h at room temperature, followed by incubation with primary antibodies overnight at 4°C. After washing three times with TBST, the membranes were then probed with horseradish peroxidase (HRP)-conjugated secondary antibody (1:10,000; cat. no. bs-0369M-HRP; Bioss) for 1 h at room temperature. The membranes were then visualized with enhanced chemiluminescence reagent (Amresco, LLC) and analyzed with a FluorChem FC system (Alpha Innotech). The levels of protein expression were normalized to those of β-actin. Densitometry analysis was performed using ImageJ software (version 2X; National Institutes of Health). The primary antibodies used in the experiment were as follows: Anti-collagen I (Col- I; cat. no. ab34710; Abcam), anti-collagen III (Col-III; cat. no. ab7778; Abcam), anti-α-smooth muscle actin (α-SMA; cat. no. ab21027; Abcam) and anti-HSP70 (cat. no. ab2787; Abcam). All primary antibodies were used at a dilution of 1:200.
Wound healing assay
Cells were seeded into 6-well plates at a concentration of 1×105/ml and cultured in DMEM/10% FBS for 24 h at 37°C and 5% CO2. Once confluent, an artificial wound was created in the cell monolayer using a 100 µl micropipette tip. The plates were then gently washed three times with PBS, and the medium was replaced with serum-free medium containing different treatments. The cells were cultured at 37°C and 5% CO2. The rate of the wound healing was visualized and photographed (magnification, ×100) at 0, 6, 12 and 24 h using an inverted light microscope that was linked to a digital camera (Leica Microsystems GmbH). The original images were analyzed using using ImageJ software (version 2X; National Institutes of Health). Three areas of each well and three wells from each group were analyzed in each experiment.
Cell proliferation assays
Cell proliferation was measured using an MTT cell viability and cytotoxicity assay kit (Beijing Solarbio Science & Technology Co., Ltd.) and a 5-bromo-2-deoxyrudidine (BrdU) cell proliferation assay kit (BioVision, Inc.), according to the manufacturer's instructions. Briefly, for the MTT assay, cells were suspended in DMEM/10% FBS at 105 cells/ml and seeded into 96-well plates. After incubating at 37°C and 5% CO2 for 24 h, serum-free medium containing different treatments was added. After a further incubation in the same conditions for 24 h, the cells were incubated with 0.5 mg/ml MTT at 37°C for 4 h. The supernatant was then removed, and 110 µl of DMSO was added for 60 min. The absorbance values were determined at 490 nm using an EL ×800 strip reader (BioTek Instruments Inc.). Proliferation of the treated cells relative to the control cells, which were treated with medium only, was determined. For the BrdU assay, cells were seeded into 96-well plates at a density of 5×103 cells/well and incubated for 48 h. The cells were then treated with a BrdU labeling solution (Sigma-Aldrich; Merck KGaA) for 2 h, followed by incubation with FixDenat solution for 30 min at room temperature. Thereafter, the cells were labeled by peroxidase-conjugated anti-BrdU and incubated for 90 min at 37°C. Finally, substrate solution was added to stop the reaction, and the cells were incubated for 10 min at room temperature. The absorbance values at 370 nm were measured using a microplate reader (BioTek Instruments, Inc.).
Cell apoptosis assays
Cell apoptosis was measured using a caspase-3 activity assay kit (Beyotime Institute of Biotechnology) and an in situ cell death detection kit (Beijing Solarbio Science & Technology Co., Ltd.), according to the supplier's instructions. For the caspase-3 assay, cells (1×104) were seeded into 96-well white opaque plates and allowed to adhere overnight. Following different treatments, the cells were lysed and incubated with 2 mM Ac-DEVD (Asp-Glu-Val-Asp)-pNA in reaction buffer at 37°C for 1 h. The absorbance values at 405 nm were detected using an EL ×800 strip reader (BioTek Instruments Inc.). For the TUNEL assay, after fixation with 4% paraformaldehyde for 30 min, the cells were incubated with TUNEL buffer for 1 h at 37°C and then rinsed three times with PBS. The number of TUNEL-positive cells and the total number of cells in five different random fields were counted under a magnification of ×400 using a light microscope (Olympus Corporation). The rate of apoptotic cells was expressed as a percentage over the total cells.
Statistical analysis
Statistical analyses were performed using the one-way analysis of variance test. The Bonferroni post hoc test was used for assessing parametric data and the Kruskal-Wallis test with Dunn's post hoc test was used for assessing nonparametric data (SPSS 21.0; IBM Corp.). All data were expressed as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.
Results
ECM-associated proteins are overexpressed in strictured anastomosis tissues (SAT) compared with normal tissues (NT)
ECM is mainly synthesized by fibroblasts, and an imbalance in ECM synthesis, deposition, and degradation is considered to be the main cause of tissue fibrosis. To clarify whether fibrosis is the main biological basis of postoperative anastomotic stricture in CDpatients, the expression levels of ECM-associated proteins were detected in SAT and adjacent NT samples by western blot analysis. The results demonstrated that, as the main components of ECM, the levels of Col-I, Col-III and α-SMA were significantly upregulated in SAT compared with NT (P<0.05; Fig. 1), which clearly suggested that fibrosis had an important role in the progression of postoperative anastomosis stricture in CDpatients.
Figure 1.
Protein expression levels of Col-I, Col-III and α-SMA in NT and SAT samples from patients with Crohn's disease. (A) Representative images and (B) quantification of western blot analysis results. Data are presented as the average ± standard deviation. *P<0.05, with comparisons indicated by lines. Col, collagen; α-SMA, α-smooth muscle actin; NT, normal tissue; SAT, strictured anastomosis tissue.
miR-16-1/HSP70 pathway might be involved in the formation of anastomosis stricture of CD patients
We previously reported that the miR-16-1/HSP70 pathway is closely associated with postoperative anastomotic fibrosis in a CD animal model that underwent ileocecal resection. However, to date, there is no research that has focused on the relationship between the miR-16-1/HSP70 pathway and anastomotic recurrence in CDpatients. Therefore, the present study further investigated the expression of miR-16-1 in the intestinal tissues of CDpatients by RT-qPCR. The data demonstrated that the miR-16-1 levels in the SAT group were significantly higher compared with the NT group (P<0.05; Fig. 2A). RT-qPCR and western blotting were performed to measure the levels of HSP70 mRNA and protein, respectively. Conversely, the data indicated that the expression of HSP70 mRNA and protein in the SAT group was significantly lower compared with the NT group (P<0.05; Fig. 2B-D). These results suggest that the miR-16-1/HSP70 pathway may be involved in the formation of postoperative anastomosis fibrosis in CDpatients.
Figure 2.
miR-16-1 and HSP70 expression in NT and SAT samples from patients with Crohn's disease. (A) miR-16-1 levels and (B) HSP70 mRNA levels in each group. (C) Representative images and (D) quantification of western blot analysis for HSP70 in each group. Data are presented as the average ± standard deviation. *P<0.05, with comparisons indicated by lines. miR, microRNA; HSP70, heat shock protein 70; NT, normal tissue; SAT, strictured anastomosis tissue.
Upregulation of miR-16-1 reverses the effects of TPL on the miR-16-1/HSP70 pathway in fibroblasts from SAT
Next, primary fibroblasts were treated with TPL in order to investigate whether TPL can affect the miR-16-1/HSP70 pathway in fibroblasts. Primary fibroblasts were derived from NT and SAT samples and were divided into the following four groups: NT group (fibroblasts from normal tissue with no treatment), SAT group (fibroblasts from strictured anastomosis tissue with no treatment), TT-SAT group (fibroblasts from strictured anastomosis tissue with TPL treatment) and TT-SAT+agomir-16-1 (fibroblasts from strictured anastomosis tissue treated with TPL and agomir-16-1). Vimentin is a fibroblast-specific protein, and immunofluorescence staining for vimentin was used to first confirm that the cells isolated were indeed fibroblasts. The results revealed that the cells were vimentin-positive (Fig. 3). The subsequent RT-qPCR results demonstrated that the levels of miR-16-1 in the SAT group were significantly increased compared with the NT group (P<0.05; Fig. 4A), although the elevated expression of miR-16-1 in the SAT group was then effectively inhibited by TPL treatment (Fig. 4A). Furthermore, compared with the NT group, both the mRNA and protein levels of HSP70 were markedly downregulated in the SAT group (P<0.05; Fig. 4B-D), while TPL exhibited a strong promoting effect on HSP70 synthesis (P<0.05; Fig. 4B-D).
Figure 3.
Fibroblast morphology and identification. (A) Morphology of fibroblasts from second passage (magnification, ×200). (B) Vimentin immunofluorescence staining (green) in fibroblasts (magnification, ×400). Cell nuclei were counterstained with DAPI (blue).
Figure 4.
Upregulation of miR-16-1 reverses the effect of TPL on the miR-16-1/HSP70 pathway in fibroblasts from SAT. (A) miR-16-1 levels and (B) HSP70 mRNA expression levels in each group. (C) Representative images and (D) quantification of of western blot analysis for HSP70 in each group. Data are presented as the average ± standard deviation. *P<0.05, with comparisons indicated by lines. miR, microRNA; TPL, triptolide; HSP70, heat shock protein 70; NT, normal tissue; SAT, strictured anastomosis tissue; TT-SAT, triptolide-treated fibroblasts from SAT.
Finally, to investigate whether TPL regulates anastomosis fibrosis through targeting the miR-16-1/HSP70 pathway, the agomir-16-1 was used to upregulate the expression of miR-16-1 in fibroblasts pretreated with TPL. The results demonstrated that following transfection with agomir-16-1, miR-16-1 expression was significantly restored in the TT-SAT group (P<0.05; Fig. 4A). Correspondingly, overexpression of miR-16-1 significantly reversed the promoting effect of TPL on the expression of HSP70 (P<0.05; Fig. 4B-D).
Overexpression of miR-16-1 reverses the effects of TPL treatment in fibroblasts from strictured anastomosis
To determine whether TPL can affect the biological functions of fibroblasts through targeting miR-16-1, cell migration, proliferation, apoptosis and ECM synthesis rates were investigated next in the different treatment groups.The wound healing assay results demonstrated that fibroblasts in the SAT group had an increased migration compared with the NT group (P<0.05; Fig. 5A and B), while the migration rate was significantly decreased in the TT-SAT group compared with the SAT group (P<0.05; Fig. 5A and B). Additionally, the inhibitory effect of TPL on cell migration was significantly reversed by transfection with agomir-16-1 (P<0.05; Fig. 5A and B).
Figure 5.
Overexpression of miR-16-1 reverses the effect of TPL treatment on fibroblasts from strictured anastomosis. (A) Representative images and (B) quantification of wound healing assay results. (C) Cell viability was measured by MTT assay. (D) Cell proliferation was measured by BrdU assay. (E) Cell apoptosis was determined by caspase-3 activity assay and (F) TUNEL assay. (G) Representative images and (H) quantification of western blot analysis for Col-I, Col-III and α-SMA in each group. Data are presented as the average ± standard deviation. *P<0.05, with comparisons indicated by lines. miR, microRNA; TPL, triptolide; BrdU, 5-bromo-2-deoxyrudidine; Col, collagen; α-SMA, α-smooth muscle actin; NT, normal tissue; SAT, strictured anastomosis tissue; TT-SAT, triptolide-treated fibroblasts from SAT; OD, optical density.
The MTT and BrdU assays demonstrated that the cell proliferation was significantly increased in the SAT group compared with the NT group (P<0.05; Fig. 5C and D), while TPL treatment resulted in a significant decrease of cell proliferation, which was significantly reversed by agomir-16-1 transfection (P<0.05; Fig. 5C and D).The results of the caspase-3 activity assay and the TUNEL assay revealed no obvious difference in cell apoptosis rates between the NT and SAT groups (P>0.05; Fig. 5E and F), but cell apoptosis was markedly enhanced by TPL (P<0.05; Fig. 5E and F), and no significant change was detected following agomir-16-1 transfection (Fig. 5E and F).Additionally, western blot analysis indicated that the expression levels of Col-I, Col-III and α-SMA were all significantly upregulated in fibroblasts in the SAT group compared with the NT group (P<0.05; Fig. 5G and H). TPL exhibited a suppressive effect on Col-I, Col-III and α-SMA expression; conversely, the overexpression of miR-16-1 by agomir-16-1 transfection reversed the effect of TPL (Fig. 5G and H).Taken together, the present results indicated that TPL exerted remarkable inhibitory effects on cell migration, proliferation and ECM-associated protein expression and promoted the apoptosis of fibroblasts from SAT. By contrast, overexpression of miR-16-1 reversed the effects of TPL, except for cell apoptosis. No obvious effect on cell apoptosis was detected following agomir-16-1 treatment.
Downregulation of miR-16-1 imitates effects similar to TPL treatment and can be reversed by knockdown of HSP70
To further investigate the effects of miR-16-1 on fibroblasts and whether miR-16-1 functions through targeting HSP70, fibroblasts were transfected with either scrambled NC siRNA, antagomir-16-1 or antagomir-16-1 accompanied by HSP70 siRNA. Antagomir-16-1 was used to downregulate the expression of miR-16-1 in SAT fibroblasts, and HSP70 siRNA was used to inhibit the expression of HSP70.First, the efficiency of the HSP70 siRNA to significantly decrease the protein expression of HSP70 was confirmed by western blotting (Fig. S1). As presented in Fig. 6A-D, the results of RT-qPCR and western blot analyses revealed that transfection of antagomir-16-1 significantly decreased the expression of miR-16-1 and increased the expression of HSP70 compared with the NC group (P<0.05), while HSP70 siRNA significantly reversed the promoting effect of antagomir-16-1 on HSP70 expression (P<0.05).
Figure 6.
Downregulation of miR-16-1 imitates the effects of TPL treatment and is reversed by knockdown of HSP70. (A) miR-16-1 levels and (B) HSP70 mRNA expression levels in each group. (C) Representative images and (D) quantification of western blot analysis for HSP70 in each group. (E) Representative images and (F) quantification of wound healing assay results. (G) Cell viability was measured by MTT assay. (H) Cell proliferation was measured by BrdU assay. (I) Cell apoptosis was determined by caspase-3 activity assay and (J) TUNEL assay. (K) Representative images and (L) quantification of western blot analysis for Col-I, Col-III and α-SMA in each group. Data are presented as the average ± standard deviation. *P<0.05, with comparisons indicated by lines. miR, microRNA; TPL, triptolide; HSP70, heat shock protein 70; BrdU, 5-bromo-2-deoxyrudidine; Col, collagen; α-SMA, α-smooth muscle actin; NC, negative control; siRNA, small interfering RNA; OD, optical density.
The inhibitory effect on cell migration (Fig. 6E and F), proliferation (Fig. 6G and H) and ECM-associated protein (Col-I, Col-III and α-SMA) expression (Fig. 6K and L) induced by antagomir-16-1 could all be significantly reversed by HSP70 silencing, while no effect of antagomir-16-1 or HSP70 silencing was observed on cell apoptosis (Fig. 6I and J).
Discussion
CD is a chronic, granulomatous, pan-intestinal inflammatory disorder that is often complicated by gastrointestinal strictures and eventually leads to surgical intervention in the majority of patients. Fibrostenotic CDpatients do not respond to medical therapy, and a high number of patients eventually require surgical intervention. Although any portion of the bowel can be affected, CD is present most commonly in the terminal ileum, thus ileocecal or ileocolonic resection and anastomosis is the most common operation. Limited surgical resection effectively relieves the obstruction in symptomatic stenotic CD. However, recurrent ileocolic anastomotic strictures are common, and repeated surgical interventions may be necessary and increases the risk of short bowel syndrome. In the present study, the results of western blotting demonstrated that the ECM synthesis rate, which is mainly determined by fibroblasts and can be well represented by levels of Col-I, Col-III and α-SMA, was significantly higher in strictured anastomosis compared with normal tissue samples from patients. Furthermore, fibroblasts derived from SAT exhibited significantly higher migration, proliferation and ECM-associated protein expression compared with NT fibroblasts. Together, these results indicated that fibrosis may be one of the main pathogeneses leading to postoperative anastomotic recurrence. As obstructive symptoms are the main indication for surgery and repeat surgery in CD, and most irreversible obstructive situations are caused by a fibrotic stricture, a noninvasive treatment that prevents recurrence of CD, especially postoperative anastomotic excessive fibrosis following intestinal resection, would be of great clinical benefit. In our previous study, in vivo experiments using an animal model of CD demonstrated that as an important target of TPL the miR-16-1/HSP70 signaling pathway might be closely associated with postoperative anastomotic fibrosis. However, no report using in vitro experiments regarding the relationship between TPL, the miR-16-1/HSP70 pathway and postoperative anastomotic fibrosis existed. Therefore, the present study investigated the levels of miR-16-1 and HSP70 in strictured anastomosis tissues and normal tissues from CDpatients. The results demonstrated that the levels of miR-16-1 in the SAT group was significantly elevated compared with the NT group, and conversely, the levels of HSP70 exhibited an opposite trend from miR-16-1, which was in accordance with our previous study.The traditional Chinese medicine TWHF has anti-inflammatory, antiproliferative, and proapoptotic properties. A variety of extracts of TWHF have been reported to be therapeutically effective in patients with autoimmune or chronic inflammatory diseases. TPL, which is a major bioactive component of TWHF, exerts strong immunosuppressive and antifibrotic activities. Increasing evidence has demonstrated that TPL has a protective effect on CD. TPL modulates colitis through action in both the Th1 and Th17 pathways (34). The efficiency of TPL as a treatment for CD was reported to be attributed to mechanisms including the tumor necrosis factor (TNF)-α/TNF receptor 2 (35) and Toll-like receptors/nuclear factor (NF)-κB signaling pathways (36). Additionally, numerous studies have demonstrated that TPL can also effectively alleviate tissue fibrosis through multiple mechanisms, including the transforming growth factor (TGF)-β1/Smad signaling pathway (37), the axis of alveolar macrophages-nicotinamide adenine dinucleotide phosphate oxidase-reactive oxygen species-myofibroblasts (38) and the p38 mitogen-activated protein kinase signaling pathway (39). However, there are few studies concerning the effect of TPL on postoperative anastomosis fibrosis of CD. We have previously reported that TPL is an effective substance against postoperative anastomotic fibrosis in a surgical animal model of CD (11). The present study aimed to investigate the effects of TPL on fibroblasts from strictured anastomoses of CDpatients. The results demonstrated that TPL exhibited a strong inhibitory effect on cell migration, proliferation and expression of ECM-associated proteins and promoted the apoptosis of fibroblasts from SAT. As the activation, proliferation, migration and ECM synthesis rate of fibroblasts are crucial for tissue fibrosis, the present results suggested that TPL might be a promising compound for the treatment of postoperative anastomosis fibrosis in patients with CD. Although the toxicity of TPL is lower compared with TWHF, TPL may exhibit certain long-term side effects. Because of its potential beneficial clinical impact, it is necessary to understand how TPL exerts its therapeutic function.miRNAs have recently come into focus as a novel class of posttranscriptional regulators of gene expression. A number of miRNAs have been found to be involved in a wide variety of cellular processes, including cellular differentiation, proliferation and apoptosis, and their aberrant expression has been linked to disease (40). miR-16-1, which belongs to the miR-16 cluster and is located at chromosome 13q14, can regulate numerous cellular biological behaviors, including cell proliferation, differentiation, cell cycle regulation and apoptosis. Multiple studies have demonstrated that miR-16-1, together with miR-15a, has an important role in leukemia, osteosarcoma, and multiple myeloma (14,41,42). Previously, miR-16-1 has been reported to be overexpressed both in the mucosa of the terminal ileum and in the peripheral blood of patients with active CD compared with healthy individuals (16,17). Therefore, the present study detected the expression of miR-16-1 in the intestinal tissue and demonstrated that the mean level of miR-16-1 in SAT was significantly elevated compared with that in NT, suggesting that miR-16-1 may have an important role in the process of postoperative anastomosis fibrosis and stenosis formation in CDpatients. Furthermore, TPL inhibited the expression of miR-16-1 in a time- and dose-dependent manner (43); therefore, the interaction of miR-16-1 and TPL in the inhibition of fibroblast function warranted further investigation. Agomir-16-1 transfection reversed the inhibitory effect of TPL on miR-16-1 expression in fibroblasts; notably, the inhibitory effects of TPL on the cell proliferation, migration and ECM synthesis rates were also reversed by agomir-16-1. By contrast, downregulation of miR-16-1 by antagomir-16-1 transfection in fibroblasts had similar effects on the cell proliferation, migration and ECM synthesis rates to the TPL treatment. Together, these results demonstrated that miR-16-1 was an important target of TPL and regulated fibroblast biological functions.HSPs are a family of ubiquitous intracellular chaperones that are named and grouped as various families according to their molecular weight. Among the various HSPs, HSP70 has recently been reported to exhibit a protective role in many diseases, including CD. The genetic determination of the defense mechanisms in CD is associated with the polymorphism of the HSP70 gene (44). HSP70 exerts its antifibrosis and anti-inflammatory effects in a variety of ways. HSP70 interacts with Smad2 and decreases TGF-β signal transduction. The ectopic expression of HSP70 prevents receptor-dependent phosphorylation and nuclear translocation of Smad2 and blocks TGF-β-induced epithelial-mesenchymal transition (EMT) (45). Induction of HSP70 and its subsequent interaction with TGF-β receptors serves a crucial role in the inhibition of TGF-β signaling (46). A previous study demonstrated that HSP70 has a protective effect on lung injury and fibrosis through the suppression of macrophage inflammatory protein 2 production and inflammatory cell accumulation (47). Additionally, the upregulation of HSP70 exerts beneficial effects in C-C motif chemokine ligand 4-induced liver fibrosis (48). HSP70 is believed to ameliorate renal tubulointerstitial fibrosis in obstructive nephropathy, partly by inhibiting EMT (49). It also has a protective role against bleomycin-induced pulmonary fibrosis through cytoprotective effects by inhibiting the production of TGF-β1 and TGF-β1-dependent EMT in epithelial cells and by inhibiting the expression of pro-inflammatory cytokines (26). By exerting domain-specific effects on Smad3 activation and nuclear translocation, HSP70 can also inhibit EMT in renal epithelial cells (50). Because miR-16-1 targets the 3′UTR of HSP70 and reduces HSP70 expression (27), the present study investigated whether HSP70 silencing could reverse the effect of miR-16-1 downregulation on biological functions of fibroblasts from strictured anastomoses of CDpatients. The results demonstrated that inhibition of HSP70 expression markedly reversed the effects of antagomir-16-1 on fibroblasts; this indicated that HSP70 was involved in the regulatory role of miR-16-1 in the migration, proliferation and ECM synthesis of fibroblasts from strictured anastomoses.In conclusion, the present findings indicate that TPL may serve as a potential therapeutic option for postoperative anastomosis fibrosis in patients with CD. As an important target of TPL, the miR-16-1/HSP70 pathway had an important role in the TPL inhibitory effects on the migration, proliferation and ECM synthesis rates of fibroblasts from strictured anastomosis tissues.