Waleed A Ibrahim1, Sherif A Marouf2, Ahmed M Erfan1, Soad A Nasef1, Jakeen K El Jakee2. 1. Reference Laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, P.O. Box 264-Dokki, Giza 12618, Egypt. 2. Department of Microbiology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt.
Abstract
AIM: This work aimed to determine the occurrence of antibiotic and disinfectant resistance genes in Escherichia coli isolated from chickens in Egypt. MATERIALS AND METHODS: Organs (liver, lung, heart, yolk sac, and bone marrow) of 1500 chicken samples were collected from diseased chickens suffered from colibacillosis with PM findings as CRD, diarrhea and omphalitis from different governorates of Egypt as: Giza, EL-Bahira, Fayoum, El-Dakahlia, El-Ismalia, and El-Sharkia during 2015-2016. These samples were labeled and transported immediately on ice to the Reference laboratory for quality control on poultry production (RLQP). The samples were cultured onto MacConkey agar and Eosin Methylene Blue Agar. Isolation and identification of the E. coli were performed based on morphology, cultural, staining, and biochemical properties. Antimicrobial resistance test was carried out using disk diffusion method. The PCR employing tetA, qacED1 and qacA/B were carried out for detection of these genes in isolated E.coli. RESULTS: The prevalence of E. coli in chicken was 34%. Predominant serotypes of E. coli which serologically identified were O128, O111, O44, O158, and O2. Antibiotic susceptibility test of E. coli revealed that 100% of isolates were resistant to ampicillin, erythromycin, and sulfamethoxazole-trimethoprim, while 73.53% and 38.23% of them were sensitive for colistin sulfate and levofloxacin, respectively. Antibiotic resistance genes as tetA gene were tested for isolated E. coli and detected by incidence rate of 91.18%. qac resistance genes resembling as qacED1 and qacA/B genes were detected in isolated E. coli 70.6% and 14.7%, respectively. CONCLUSION: E. coli isolated from chickens in Egypt was carried qac and antibiotic-resistant genes that affect the poultry industry.
AIM: This work aimed to determine the occurrence of antibiotic and disinfectant resistance genes in Escherichia coli isolated from chickens in Egypt. MATERIALS AND METHODS: Organs (liver, lung, heart, yolk sac, and bone marrow) of 1500 chicken samples were collected from diseased chickens suffered from colibacillosis with PM findings as CRD, diarrhea and omphalitis from different governorates of Egypt as: Giza, EL-Bahira, Fayoum, El-Dakahlia, El-Ismalia, and El-Sharkia during 2015-2016. These samples were labeled and transported immediately on ice to the Reference laboratory for quality control on poultry production (RLQP). The samples were cultured onto MacConkey agar and Eosin Methylene Blue Agar. Isolation and identification of the E. coli were performed based on morphology, cultural, staining, and biochemical properties. Antimicrobial resistance test was carried out using disk diffusion method. The PCR employing tetA, qacED1 and qacA/B were carried out for detection of these genes in isolated E.coli. RESULTS: The prevalence of E. coli in chicken was 34%. Predominant serotypes of E. coli which serologically identified were O128, O111, O44, O158, and O2. Antibiotic susceptibility test of E. coli revealed that 100% of isolates were resistant to ampicillin, erythromycin, and sulfamethoxazole-trimethoprim, while 73.53% and 38.23% of them were sensitive for colistin sulfate and levofloxacin, respectively. Antibiotic resistance genes as tetA gene were tested for isolated E. coli and detected by incidence rate of 91.18%. qac resistance genes resembling as qacED1 and qacA/B genes were detected in isolated E. coli 70.6% and 14.7%, respectively. CONCLUSION: E. coli isolated from chickens in Egypt was carried qac and antibiotic-resistant genes that affect the poultry industry.
Avian pathogenic Escherichia coli (APEC) unlike other normal microflora E. coli in poultry intestine APEC spreads into several internal organs and causes systemic fatal disease colibacillosis, which is characterized by septicemia with multiple organ lesions, typically pericarditis, airsacculitis, perihepatitis, peritonitis, and other extra-intestinal lesions [1]. In poultry farms and surrounding environment, antibiotic resistance occurs frequently and can be spread to humans through food or water chain and also by routes such as environmental contamination by poultry waste and direct interaction with animals [2]. Quaternary ammonium compounds (QACs) are cationic surface active detergents generally used for the control of microorganisms in clinical and industrial environments plus used in the disinfection of hard surfaces [3]. The last line of defense for the poultry industry could possibly be the use of disinfectants as QACs that are frequently used in environments where antibiotics are used, thus fuelling the concern of a relationship between QAC and antibiotic resistance [4]. QAC resistance genes frequently existed among E. coli isolates. The qac genes were highly associated with antimicrobial resistance phenotypes [5]. qac genes in Gram-negative bacteria were most frequently found in combination with genes coding for resistance to aminoglycosides, chloramphenicol, sulfonamides, trimethoprim, and β-lactams [6,7]. In the previous study, detection of the disinfectant resistant gene of aerobic bacteria in unhatched chicken eggs in Egypt was done, and the results indicate the presence of qacED1 gene in isolated E. coli with incidence rate of 100% [8].The significance of study is to explain the failure of treatment of E. coli infection in poultry using antibiotics and increases the infection of E.coli during first week of age besides that the antibiotic resistance occurs often in poultry farms and surrounding environment which can be spread to humans via food or water chain.Hence, the present investigation aimed to study the disinfectant and antibiotic resistance genes among E. coli isolated from chickens in Egypt.
Materials and Methods
Ethical approval
Ethical approval for this study was obtained from Animal Health Research Institute of Egypt.
Collected samples
Organs (liver, lung, heart, yolk sac, and bone marrow) of 1500 chicken samples were collected from diseased chickens suffered from colibacillosis with PM findings as CRD, diarrhea and omphalitis from different age-old and different governorates of Egypt as: Giza; 610 samples, EL-Bahira; 350 samples, Fayoum; 230 samples, El-Dakahlia; 160 samples, El-Ismalia; 120 samples, and El-Sharkia; 100 samples during 2015-2016 in winter seasons. These samples were labeled and transported immediately on ice to Reference laboratory for quality control on poultry production (RLQP). All samples were handled aseptically and examined microbiologically.
Bacteriological examination
Isolation of E. coli by conventional method [9]
Each pooled sample was transferred to buffered peptone water and incubated for 16–18 h at 37°C. After selective enrichment, a loopful of the broth was inoculated on MacConkey agar and Eosin Methylene blue agar (Oxoid), then incubated aerobically in 37°C for 24 h. Suspected E. coli colonies were purified and kept for further identification.
Microscopic examination
Gram’s stain was prepared and used for examined suspected colonies as described by Cruickshank [10] for morphological study.
Biochemical confirmation
Suspected colonies were examined using different biochemical reaction including indole reaction, methyl red test, Voges–Proskauer test, citrate utilization test, catalase test, sugar fermentation test, oxidase test, triple sugar iron, and Christensen’s urea agar test according to Quinn et al. [9].
Serological identification
E. coli isolates were serologically identified using rapid diagnostic E. coli antisera Set 1 containing polyvalent and monovalent O antisera (DENKA SEIKEN Co. LTD, Japan) according to Edwards and Ewing [11].
Antibiotic susceptibility testing
Sensitivity to 12 different groups antibacterial drugs (Ampicillin 10 µg, Amoxicillin 10 µg, Gentamicin 10 µg, Streptomycin 10 µg, Erythromycin 15 µg, Amoxi-clavulanic acid 20/10 µg, Doxycycline 30 µg, Tetracycline 30 µg, Nalidixic acid 30 µg, Levofloxacin 5 µg, Colistin sulfate 25 µg, and trimethoprim-sulfamethoxazole 1.25/23.75 µg) from Oxoid Hampshire, U K, was tested by disk diffusion method according to Quinn et al. [9] and Cruickshank [10]. The interpretation of the inhibition zones of tested culture was tested according to Clinical and Laboratory Standards Institute [12].
Polymerase chain reaction (PCR) for the identification of different genes
Oligonucleotide primers
Primers used were supplied from Metabion (Germany) and are listed in Table-1 [13-15], and cycle condition for different primers is shown in Table-2.
Table-1
Primers used for sequence of partial and complete fusion gene.
Primer
Sequence
Amplified product
References
qacED1
TAA GCC CTA CAC AAA TTG GGA GAT AT
362 bp
[13]
GCC TCC GCA GCG ACT TCC ACG
qacA/B
GCAGAAAGTGCAGAGTTCG
361 bp
[14]
CCAGTCCAATCATGCCTG
tetA(A)
GGTTCACTCGAACGACGTCA
576 bp
[15]
CTGTCCGACAAGTTGCATGA
Table-2
Cycling conditions of the different primers.
Gene
Primary denaturation
Secondary denaturation
Annealing
Extension
Number of cycles
Final extension
QacED1
94°C 5 min
94°C 30 s
58°C 40 s
72°C 40 s
35
72°C 7 min
QacA/B
53°C 40 s
72°C 7 min
TetA(A)
50°C 40 s
72°C 10 min
Primers used for sequence of partial and complete fusion gene.Cycling conditions of the different primers.
DNA extraction
DNA extraction from samples was performed using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer’s recommendations.
Results
Occurrence of E. coli in chickens
E. coli isolates showed bright pink colonies, lactose fermentable on MacConkey agar plates and showed a distinctive metallic green sheen on EMB agar plates. Biochemically, all E. coli suspected isolates were lactose fermenting colonies, positive indole, methyl red, and catalase. Meanwhile all isolates were negative oxidase, urea hydrolysis, citrate utilization, Voges-Proskauer and didn’t produce H2S.The incidence of E. coli isolation in chicken was 34%. The serotyping of isolated E. coli recovered from different organs of chickens revealed that 24 strains could be identified serologically. They belonged to 12 different serogroups. The most commonly detected E. coli serogroups isolated were O128 (4 isolates), O111 (3 isolates), O44 (3 isolates), O158 (2 isolates), O2 (2 isolates), O115 (2 isolates), O20 (2 isolates), O29, O15, O169, O125, O26 and O6, while 10 strains were not typed due to antiserum availability.
Antibiogram pattern of isolated E. coli
Antibiogram pattern of E. coli in our study revealed that 100% of the isolates were resistant to ampicillin, erythromycin, and sulfamethoxazole/trimethoprim, while E. coli isolates were sensitive for colistin sulfate and levofloxacin with 73.53% and 38.23% as shown in Table-3.
Table-3
Antibiotic resistance pattern of isolated E. coli.
Antimicrobial agents
Resistance
Intermediate
Sensitive
n (%)
n (%)
n (%)
Ampicillin
34 (100)
-
-
Amoxicillin
33 (97.06)
-
1 (2.94)
Gentamicin
22 (64.71)
2 (5.88)
10 (29.41)
Streptomycin
33 (97.06)
-
1 (2.94)
Erythromycin
34 (100)
-
-
Amoxicillin-clavulanic acid
32 (94.12)
-
2 (5.88)
Doxycycline
30 (88.24)
-
4 (11.76)
Tetracycline
32 (94.12)
-
2 (5.88)
Nalidixic acid
30 (88.24)
-
4 (11.76)
Levofloxacin
9 (26.47)
12 (35.29)
13 (38.23)
Colistin sulfate
7 (20.59)
2 (5.88)
25 (73.53)
Trimethoprim-sulfamethoxazole
34 (100)
-
-
Antibiotic resistance pattern of isolated E. coli.
Detection of the genes of isolated E. coli by conventional PCR
Screening the presence of tetA, qacED1 and qacA/B genes by PCR technique after DNA extraction revealed that tetA gene in 31 (91.18%), qacED1 gene in 24 (70.56%) and qacA/B gene in 5 (14.7%) out of 34 tested E.coli isolates.
Discussion
Avian colibacillosis is an extraintestinal infection that can progress into several lesions in diverse organs as polyserositis, cellulitis, salpingitis, perihepatitis, peritonitis, septicemia, airsaculitis, and death. These cause harsh economic losses in the poultry industry, due to the significant number of morbidities, mortalities, slaughter condemnation, and reduced productivity of affected birds [16].The incidence of E. coli isolation in chicken was 34% These results are agreed to some extent with that obtained by Ashraf et al. [17] who isolated E. coli in Egypt at 38%.The most commonly detected E. coli serogroups were O128, O111, O44, O158, and O2. E. coli serotypes had been previously isolated from chicken and newly hatched chicks in Egypt as reported by Ashraf et al. [17] who detected O78 and O111, El-Haleem [18] and Taha [19] detected O2, El-Jakee et al. [20] collected E. coli serogroups O2, O6, O8, O26, O27, O78, O86, O111, O128, O157, and O136 from chicken cloacal swabs, El-Sayed et al. [21] founded O111, O55, O142, and O128, El Jakee et al. [22] collected E. coli isolates serogroups O125:K70, O1:K-, O146:K-, O26:K-, O78:K80, O126:K58, and O128:K67 from diseased chickens to prepare a potent E. coli vaccine to control colibacillosis in chickens, and also Bakheet et al. [8] identified O2:H6 (2 isolates), O163:H2 (2 isolates), O128:H2 (3 isolates), O158 (2 isolates), and O44:H18 (2 isolates).Antimicrobial resistance has become a worldwide problem, and the vast consumption of antibiotics by both humans and animals leads to the development and spread of a large number of antibiotic resistance among bacterial populations consequently creating critical public health problems. In the current study, isolated E. coli revealed that 100% of the isolates were resistant to ampicillin, erythromycin, and sulfamethoxazole/trimethoprim (each) as shown in Table-3 that results agreed with Subedi et al. [23] who showed that the maximum resistance of 50 E. coli strains to ampicillin (98%), Bakheet et al. [8] who recorded resistant to sulfamethoxazole/trimethoprim 100%, and Radwan et al. [24] who discussed that antibiogram profiles of E. coli isolates and indicated maximum resistance to ampicillin (100%); furthermore, Eid et al. [25] reported that the highest resistance rates were recorded against trimethoprim sulfate, doxycycline, tetracycline, and amoxicillin (94.1%, 93.2%, 92.9%, and 92.3%, respectively). While E. coli isolates were sensitive for colistin sulfate and levofloxacin with the percentage of 73.53% and 38.23%, respectively, Makhol et al. [26] found that 69.4% of E. coli isolates were sensitive to colistin sulfate.The extensive and prolonged use of tetracycline in the poultry industry is undoubtedly one of the explanations for the high prevalence of resistance to tetracycline in broilers [27]. Concerning tetracycline resistance, in our study, E. coli isolates were 94.12% resistance to tetracycline antibiotics.The tetA gene was tested for isolated E. coli to assess its resistance to tetracycline. Interestingly, the positive PCR percentage (91.18%) was high as shown in isolates. However, the phenotypic antibiotic susceptibility test was 94.12%, which may be related to more genes than tetA gene contributing for tetracycline resistance in E. coli. Sengeløv et al. [28] examined E. coli isolates from diseased and healthy broilers for the presence of tetracycline resistance genes tet
(A), (B), (C), (D), or (E) and found that the tetA and tetB were the most prevalent; in isolates from healthy broilers, tetA was present in 41.2%, tetB in 52.9%, and tetD in 5.9%, and in isolates originated from diseased broilers, tetA was present in 72.2% and tetB in 27.8% samples. Furthermore, Abo-Amer et al. [29] recorded that tetracyclines genes tetA and tetB were observed at the prevalence of 65% among E. coli isolated from chicken farms in Saudi. There was a correlation between the presence of integrons and resistance to tetracycline in chicken E. coli isolates from the Veterinary Antimicrobial Resistance Surveillance Network [30].QACs are cationic surface active detergents extensively used in the poultry industry as of their low relative toxicity, good antibacterial properties non-irritating, non-corrosive, low toxicity, and reasonably effective in the presence of organic matter. Hence, it makes a disinfectant of choice for equipment such as incubators and hatching trays [31]. Genes that confer resistance to QACs are qacE and qacED1; qacED1 a mutant version of qacE appears to be partially functional as a multidrug transporter and is widely distributed throughout Gram-negative bacteria due to its location on the 3´ conserved region of class 1 integrons [32].In this study, the qacED1 gene was reported in 70.6% E. coli (24 positive samples from 43 E. coli isolates). These results were nearly in accordance with Amira [33] and El Tawab et al. [34] who found qacED1 gene among E. coli isolates (93.1% and 63.16%, respectively) in Egypt. QacE gene (including its attenuated variant qacED1) is widely spread in Gram-negative bacteria, mainly in Enterobacteriaceae [35,36].QacA/B gene was founded in 14.7% E. coli in our study; nevertheless, qacA/B was founded in Gram-negative bacteria like E. coli. It seems that the presence of the qac genes does not necessarily imply increased resistance to antiseptics that could be relevant for practice [37].Antimicrobial resistance has become a worldwide problem, and the massive usage of antibiotics by both humans and animals leads to the development and spread of a large number of antibiotic resistance among bacterial populations consequently creating critical public health problems. The co-resistance of QAC and antibiotics could be attained by linkage of different resistance mechanisms on the similar plasmid, transposon otherwise integrin, or any combination of these [4]. The localization of these QAC determinants on different mobile elements may share in the transmission of resistance to the other bacteria [38]. Among Gram-negative bacteria, the qac genes are often related with plasmid-mediated class 1 integrons which harbor a diversity of antibiotic resistance genes [7].
Conclusion
E. coli is one of the most dangerous pathogens that threaten the poultry industry in Egypt due to the high rate of its presence in the farms as well as the presence of the qac resistance gene and antibiotic resistance gene in E. coli definite a link between antibiotic and disinfectant in possible that needs further study.
Authors’ Contributions
The study was designed by SAM, SAN, and JKE. WAI and AME did the molecular work. Data collection, analysis and manuscript preparation by WAI. All authors read and approved the final manuscript.
Authors: Tianmin Li; Claudia D Castañeda; Julio Miotto; Chris McDaniel; Aaron S Kiess; Li Zhang Journal: Poult Sci Date: 2020-12-10 Impact factor: 3.352