Therapeutic Effects of Resveratrol Liposome on Muscle Injury in Rats.

BACKGROUND In this study we prepared liposome microbubbles loading resveratrol (LMLR) and evaluated its therapeutic effect on injury of gastrocnemius muscle in rats. MATERIAL AND METHODS LMLR was prepared and characterized by particle size, potential, and microscopy, and a rat model of acute blunt injury of gastrocnemius muscle was established. After treatments with resveratrol or LMLR, the therapeutic effects were evaluated by hematoxylin-eosin (HE) staining. The expression of MHCIIB and vimentin in mRNA level was measured by real-time PCR. The expression of desmin and collagen I protein was assessed by immunohistochemistry. RESULTS LMLR showed regular cycle shape in a size of ~1000 nm. LMLR was negatively charged (-30 mV). The in vitro release of LMLR was close to 80% at 10 h and 90% at 48 h. Acute gastrocnemius muscle injury was established in rats and tissue recovery was observed after LMLR treatment as evidenced by HE staining, decreased expression of MHCIIB, and increased expression of vimentin. Moreover, LMLR treatment obviously facilitated desmin expression and reduced collagen I expression. CONCLUSIONS LMLR is effective in treating acute blunt injury of gastrocnemius muscle in rats.

Background

Blunt skeletal muscle injury (BSMI) is one of the most common sport injuries and has a high morbidity rate in different sports, seriously affecting the function of skeletal muscle. The investigation of skeletal muscle injury and finding of prevention, treatment, and rehabilitation have recently become important topics [1,2]. According to current therapeutic strategies and daily clinical practice, BSMI predominantly heals with residual deficits since no causal treatment options exist [3]. It is thus of particular significance to find effective treatment strategies.

Resveratrol is a non-flavonoid polyphenolic compound widely found in peanuts, red grapes, and berry fruits. Resveratrol is a natural plant antitoxin that can protect against fungal infections, and is also an active ingredient in some herbs that possess capacity to treat inflammation, lipid metabolism, and heart disease [4,5]. Additionally, resveratrol is also documented to have antioxidant, anti-inflammatory, and anti-tumor activities [6-8]. More importantly, resveratrol has been reported to protect against muscle injury [9-12]. However, the clinical application of resveratrol was been limited because of delivery problems in humans, at least in part due to its weak bioavailability [13].

Lipid microbubbles have attracted more and more attention as a new and targeted drug carrier [14,15]. In addition to being safe, effective, and long-acting, lipid microbubbles can also enter the cellular environment through the endothelial space of capillaries, carrying genes, drugs, targeted substances, and fluorescent proteins [16,17]. In this study, lipid microbubbles were prepared from phospholipids and embedded with resveratrol. Then, the effects of resveratrol liposomes were evaluated in blunt injury to the gastrocnemius muscle in rats.

Material and Methods

Preparation of liposome microbubbles loading resveratrol (LMLR)

LMLR was prepared using the supercritical method. Stearic phosphatidylcholine (DSPC), dipalmitoyl phosphatidylethanolamine (DPPE), resveratrol (RES), dipalmitoyl phosphatidylic acid (DPPA), glycerol, and PBS were mixed in a 2-ml tube (DSPC: DPPE: RES: DPPA: glycerol: PBS=5 mg: 2 mg: 1 mg: 50 μl: 500 μl). The sample was shaken, mixed, and injected with carbon dioxide. The aerated tube was put into a 37°C water bath for 30 min and then in an ultrasonic bath for 1 min.

Measurement particle size and Zeta potential

LMLR was diluted into the appropriate solution and counted with blood-count plates. The numbers of particles in 1 mL solution was calculated. The particle size and potential were measured immediately by use of a Malvern laser particle size analyzer. The measurement was performed after the substance was completely enclosed in liposomes. Since the bubbles are not homogeneous, the measurement of bubble size and potential was measured 3 times and was averaged. LMLR was observed by optical microscope, counted by blood cell counting plate according to the dilution, and the shape and size of microbubble were recorded by photography.

Measurement of in vitro release of LMLR

The microbubbles were dissolved in PBS buffer (100 ml, pH 6.8). A magnetic stirrer was used to control the rotational speed (400 rpm). The samples were measured at 9 time-points (30 min, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, 24 h, and 48 h). The content of resveratrol was determined by high-performance liquid chromatography. The encapsulation efficiency and drug loading were determined by chromatographic method. The prepared ultrasonic microbubble solution was mixed with 5% ethanol (1 ml) and centrifuged at a high speed of 16 000 rpm for 20 min at 6°C. The upper microbubbles were removed, and the lower liquid was diluted and washed with 5% ethanol (0.5 ml) and then we added the proper amount of ether. The ether layer was obtained after centrifuging. The encapsulation efficiency was calculated as: encapsulation efficiency=weight of in vitro release/total weight of the drug ×100%.

Animal model

Sprague-Dawley rats (male; weight, ~252 g) were purchased from Shanghai Super B&K Laboratory Animal Co. (license number 2013-0016; Shanghai, China). The animals were maintained in a temperature-controlled environment (25°C) and a humidity of 40–60% with a standard 12-h light/dark cycle and ad libitum access to food and water. After anesthesia by inhalation of isoflurane, their hind limbs were depilated. All experimental procedures were approved by the Ethics Committee of Wenzhou Medical University. The model was produced after exposing the gastrocnemius muscle by placing the hind limbs in extensor knee, ankle dorsiflexion 90 degrees, and slight abduction position. The model of acute gastrocnemius injury in the right lower limb was successfully established by a single injury caused by free fall of a heavy object on the ventromedial side of the right lower-limb gastrocnemius muscle. The striking weight was 400 g, the falling height was 67 cm, the kinetic energy was 2.63 J, and the attack area was about l cm2. The modeled animals were randomly divided into 3 groups: the LMLR treatment group (the drug-loaded microbubbles diluted with saline were injected into the tail vein (5 mL containing 2 mg resveratrol); the resveratrol group (2 mg resveratrol was dissolved in 1 ml PBS and injected into the tail vein); and the model group (1 ml saline was injected through the tail vein). The blank control group also received 1 ml saline. The dose of resveratrol used in injection was selected based upon a previous publication [18]. Comparisons were made at specified time periods on days 7 and 14.

HE staining

The muscle tissues were fixed with 10% neutral-buffered formalin for 24 h at 4°C and dehydrated with 70%, 80%, and 90% ethanol, mixed with anhydrous ethanol and xylene for 15 min (until transparent). The tissue was paraffin-embedded and sliced. The slices were stained with hematoxylin solution for 3 min, differentiated with 1% hydrochloric acid and 60% ethanol solution for 15 s, lightly washed with water, and stained with eosin for 3 min. After that, the slides were photographed under light microscopy. At least 5 fields of view were captured and analyzed.

Immunohistochemistry (IHC)

IHC assays were performed to determine protein expression levels of desmin and collagen I, as previously described [19]. The muscle tissues were fixed with 10% neutral-buffered formalin for 24 h at 4°C and then embedded in paraffin. Paraffin sections were subjected to dewaxing, boiling, and washing with PBS. Following this, sections were incubated with rabbit anti-mouse monoclonal primary antibodies against desmin (1: 250; cat. no. ab32362, Abcam) or rabbit anti-mouse monoclonal primary antibodies against collagen I (1: 250; cat. no. bs-10423R, Bioss) for 60 min at room temperature, followed by incubation with anti-rabbit IgG horseradish peroxidase-linked antibody (1: 200; cat. no. 7074; ZB-2301, ZSGB-BIO) at 37°C for 15 min. Immunohistochemical staining was visualized by incubating sections with 3,3′-diaminobenzidine chromogen for 3 min at room temperature. A 50i Nikon Fluorescence Microscope (Nikon Corporation, Tokyo, Japan) and Adobe Photoshop CS4 software version 11.0 (Adobe Systems, Inc., San Jose, CA, USA) were used to capture and analyze the images. Finally, samples were counterstained with 1 mg/ml hematoxylin for 3 min at room temperature, dehydrated in alcohol, and then mounted. Two investigators who were blinded to the clinical data semi-quantitatively scored the slides by evaluating the staining intensity. At least 5 fields of each view were captured at ×200 magnification.

Real-time polymerase chain reaction (QRT-PCR)

QRT-PCR was performed as previous described [20]. Briefly, total RNA was extracted using TRIzol® (Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocol. mRNA purity was confirmed by OD280/OD260 using a spectrophotometer and amplified by a one-step RT-PCR kit (cat. no. DRR046A; Takara Bio, Inc., Otsu, Japan). The primers were added into a 25-μl PCR reaction system following a protocol of 94°C denaturation 45 s, 56°C annealing 45 s, and 72°C extension 60 s for 40 cycles. Primers are listed in Table 1.

Table 1

Primer sequence for use in reverse transcription-quantitative polymerase chain reaction.

Genes	Sequence	Primer length (bp)	Product length (bp)	Annealing (°C)
MHCIIB F	CTGATCACCACCAACCCATAT	20	419	58.03
MHCIIB R	GTGACCATCCACAGGAACATC	21
Vimentin F	CAAGAACACCCGCACCAA	17	180	58.32
Vimentin R	TCCCTCATCTCCTCCTCGTA	20
GAPDH F	GCAAGTTCAACGGCACAG	18	141	58.6
GAPDH R	CGCCAGTAGACTCCACGAC	18

Statistical analysis

Data are expressed as mean and standard deviation and were analyzed using SPSS software, version 19.0 (IBM SPSS, Armonk, NY). Statistical significance was assessed using a paired t test (parametric) or one-way analysis of variance with Newman-Keuls as the post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Characterization of LMLR

As shown in Figure 1A, LMLR indicates regular cycle shape in difference sizes. Figure 1B shows that the size of LMLR was about 1000 nm. Zeta potential shows that the surface of LMLR was negatively charged (−30 mV) (Figure 1C). Table 2 shows the drug loading, entrapment efficiency, and counts of resveratrol in lipid microbubbles. The release of LMLR in vitro was close to 80% at 10 h and close to 90% at 48 h (Figure 1D). The final dose of resveratrol was about 2 mg/5 mL in LMLR.

Figure 1

Characterization of LMLR. (A) Structure of LMLR observed by electron microscopy; (B) Size of the LMLR; (C) Zeta potential of LMLR; (D) Release rate of LMLR.

Table 2

Characterization of LMLR.

	Values
Drug loading	10.739%
Entrapment efficiency	42.955%
Counts/mg LMLR	1.1875×106

LMLR reduced MHCIIB expression and promoted vimentin expression in blunt injury of gastrocnemius muscle

The blunt injury of gastrocnemius muscle was produced in rats (Figure 2A). HE staining showed that the transverse section of the muscle fibers was a pink polygon, and the nuclei were mostly oval and located at the edge of the muscle fibers. Inflammatory cell infiltration was observed in the model group (Figure 2B).

Figure 2

Establishment of blunt injury of gastrocnemius muscle in rats. (A) The blunt injury of gastrocnemius muscle was produced in rats; Arrow indicates injury; (B) HE staining of gastrocnemius muscle tissue (Magnification: ×200).

Compared with normal rats, the gastrocnemius muscle fiber in the model group was a pink polygon, and the nucleus was mostly elliptic and located at the edge of muscle fibers. Inflammatory cell infiltration was observed in the model group. These features suggest that the model was successfully established [21]. On day 7, the muscle fibers of the normal control group were arranged tightly and uniformly, and the transverse section of the muscle fibers was polygonal, with different sizes. In the model group, there were obvious swelling and necrosis of muscle cells, loose arrangement of muscle fibers, and many inflammatory cell infiltrating; only a few inflammatory cell infiltrations were found after Res treatment compared with the model group. The inflammatory cell infiltration in the LMLR-treated group was significantly reduced and the muscle fibers were uniformly arranged. After 14 days, all the components were improved. The cells of the Res treatment group were compact but divided into several small pieces. The wound area of the LMLR treatment group had no inflammatory cells, similar to the normal control group (Figure 3).

Figure 3

Morphology of gastrocnemius muscle (Magnification: ×200).

The expression of MHCIIB and vimentin mRNA was detected by QRT-PCR. Compared with controls, MHCIIB expression in the model group was significant promoted and was reduced by Res and LMLR treatment (Figure 4A). Interestingly, LMLR significantly promoted vimentin expression compared with control, model, and model + Res groups (Figure 4B).

Figure 4

LMLR reduced MHC II B expression and promoted Vimentin expression. (A) MHC II B expression; (B) Vimentin expression. Compared with control, * P<0.05; compared with model, # P<0.05.

LMLR promoted desmin expression and reduced collagen I expression in blunt injury of gastrocnemius muscle

The expression of desmin and collagen I proteins in gastrocnemius muscle was detected by immunohistochemistry. As shown in Figure 5, desmin protein was expressed obviously on the 7th day after LMLR treatment. On the 14th day, the expression of desmin protein in model, resveratrol, and LMLR groups were significantly increased. Interestingly, the increase in the LMLR group was more obvious than in the control group.

Figure 5

LMLR promoted Desmin expression. Compared with control, * P<0.05; compared with model, # P<0.05; compared with model+Res group, @ P<0.05.

As shown in Figure 6, collagen I was comparable among control, model, and model+resveratrol group on the 7th day, but was reduced in the LMLR group (vs. model+Res), indicating a better recovery after LMLR treatment. On the 14th day, collagen I expression in the model group was significantly increased in the model group, which was reduced by resveratrol and LMLR treatments. The level in the LMLR group was nearly normal.

Figure 6

LMLR reduced Collagen I expression. Compared with control, * P<0.05; compared with model, # P<0.05; compared with model+Res group, @ P<0.05.

Discussion

LMLR was prepared by lipid microbubbles embedding resveratrol in this study, and the treatment of LMLR in acute blunt injury of the gastrocnemius muscle was also evaluated. Our data revealed a prior protective effect of LMLR on muscle injury in comparison with the direct application of resveratrol.

LMLR was prepared according to a specific proportion of DSPC, DPPE, resveratrol, DPPA, and glycerol. The diameter of lipid microbubbles was about 1 μm and the surface charge was about −30 mV. These parameters showed some differences from a previous study, but the discrepancy might be caused by different preparations of liposome [22]. The drug loading of resveratrol was 10.739% and the encapsulation rate was 42.955%. The number of 1 mg LMLR blood cell counting plate was 1.1875×106. The in vitro release experiment of LMLR showed that resveratrol released nearly 80% at 10 h and 90% at 48 h, indicating that lipid microbubbles had high resveratrol embedding performance and good release efficiency.

Resveratrol can protect against muscle injury [9,10]. The model of blunt injury of gastrocnemius muscle in rats was established by the one-hit method. Our data revealed that resveratrol had protective activity in BMSI. However, compared with a similar dose of resveratrol, LMLR showed prior therapeutic effect as evidenced by HE staining [23,24]. Consistent with our study, resveratrol-loaded liposomes had prior anticonvulsant activity compared with application of a similar dose of resveratrol [22]. Therefore, liposomes are useful to improve the biological availability of resveratrol [13,25,26].

MHCIIB regulates lymphocyte proliferation and interaction and controls immune strength and is associated with disease resistance, affecting the recovery of skeletal muscle and other injuries [27]. In the present study, we found that resveratrol and LMLR both reduced MHCIIB expression. By contrast, vimentin expression was different after resveratrol and LMLR treatment. Vimentin is associated with cellular integrity and cytoskeleton, which is proposed as a marker for recovery of muscle tissue [28]. Interestingly, LMLR remarkably promoted vimentin expression, while resveratrol did not affect vimentin expression. These data reveal that LMLR is more effective in treating muscle injury, likely through promoting vimentin expression. Nevertheless, the mechanisms require further study.

Desmin is an intermediate filament protein that connects the Z-line to the mitochondria, the nucleus, and the cell membrane, and its role is mainly to limit the excessive involvement of sarcomeres in muscle contraction and relaxation [29-31]. Collagen I is one of the main types of collagen in muscle tissue, and the gap between the stumps after muscle injury is initially filled with hematoma [32]. Overproduction of collagen prevents muscle repair and regeneration [33]. The expression of desmin and collagen I protein in each group was characterized by immunohistochemistry in our study. Desmin expression in the LMLR treatment group was increased, but collagen I protein expression was not obviously affected on the 7th day, but it was remarkably reduced on the 14th day by LMLR. High expression of desmin can stabilize the organelles in muscle fibers, maintain certain morphology of muscle fibers, and facilitate the rapid recovery of muscle cells [34], while collagen I has an opposite function in regulating muscle recovery [35]. Therefore, LMLR treatment promoted the recovery of gastrocnemius muscle injury by regulating expression of collagen I and desmin.

Resveratrol works by scavenging free radicals and interfering with oxidative metabolism [36]. Studies have shown that resveratrol has an obvious antioxidant radical effect, and can increase superoxide dismutase and glutathione peroxidase activity, reduce glutathione consumption, and reduce malondialdehyde level [37,38]. Additionally, anti-apoptotic and anti-catabolic effects of resveratrol on compression injury in skeletal muscle were reported to be SIRT1-dependent [18]. In the present study, we only assessed the therapeutic effect of LMLR. However, the utility of LMLR in the treatment of muscle injury, especially the potential mechanisms, should be clarified in future research.

Conclusions

LMLR is effective in treating acute blunt injury of the gastrocnemius muscle in rats. Therefore, the use of lipid microbubbles as drug carriers for sustained resveratrol release in the treatment of muscle injury appears to have broad potential applications and good clinical value.