Literature DB >> 30932814

Low wnt/β-catenin signaling determines leaky vessels in the subfornical organ and affects water homeostasis in mice.

Fabienne Benz1, Viraya Wichitnaowarat1, Martin Lehmann1, Raoul Fv Germano2, Diana Mihova1, Jadranka Macas1, Ralf H Adams3, M Mark Taketo4, Karl-Heinz Plate1,5,6,7,8, Sylvaine Guérit1, Benoit Vanhollebeke2,9, Stefan Liebner1,5,6.   

Abstract

The circumventricular organs (CVOs) in the central nervous system (CNS) lack a vascular blood-brain barrier (BBB), creating communication sites for sensory or secretory neurons, involved in body homeostasis. Wnt/β-catenin signaling is essential for BBB development and maintenance in endothelial cells (ECs) in most CNS vessels. Here we show that in mouse development, as well as in adult mouse and zebrafish, CVO ECs rendered Wnt-reporter negative, suggesting low level pathway activity. Characterization of the subfornical organ (SFO) vasculature revealed heterogenous claudin-5 (Cldn5) and Plvap/Meca32 expression indicative for tight and leaky vessels, respectively. Dominant, EC-specific β-catenin transcription in mice, converted phenotypically leaky into BBB-like vessels, by augmenting Cldn5+vessels, stabilizing junctions and by reducing Plvap/Meca32+ and fenestrated vessels, resulting in decreased tracer permeability. Endothelial tightening augmented neuronal activity in the SFO of water restricted mice. Hence, regulating the SFO vessel barrier may influence neuronal function in the context of water homeostasis.
© 2019, Benz et al.

Entities:  

Keywords:  Wnt; beta-catenin; blood-brain barrier; circumventricular organs; developmental biology; mouse; subfornical organ; water homeostasis; zebrafish

Year:  2019        PMID: 30932814      PMCID: PMC6481993          DOI: 10.7554/eLife.43818

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

In vertebrates, the endothelial blood-brain barrier (BBB) is crucial for providing a permissive microenvironment for neuronal function. During developmental brain vascularization, blood vessels undergo Wnt/β-catenin signaling, driven by Wnt7a/7b that is required for angiogenesis as well as for BBB formation (Daneman et al., 2009; Stenman et al., 2008; Liebner et al., 2008). In the adult, the Wnt pathway remains instrumental to maintain BBB function in endothelial cells (ECs) of the central nervous system (CNS) (Zhou et al., 2014). Herein activation of β-catenin/TCF signaling can be induced by two flavors of the canonical Wnt pathway mediated by the ligands Wnt7a/7b and the non-Wnt-related norrin disease protein (Ndp), binding to the receptor complexes frizzled-4/Lrp5/6/Gpr124/Reck and frizzled-4/Lrp5/6/Tspan12, respectively (Junge et al., 2009; Chang et al., 2017; Cullen et al., 2011; Posokhova et al., 2015; Kuhnert et al., 2010; Wang et al., 2014; Cho et al., 2017; Vanhollebeke et al., 2015; Eubelen et al., 2018). Although a strict control of the exchange between blood and the CNS tissue by the endothelial BBB is realized in most parts of the CNS, some areas of the brain and the ciliary body of the eye are exceptions to this rule, providing a physiologically highly relevant door to the CNS. The circumventricular organs (CVOs) are a number of small midline structures found in all vertebrate brains, located around the third and fourth ventricle. CVOs have a rich capillary plexus, which physiologically lacks BBB properties (Ganong, 2000; Ufnal and Skrzypecki, 2014; Langlet et al., 2013; Benarroch, 2011). These characteristics are regarded as important sites of communication between brain and blood. Based on their function, CVOs are commonly classified into secretory and sensory organs. The median eminence, the neurohypophysis (posterior pituitary, PP), the pineal gland (PI) and the subcommissural organ (SCO) belong to the secretory group. The vascular organ of the lamina terminalis (organum vasculosum of the lamina terminalis, OVLT), the subfornical organ (SFO) and the area postrema (AP) are considered as sensory organs (Ufnal and Skrzypecki, 2014). The leaky vessels of the CVOs evidently have different morphological and structural characteristics from those of typical BBB vessels, lacking a cellular organization as neuro-vascular unit (NVU), without distinctive astrocytic endfeet and ECs with numerous fenestrations and vesicles (Morita et al., 2016). Interestingly, in previous reports neither the tight junction proteins claudin-5 (Cldn5), occludin (Ocln) and zonula occludens 1 (Tjp1/ZO-1) (Mullier et al., 2010; Maolood and Meister, 2010; Norsted et al., 2008; Sisó et al., 2010), nor the transporter proteins glucose transporter 1 (Glut-1) and transferrin receptor (Norsted et al., 2008; Maolood and Meister, 2009), showed a BBB-like staining in leaky CVO ECs. In line with these vascular features, Morita et al. showed that 10 kDa dextran accumulates in the perivascular space between the inner and outer basement membranes, whereas smaller tracers up to 3 kDa dextran diffuse into the parenchyma (Morita et al., 2016). Not only the endothelium, but also the perivascular space in CVOs has specific properties, being enlarged and filled by collagen fibers, fibroblasts, astrocytic processes and axons (Morita and Miyata, 2012). Beside the leaky vasculature of the CVOs, free diffusion of substances into the brain parenchyma is prohibited by tanycytes, specialized cells of the ependymal lining. Tanycytes contain long processes, unlike typical ependymal cells, which project to the parenchyma of the CVOs making contact to the fenestrated vascular wall of the CVOs (Langlet et al., 2013; Benarroch, 2011; Mullier et al., 2010). The detailed function of all CVOs has not intensely been explored in the past, but more recently, the SFO together with the OVLT, the median preoptic nucleus (MnPO) and the PP were identified as a functional circuit, regulating drinking behavior and water homeostasis of the organism (Zimmerman et al., 2016; Oka et al., 2015; Augustine et al., 2018). The SFO is a tiny organ located underneath the fornix at the foramen of Monro, protruding into the third ventricle at the meeting point with the lateral ventricles. The dense vascular network in the SFO is similarly organized in different vertebrate species. It presents with heterogeneous vessel phenotypes and can therefore be divided into two zones. Whereas the outer shell contains more BBB expressing vessels, the majority within the ventromedial core is fenestrated with a wide perivascular space. In general, the vascular density is four to five times higher than in other brain regions with tortuous vessels, exhibiting a high blood volume and slow perfusion rate, thereby contributing to high permeability rates (Sisó et al., 2010; Duvernoy and Risold, 2007; Fry et al., 2007; Bouchaud et al., 1989). Although a cell type-specific expression analysis by single cell sequencing, as it has been performed for the brain parenchyma (Vanlandewijck et al., 2018), has not been conducted yet, neurons and astrocytes of sensory CVOs (SFO, OVLT and AP) were shown to express specific receptors and ion channels. Those permit them to detect several blood–derived molecules such as salts, hormones, lipids and toxins and convey this information to other parts of the brain, involved in controlling autonomic and peripheral functions (Benarroch, 2011; Sisó et al., 2010). Evidence supports that 25–60% of CVO neurons respond to signals in the circulatory system and a single neuron may respond to multiple signals such as osmolarity and angiotensin II. Most sensory CVOs play a role in the control of blood pressure, fluid and sodium balance, cardiovascular regulation, feeding and energy homeostasis and immunomodulation (Ufnal and Skrzypecki, 2014; Benarroch, 2011; Sisó et al., 2010; Morita and Miyata, 2012; Smith and Ferguson, 2012). Given the fact that endothelial Wnt/β-catenin signaling is necessary for BBB development and maintenance, the question remains if the pathway is instrumental in the establishment of vascular heterogeneity in the CNS. Hence, we addressed the question if Wnt/β-catenin signaling is operational in CVO vessels during development and if local regulation of β-catenin signaling is involved in establishing a leaky vascular phenotype in CVOs. Finally, we asked if dominant activation of β-catenin in ECs can overwrite the leaky vessel fate thereby affecting CVO function. Here we show by investigating CVOs during BAT-gal reporter mouse development that at any embryonic stage analyzed, starting from E13.5, when the first SFO primordium could be identified, to P21, no activation of β-catenin signaling in CVO vessels could be detected. Focusing on the SFO as a crucial CVO in the regulation of water homeostasis, we show that blood vessels in the caudal portion were mainly leaky evidenced by Plvap/Meca32 staining, whereas capillaries in the rostral portion of the organ were tighter. Interestingly, within the vessel continuity, individual ECs might be Plvap/Meca32+//Cldn5- followed by a Plvap/Meca32-//Cldn5+ EC, suggesting a locally confined regulation of barrier properties. Dominant, genetic activation of β-catenin signaling (gain-of-function, GOF) in ECs resulted in tightening of CVO blood vessels, evidenced by the switch from a Plvap/Meca32+//Cldn5- to a Plvap/Meca32-//Cldn5+ vascular phenotype. Vessel tightening was accompanied by a significant reduction in endothelial fenestrations, that likely contributed to the reduction of transcellular permeability evidenced by decreased tracer leakage. Interestingly, endothelial tightening did not coincide with the formation of astrocytic endfeet towards a BBB-like NVU. Finally, we observed augmented neuronal activity in the SFO under thirst conditions after sealing CVO vessels, supported by significantly increased neuronal c-fos staining in the SFO of GOF mice.

Results

Wnt/β-catenin signaling is not detectable in ECs of the developing CVOs

As previously shown, BAT-gal mice report active Wnt/β-catenin in brain parenchymal vessels during embryonic and early postnatal brain vascularization (Figure 1A) (Liebner et al., 2008). So far, the developmental formation of CVOs and of the SFO in particular has not been investigated in mice. We made use of BAT-gal mice to monitor Wnt/β-catenin activity in CVO vessels at different time points of embryonic and postnatal mouse development, starting from E13.5 which was the first timepoint we could identify the primordial SFO, to P21 (Figure 1B–E, Figure 1—figure supplements 1 and 2). In the SFO (Figure 1B–E) we could not detect an overlap of reporter gene-expression and CD31+ cells at any developmental stage analyzed. Instead, adjacent, non-endothelial cells in the ependymal lining as well as cells in the stroma of the organ showed active Wnt/β-catenin signaling, evidenced by nuclear β-galactosidase staining (Figure 1B–E). The latter observation suggested that Wnt growth factors are indeed available in the CVO region, but the canonical pathway was not activated in ECs.
Figure 1.

β-Catenin signaling is undetectable at different developmental stages in BAT-gal reporter mice.

(A) Endothelial reporter gene expression, indicating β-catenin activity is detectable in cortical endothelial cells at E13.5 (arrowheads). (B–E) No β-catenin signaling could be detected in ECs at developmental stages E13.5, E17.5, P0 and P14 within the SFO. Arrows point to β-galactosidase positive nuclei. Scale bar: left (200 µm), middle (50 µm) and right column (20 µm).

OVLT from E17.5 - P21 of BAT-gal reporter mice. Arrows point to β-galactosidase-positive nuclei in non-endothelial cells. Scale bar: left (200 µm), middle (50 µm), right column (20 µm).

Pineal gland (PI) of BAT-gal reporter mice in the developmental stages E17.5 and P0. Arrows point to β-galactosidase-positive nuclei in non-endothelial cells. Scale bar: left (200 µm), middle (50 µm), right column (20 µm).

Figure 1—figure supplement 1.

No endothelial β-catenin signaling in the organum vasculosum of the lamina terminalis (OVLT) during development.

OVLT from E17.5 - P21 of BAT-gal reporter mice. Arrows point to β-galactosidase-positive nuclei in non-endothelial cells. Scale bar: left (200 µm), middle (50 µm), right column (20 µm).

Figure 1—figure supplement 2.

No β-catenin activity in endothelial cells of the pineal gland (PI) during development.

Pineal gland (PI) of BAT-gal reporter mice in the developmental stages E17.5 and P0. Arrows point to β-galactosidase-positive nuclei in non-endothelial cells. Scale bar: left (200 µm), middle (50 µm), right column (20 µm).

β-Catenin signaling is undetectable at different developmental stages in BAT-gal reporter mice.

(A) Endothelial reporter gene expression, indicating β-catenin activity is detectable in cortical endothelial cells at E13.5 (arrowheads). (B–E) No β-catenin signaling could be detected in ECs at developmental stages E13.5, E17.5, P0 and P14 within the SFO. Arrows point to β-galactosidase positive nuclei. Scale bar: left (200 µm), middle (50 µm) and right column (20 µm).

No endothelial β-catenin signaling in the organum vasculosum of the lamina terminalis (OVLT) during development.

OVLT from E17.5 - P21 of BAT-gal reporter mice. Arrows point to β-galactosidase-positive nuclei in non-endothelial cells. Scale bar: left (200 µm), middle (50 µm), right column (20 µm).

No β-catenin activity in endothelial cells of the pineal gland (PI) during development.

Pineal gland (PI) of BAT-gal reporter mice in the developmental stages E17.5 and P0. Arrows point to β-galactosidase-positive nuclei in non-endothelial cells. Scale bar: left (200 µm), middle (50 µm), right column (20 µm). Similarly, we did also not observe reporter gene-expressing ECs in the OVLT and in the PI (Figure 1—figure supplements 1 and 2), providing evidence for the interpretation that CVO endothelia generally show low or no Wnt/β-catenin activity. We further wanted to address the question, whether the lack of Wnt pathway activation in CVO vessels is evolutionary conserved and analyzed the OVLT of adult Wnt pathway reporter zebrafish (Jeong et al., 2008). In all fish analyzed, OVLT vessels were largely devoid of GFP reporter gene expression, suggesting that Wnt/β-catenin activation is strongly reduced or absent in this CVO of the fish (Figure 2).
Figure 2.

Low Wnt/β-catenin signaling in the adult zebrafish OVLT.

(A) Midline sagittal section of an adult Tg(kdrl:ras-mCherry):Tg(7xTCF-Xia.Siam:EGFP) zebrafish brain. The OVLT-containing area, anatomically-defined following Jeong et al. (2008), is boxed in white. (B) Higher magnification view of (A). The dense and tortuous OVLT endothelium (red) exbibits low Wnt-reporter activity (green) compared to the surrounding vessels. (C) Same as (B) in another individual. Scale bars: (A) 500 μm, (B) and (C) 100 μm; Te, Telencephalon; Me, Mesencephalon; Di, Diencephalon; Ce, Cerebellum; Rh, Rhombencephalon.

Low Wnt/β-catenin signaling in the adult zebrafish OVLT.

(A) Midline sagittal section of an adult Tg(kdrl:ras-mCherry):Tg(7xTCF-Xia.Siam:EGFP) zebrafish brain. The OVLT-containing area, anatomically-defined following Jeong et al. (2008), is boxed in white. (B) Higher magnification view of (A). The dense and tortuous OVLT endothelium (red) exbibits low Wnt-reporter activity (green) compared to the surrounding vessels. (C) Same as (B) in another individual. Scale bars: (A) 500 μm, (B) and (C) 100 μm; Te, Telencephalon; Me, Mesencephalon; Di, Diencephalon; Ce, Cerebellum; Rh, Rhombencephalon. In order to further characterize the vascular organization of the SFO, we analyzed adult wild type (WT) mice by confocal and light sheet microscopy.

Adult SFO vessels are highly heterogenous regarding their barrier properties

As it has previously been proposed by Pócsai et al. that the SFO can be divided into a shell and a core region with different properties of astrocytes and extracellular matix (ECM), we intended to analyze the distribution of leaky and tight vessels within the SFO by staining for Plvap/Meca32 and Cldn5, respectively (Pócsai and Kálmán, 2015). In order to visualize the organs, relevant for water homeostasis, we initially applied fluorescent microscopy on sagittal sections, showing that indeed, vessels in the SFO, OVLT and PP were Plvap/Meca32+, but also showed a considerable degree of intermingling with Cldn5+ ECs (Figure 3—figure supplement 1).
Figure 3—figure supplement 1.

Vessel heterogeneity in sensory circumventricular organs (CVOs) involved in water homeostasis.

Plvap/Meca32- and Cldn5-positive ECs in vessels of the SFO, OVLT and PP, demonstrating vessels heterogeneity. Scale bar: left (200 µm), middle (50 µm), right column (20 µm).

In order to have a global view on vessel heterogeneity within the SFO, we prepared brains of WT C57Bl6 mice for whole mount staining (Figure 3). Light sheet microscopy analysis of whole mount preparations revealed that the majority of SFO vessels in the rostral portion, as well as of the shell were Plvap/Meca32-//Cldn5+, suggesting that these vessels possess BBB properties. Instead, vessels of the caudal SFO region were mainly Plvap/Meca32+//Cldn5-, providing evidence for their leaky phenotype (Figure 3D; Video 1). Higher magnification of the rostral part and the outer shell of the organ showed that some vessels exhibit a mosaic-like staining for Plvap/Meca32 and Cldn5 along their longitudinal extension (Figure 3D; Video 1). In order to visualize the alternating expression of leaky and tight vessel markers in more detail, we applied confocal microscopy on sagittal sections, revealing that neighboring cells may be positive either for Plvap/Meca32 or for Cldn5 (Figure 3C). However, some cells also showed a mixed identity, allowing the interpretation that there is a continuous transition from leaky-to-tight-to-leaky vessels in the SFO.
Figure 3.

Heterogeneous barrier phenotype in vessels of the adult wild type subfornical organ (SFO).

(A) Sagittal scheme of all circumventricular organs (CVOs) (left overview), the SFO in detail (middle sagittal, right coronal) provide an orientation. (B) Heterogenous barrier phenotype in coronal fluorescence images, (C) sagittal confocal projections of the rostral SFO tip and (D) light sheet projections of whole mount SFO samples with leaky MECA32+ and tight Cldn5+ vessels. Scale bars: (B) 100 µm, (D) first picture 50 µm and following 20 µm. SFO, Subfornical organ; OVLT, organum vasculosum of lamina terminalis; ME, median eminence; PP, posterior pituitary; SCO, subcommisural organ; PI, pinal organ; AP, area postrema; SV, septal veins; V-III, third ventricle; CP, choroid plexus; CC, corpus callosum; SF, septofimbrial nucleus; TL, tomato lectin; VR, volume rendering.

Plvap/Meca32- and Cldn5-positive ECs in vessels of the SFO, OVLT and PP, demonstrating vessels heterogeneity. Scale bar: left (200 µm), middle (50 µm), right column (20 µm).

Video 1.

Heterogeneous barrier phenotype in vessels of the adult wild type subfornical organ (SFO).

Video of a cleared whole mount preparation of the SFO and neighboring tissue, stained for Cldn5 (red), Meca32/Plvap (green) and i.v.-injected tomato-lectin-Alexa649 (blue) as a general vessel marker. Volume rendering demarcates SFO vessels.

Heterogeneous barrier phenotype in vessels of the adult wild type subfornical organ (SFO).

(A) Sagittal scheme of all circumventricular organs (CVOs) (left overview), the SFO in detail (middle sagittal, right coronal) provide an orientation. (B) Heterogenous barrier phenotype in coronal fluorescence images, (C) sagittal confocal projections of the rostral SFO tip and (D) light sheet projections of whole mount SFO samples with leaky MECA32+ and tight Cldn5+ vessels. Scale bars: (B) 100 µm, (D) first picture 50 µm and following 20 µm. SFO, Subfornical organ; OVLT, organum vasculosum of lamina terminalis; ME, median eminence; PP, posterior pituitary; SCO, subcommisural organ; PI, pinal organ; AP, area postrema; SV, septal veins; V-III, third ventricle; CP, choroid plexus; CC, corpus callosum; SF, septofimbrial nucleus; TL, tomato lectin; VR, volume rendering.

Vessel heterogeneity in sensory circumventricular organs (CVOs) involved in water homeostasis.

Plvap/Meca32- and Cldn5-positive ECs in vessels of the SFO, OVLT and PP, demonstrating vessels heterogeneity. Scale bar: left (200 µm), middle (50 µm), right column (20 µm). Video of a cleared whole mount preparation of the SFO and neighboring tissue, stained for Cldn5 (red), Meca32/Plvap (green) and i.v.-injected tomato-lectin-Alexa649 (blue) as a general vessel marker. Volume rendering demarcates SFO vessels. As we observed an alternating barrier phenotype in the SFO vasculature, we addressed the questions if dominant activation of β-catenin signaling in ECs may lead to vessel tightening of CVO vessels, particularly in the SFO.

Dominant activation of β-catenin in ECs seals SFO vessels

To dominantly activate the Wnt/β-catenin pathway in ECs, Cdh5(PAC)-CreERT2:Ctnnb1E×3fl/fl (GOF) double-transgenic mice were induced with tamoxifen (TAM) either directly after birth for three (50 µg/day, P1-P3, Figure 4—figure supplement 1) or in the adult for five (500 µg/day, 8–10 week-old mice, Figure 4) consecutive days.
Figure 4—figure supplement 1.

Tightening of subfornical organ (SFO) vessels at early postnatal stages.

(A) Cre recombinase of Cdh5(PAC)-CreERT2:Ctnnb1Ex3fl/fl was induced by tamoxifen injection (TAM) from P0 to P3. Analysis of Cldn5 and Plvap/Meca32 at P6 (A) and P14 (B) and the resulting quantification (for P6) of marker area normalized to Cdh5 area (C) (n = 3; a.u., arbitrary units). Scale bar 100 µm; error bars show ±SEM.

Figure 4.

Endothelial-specific β-catenin GOF tightens the vasculature of the subfornical organ (SFO).

(A) Mouse model and (B) schedule of endothelial-specific β-catenin GOF induction by tamoxifen (TAM) . Coronal view of the subfornical organ (SFO) (C) 16 , (D) 19 and (E) 26 days after the first TAM injection. (F) Quantification for Cldn5 and (G) Meca32-covered vessel area within the SFO (n = 3 per group). (H) Relative mRNA expression of SFO whole mount tissue (n = 1 of pooled samples (Cre- = 18 mice, Cre+ = 17 mice)). Scale bars: (C–E) 100 µm; error bars show ±SEM.

(A) Cre recombinase of Cdh5(PAC)-CreERT2:Ctnnb1Ex3fl/fl was induced by tamoxifen injection (TAM) from P0 to P3. Analysis of Cldn5 and Plvap/Meca32 at P6 (A) and P14 (B) and the resulting quantification (for P6) of marker area normalized to Cdh5 area (C) (n = 3; a.u., arbitrary units). Scale bar 100 µm; error bars show ±SEM.

Cdh5(PAC)-CreERT2:mTmGfl/wt mice either injected with tamoxifen or corn oil were analyzed for recombination. Scale bar 100 µm.

(A) Scheme of used mouse lines. (B) Adult SFO from control (Cre-) and β-catenin GOF (Cre+) mice (C). Overview of Sox17 induction in Cre- and Cre+ mice in the SFO. (D) Quantification (n = 3) and a higher magnification of confocal Sox17 staining. Asterisks indicate positive Sox17 staining in endothelial cells. Scale bar 100 µm; error bars show ±SEM.

Endothelial-specific β-catenin GOF tightens the vasculature of the subfornical organ (SFO).

(A) Mouse model and (B) schedule of endothelial-specific β-catenin GOF induction by tamoxifen (TAM) . Coronal view of the subfornical organ (SFO) (C) 16 , (D) 19 and (E) 26 days after the first TAM injection. (F) Quantification for Cldn5 and (G) Meca32-covered vessel area within the SFO (n = 3 per group). (H) Relative mRNA expression of SFO whole mount tissue (n = 1 of pooled samples (Cre- = 18 mice, Cre+ = 17 mice)). Scale bars: (C–E) 100 µm; error bars show ±SEM.

Tightening of subfornical organ (SFO) vessels at early postnatal stages.

(A) Cre recombinase of Cdh5(PAC)-CreERT2:Ctnnb1Ex3fl/fl was induced by tamoxifen injection (TAM) from P0 to P3. Analysis of Cldn5 and Plvap/Meca32 at P6 (A) and P14 (B) and the resulting quantification (for P6) of marker area normalized to Cdh5 area (C) (n = 3; a.u., arbitrary units). Scale bar 100 µm; error bars show ±SEM.

Recombination of Cdh5(PAC)-CreERT2 in brain vasculature.

Cdh5(PAC)-CreERT2:mTmGfl/wt mice either injected with tamoxifen or corn oil were analyzed for recombination. Scale bar 100 µm.

Pdgfb-iCreERT2:Ctnnb1fl/wt show tightening of subfornical organ (SFO) vasculature.

(A) Scheme of used mouse lines. (B) Adult SFO from control (Cre-) and β-catenin GOF (Cre+) mice (C). Overview of Sox17 induction in Cre- and Cre+ mice in the SFO. (D) Quantification (n = 3) and a higher magnification of confocal Sox17 staining. Asterisks indicate positive Sox17 staining in endothelial cells. Scale bar 100 µm; error bars show ±SEM. We initially determined recombination efficiency in the brain by analyzing Cdh5(PAC)-CreERT2:mTmG reporter mice (Wang et al., 2010Muzumdar et al., 2007), suggesting that VE-cadherin efficiently drives endothelial recombination in brain vessels (Figure 4—figure supplement 2).
Figure 4—figure supplement 2.

Recombination of Cdh5(PAC)-CreERT2 in brain vasculature.

Cdh5(PAC)-CreERT2:mTmGfl/wt mice either injected with tamoxifen or corn oil were analyzed for recombination. Scale bar 100 µm.

β-Catenin GOF pups were analyzed at P6 and P14 and compared to respective controls. At both timepoints analyzed (P6 and P14), control vessels exhibited high levels of Plvap/Meca32 and low levels of Cldn5 immunolabeling (Figure 4—figure supplement 1A,B). Interestingly, endothelial-specific β-catenin GOF reverted this phenotype, resulting in significantly decreased Plvap/Meca32 immunoreactivity, whereas Cldn5 expression was markedly increased in these vessels without any changes in VE-cadherin immunolabeling at P6 (Figure 4—figure supplement 1C). In the adult, the same antagonistic regulation of Plvap/Meca32 and Cldn5 by β-catenin GOF was observed as in postnatal stages (Figure 4B–D; quantification 4E, F). When analyzing different timepoints after TAM induction of adult GOF mice for the expression of Plvap/Meca32 and Cldn5, we observed that activation of β-catenin signaling significantly suppressed Plvap/Meca32 and induced Cldn5 already by day 16 (Figure 4E,F). Maximal Cldn5 induction was observed after 26 days, being significantly higher than at day 19 after the first TAM injection (Figure 4E). Analysis of pooled mRNA from 17 whole SFOs from GOF or control mice, revealed that Plvap/Meca32 was indeed down-regulated in the GOF condition on the mRNA level, whereas Cldn5 did not show an obvious regulation. This suggested that transformation of the leaky into a tight vessel phenotype in the SFO by β-catenin GOF requires around 26 days after induction of recombination. To understand if beside Cldn5 also other tight junction components are regulated upon β-catenin activation in SFO endothelial cells, we stained for occludin (Ocln) and zonula occludens 1 (ZO-1). Analyzing the junctional localization of Ocln normalized to the vessel length in the SFO, we observed only a punctuated staining of Ocln at endothelial cell-cell junctions of controls as previously described by Morita et al. (Morita and Miyata, 2012). In vessels of GOF mice we noted a significant increase in line-like junctional Ocln staining compared to controls (Figure 5A,B; quantification Figure 5C). Further analysis of mRNA of pooled SFO samples from GOF or control mice, revealed that Ocln, like Cldn5, did not show an obvious regulation in the GOF condition (Figure 5D). As opposed to Cldn5 and Ocln, ZO-1 showed only a moderately increased localization at cell-cell junctions in SFO vessels of GOF mice (Figure 5—figure supplement 1). Specifically, ZO-1 was consistently present at inter-endothelial junctions of the SFO in the control condition.
Figure 5.

Endothelial-specific β-catenin GOF leads to increased occludin localization at cell-cell junctions in the vasculature of the subfornical organ (SFO).

(A) Coronal view of the subfornical organ (SFO) 26 days after the first TAM injection; dashed line demarcates the SFO. (B) Higher magnification of an SFO vessel indicated by the rectangular inset in A, white dashed lines show Meca32+, green dashed lines show Meca32 vessels, arrows indicate junctional Ocln staining. (C) Quantification for Ocln junctional length normalized to the vessel area within the SFO (n = 3 per group). (D) Relative mRNA expression of SFO whole mount tissue (n = 1 of pooled samples (Cre-=18 mice, Cre+=17 mice)) . Scale bars: (A) 50 µm, (B) 10 µm; error bars show ±SEM.

Coronal view of the subfornical organ (SFO) 26 days after the first TAM injection stained for podocalyxin as a vascular/luminal marker, ZO-1 and DAPI (A). Higher magnification of an SFO vessel indicated by the rectangular inset in A (B). Dashed line demarcates the SFO. Scale bars: 25 µm (A), 10 µm (B).

Figure 5—figure supplement 1.

Endothelial-specific β-catenin GOF did not lead to an evident increase in ZO-1 localization at cell-cell junctions in the vasculature of the subfornical organ (SFO).

Coronal view of the subfornical organ (SFO) 26 days after the first TAM injection stained for podocalyxin as a vascular/luminal marker, ZO-1 and DAPI (A). Higher magnification of an SFO vessel indicated by the rectangular inset in A (B). Dashed line demarcates the SFO. Scale bars: 25 µm (A), 10 µm (B).

Endothelial-specific β-catenin GOF leads to increased occludin localization at cell-cell junctions in the vasculature of the subfornical organ (SFO).

(A) Coronal view of the subfornical organ (SFO) 26 days after the first TAM injection; dashed line demarcates the SFO. (B) Higher magnification of an SFO vessel indicated by the rectangular inset in A, white dashed lines show Meca32+, green dashed lines show Meca32 vessels, arrows indicate junctional Ocln staining. (C) Quantification for Ocln junctional length normalized to the vessel area within the SFO (n = 3 per group). (D) Relative mRNA expression of SFO whole mount tissue (n = 1 of pooled samples (Cre-=18 mice, Cre+=17 mice)) . Scale bars: (A) 50 µm, (B) 10 µm; error bars show ±SEM.

Endothelial-specific β-catenin GOF did not lead to an evident increase in ZO-1 localization at cell-cell junctions in the vasculature of the subfornical organ (SFO).

Coronal view of the subfornical organ (SFO) 26 days after the first TAM injection stained for podocalyxin as a vascular/luminal marker, ZO-1 and DAPI (A). Higher magnification of an SFO vessel indicated by the rectangular inset in A (B). Dashed line demarcates the SFO. Scale bars: 25 µm (A), 10 µm (B). As the upregulation of the junctional proteins Cldn5 and Ocln support the interpretation of an SFO vessel tightening in GOF mice, it remained to be clarified if vessel permeability is indeed affected by dominant β-catenin activation in ECs. To this end, GOF and control mice were intravenously injected with FITC-bovine serum albumin (FITC-BSA) (~68 kDa), and examined after 1.5 hrs of circulation. Analysis of FITC-BSA leakage normalized to vessel area revealed a significant reduction of extravasation in SFO vessels of the GOF versus control mice (Figure 6). Specifically, the leaky vessels in the controls showed pronounced FITC-BSA distribution in the circumference of vessels indicated by a prominent cloudy FITC signal in the entire SFO, whereas in the GOF condition the tracer remained confined to the vessel lumen (Figure 6C).
Figure 6.

Reduction of vascular permeability by endothelial specific β-catenin gain-of-function (GOF).

(A) Overview and (C) high magnification shows leakage of FITC labelled albumin within the SFO of Cre- and Cre+ mice. Dashed lines indicate SFO (A) or vessel outline (C). (B) Quantification of FITC-positive SFO area normalized to the vessel area (Cre- = 4 mice, Cre+ = 3 mice). Scale bars: (A) 100 µm; (C) 50 µm; error bars show ±SEM.

Reduction of vascular permeability by endothelial specific β-catenin gain-of-function (GOF).

(A) Overview and (C) high magnification shows leakage of FITC labelled albumin within the SFO of Cre- and Cre+ mice. Dashed lines indicate SFO (A) or vessel outline (C). (B) Quantification of FITC-positive SFO area normalized to the vessel area (Cre- = 4 mice, Cre+ = 3 mice). Scale bars: (A) 100 µm; (C) 50 µm; error bars show ±SEM. To strengthen the observation of SFO vessel tightening, we performed β-catenin GOF experiments also with the Pdgfb-iCreERT2 mouse driver line (Claxton et al., 2008), resulting in comparable regulation of Plvap/Meca32 and Cldn5 (Figure 4—figure supplement 3A,B). Activation of the Wnt/β-catenin pathway was supported by significantly increased nuclear Sox17 localization that was reported to be a downstream target of Wnt/β-catenin and to be upstream of Notch (Corada et al., 2013; Zhou et al., 2015) (Figure 4—figure supplement 3C,D).
Figure 4—figure supplement 3.

Pdgfb-iCreERT2:Ctnnb1fl/wt show tightening of subfornical organ (SFO) vasculature.

(A) Scheme of used mouse lines. (B) Adult SFO from control (Cre-) and β-catenin GOF (Cre+) mice (C). Overview of Sox17 induction in Cre- and Cre+ mice in the SFO. (D) Quantification (n = 3) and a higher magnification of confocal Sox17 staining. Asterisks indicate positive Sox17 staining in endothelial cells. Scale bar 100 µm; error bars show ±SEM.

Given the increase in Cldn5 expression in SFO vessels, we addressed if the endothelial tightening may also have an effect on the organization of the NVU within the core region of the SFO, in which no astrocytic endfeet are formed around vessels. Therefore, we stained GOF and control SFOs for the astrocytic endfeet markers aquaporin-4 (Aqp4), α-dystroglycanDag) and Kir4.1 (Figure 7—figure supplements 1 and 2), as well as the ECM markers laminin α 2 (Lama2) and collagen IV (ColIV) (Figure 7—figure supplement 2). All markers revealed the expected polarized distribution around BBB vessels in the striatum, nicely confirming staining specificity (Figure 7—figure supplements 1A and 2A,D).
Figure 7—figure supplement 1.

Endothelial β-catenin GOF does not affect astrocytic endfoot polarization of α-dystroglycan (α-Dag) and Kir4.1 within the subfornical organ (SFO).

Striatal BBB-vessel showing a polarized distribution of α-Dag and Kir4.1 in AC endfeet. Lumen is stained by Podxl (asterisk) (A). Coronal overview of the subfornical organ (SFO) (B); rectangular inset demarcates area for higher magnification in (C). Dashed lines outline SFO vessels. Scale bar show 2 µm (A), 50 µm (B), 10 µm (C).

Figure 7—figure supplement 2.

Endothelial β-catenin GOF does not affect the ECM of astrocytic endfeet and ECs within the subfornical organ (SFO).

Striatal BBB-vessel showing a polarized distribution of Lama2 and Aqp4 in AC endfeet. Lumen is stained by Podxl (asterisk) (A). Coronal overview of the subfornical organ (SFO) (B); rectangular inset demarcates area for higher magnification in (C). Striatal BBB-vessel showing a polarized distribution of ColIV (green) but no Meca32 (white) in ECs (D). Coronal overview SFO, rectangular inset demarcates area for higher magnification in F (E); white dashed lines show Meca32+, red dashed lines show Meca32 vessels (F). Dashed lines outline SFO vessels; scale bars show 2 µm (A), 50 µm (B), 10 µm (C), 2.5 µm (D), 50 µm (E), 10 µm (F).

As previously shown for astrocytic endfeet proteins (Pócsai and Kálmán, 2015), leaky SFO vessels did not exhibit pronounced staining of the polarity markers αDag and Kir4.1 (Figure 7—figure supplements 1B,C and and 2B,C). Moreover, none of these stainings were found to be affected by the GOF conditions, meaning that no distinct staining of vascular endfeet could be observed. Specifically, Aqp4 and αDag showed only a weak, unpolarized localization around vessels in GOF and controls, whereas the sodium channel Kir4.1 was mainly expressed by cells morphologically resembling tanycytes in the SFO (Figure 7—figure supplements 1B,C and and 2B,C). The ECM components Lama2 and ColIV, revealed that in GOF and in control vessels of the SFO a vascular and an astrocytic basal lamina was present with no obvious differences in structure and distribution between conditions (Figure 7—figure supplement 2). In order to further characterize the blood vessels in the SFO of β-catenin GOF mice, we employed electron microscopy to visualize their subcellular phenotype. As expected, the vessels in control SFOs showed the typical large and lacuna-like structure with an extensive ECM circumference (Figure 7A–C). Moreover, fenestrations were frequently observed in the control condition, a morphological feature that is consistent with a high Plvap/Meca32 expression and a permeable phenotype (Figure 7C; quantification Figure 7D). Although the vessel morphology did not show major differences regarding vessel perimeter and structure, the vessels of the GOF mice appeared to have a more compact ECM deposition in their circumference (Figure 7A–C). Endothelial vesicles did not show obvious alterations between GOF and controls (data not shown). Instead, the junctional area of GOF vessels was considerably more elaborate compared to the controls, which exhibited typical blunt-ending connections (Figure 7C). Additionally, fenestrations were significantly reduced in GOF mice, being in line with the reduction of Plvap/Meca32 immunostaining (Figure 4E; quantification Figure 4G) and further suggesting that β-catenin GOF in ECs is crucial for the suppression of a leaky vessel phenotype.
Figure 7.

Tightening of vessels in the subfornical organ (SFO) on cellular level.

(A) Semithin sections of SFO of endothelial-specific β-catenin GOF (Cre+) and controls (Cre-). Electron microscopic picture of Cre- (B), (C), left column) and Cre+ (B), (C), right column). Black arrow heads indicate fenestrations, with arrows endothelial junctions, asterisks show vesicles. AC, astrocyte; EC, endothelial cell; L, lumen; PC, pericyte. (D) Number of fenestrations are quantified in three vessel sections per animal (n = 4). Error bars show ±SEM.

Striatal BBB-vessel showing a polarized distribution of α-Dag and Kir4.1 in AC endfeet. Lumen is stained by Podxl (asterisk) (A). Coronal overview of the subfornical organ (SFO) (B); rectangular inset demarcates area for higher magnification in (C). Dashed lines outline SFO vessels. Scale bar show 2 µm (A), 50 µm (B), 10 µm (C).

Striatal BBB-vessel showing a polarized distribution of Lama2 and Aqp4 in AC endfeet. Lumen is stained by Podxl (asterisk) (A). Coronal overview of the subfornical organ (SFO) (B); rectangular inset demarcates area for higher magnification in (C). Striatal BBB-vessel showing a polarized distribution of ColIV (green) but no Meca32 (white) in ECs (D). Coronal overview SFO, rectangular inset demarcates area for higher magnification in F (E); white dashed lines show Meca32+, red dashed lines show Meca32 vessels (F). Dashed lines outline SFO vessels; scale bars show 2 µm (A), 50 µm (B), 10 µm (C), 2.5 µm (D), 50 µm (E), 10 µm (F).

Tightening of vessels in the subfornical organ (SFO) on cellular level.

(A) Semithin sections of SFO of endothelial-specific β-catenin GOF (Cre+) and controls (Cre-). Electron microscopic picture of Cre- (B), (C), left column) and Cre+ (B), (C), right column). Black arrow heads indicate fenestrations, with arrows endothelial junctions, asterisks show vesicles. AC, astrocyte; EC, endothelial cell; L, lumen; PC, pericyte. (D) Number of fenestrations are quantified in three vessel sections per animal (n = 4). Error bars show ±SEM.

Endothelial β-catenin GOF does not affect astrocytic endfoot polarization of α-dystroglycan (α-Dag) and Kir4.1 within the subfornical organ (SFO).

Striatal BBB-vessel showing a polarized distribution of α-Dag and Kir4.1 in AC endfeet. Lumen is stained by Podxl (asterisk) (A). Coronal overview of the subfornical organ (SFO) (B); rectangular inset demarcates area for higher magnification in (C). Dashed lines outline SFO vessels. Scale bar show 2 µm (A), 50 µm (B), 10 µm (C).

Endothelial β-catenin GOF does not affect the ECM of astrocytic endfeet and ECs within the subfornical organ (SFO).

Striatal BBB-vessel showing a polarized distribution of Lama2 and Aqp4 in AC endfeet. Lumen is stained by Podxl (asterisk) (A). Coronal overview of the subfornical organ (SFO) (B); rectangular inset demarcates area for higher magnification in (C). Striatal BBB-vessel showing a polarized distribution of ColIV (green) but no Meca32 (white) in ECs (D). Coronal overview SFO, rectangular inset demarcates area for higher magnification in F (E); white dashed lines show Meca32+, red dashed lines show Meca32 vessels (F). Dashed lines outline SFO vessels; scale bars show 2 µm (A), 50 µm (B), 10 µm (C), 2.5 µm (D), 50 µm (E), 10 µm (F). Upon the observation that dominant endothelial activation of Wnt/β-catenin signaling established barrier properties in SFO vessel, we wanted to elucidate if the tightening of SFO vessels affects neuronal function in this organ.

Endothelial β-catenin GOF results in augmented neuronal activity in the SFO of water-restricted mice

In order to understand if dominant activation of β-catenin signaling in ECs of the SFO may influence neuronal activity in the context of water homeostasis and drinking behavior, we induced thirst in adult mice and analyzed neuronal activity. To this end, WT mice were either kept for 72 hrs under water restriction (Figure 8A) or were intraperitoneally injected with a hyperosmolar NaCl (3 M) solution 50 min prior to sample collection (Figure 8B) and subsequent assessment of neuronal activation by c-fos staining in the SFO (Figure 8C,D). The Nissl staining of the so-called Nissl flounders nicely documents the neuronal identity of the c-fos+ cells (Figure 8). As opposed to the general nuclear staining by the fluorescent Nissl stain, the flounders are specific for neurons only.
Figure 8.

Neuronal activation via thirst induction in wild type animals.

(A) Schedule of water restriction paradigm. Small blue droplets represent a restricted amount of water in a 24 hrs cycle according to the bodyweight (BW). (C) c-fos activation in the SFO of mice with water ad libitum and animals restricted for 72 hrs. (E) quantification of c-fos positive/DAPI nuclei in the SFO (n = 3). (B) Experimental setting of hyperosmolar sodium chloride injection. Animals get either isotonic (0.15 M) or 3 M sodium chloride intraperitoneally injection (150 µl/20 g mouse). c-fos analysis 50 min after NaCl injection (D) and quantification (F) (n = 6). Dashed lines indicate Nissl flounders confirming neuronal idendity of c-fos+ (G) and c-fos- (H) cells. Scale bars: (C), (D) 50 µm, (G), (H) 2 µm; error bars show ±SEM.

Experimental setting of hyperosmolar sodium chloride injection (A). Animals received i.p. injections (150 µl/20 g mouse) of either isotonic (0.15 M), 2 M or 3 M sodium chloride solution. After 50 min in the absence of water, the SFO was analyzed for c-fos (C) and quantified (B) (n = 3 per group). Raw data are presented in the additional source data file. Scale bars: 100 µm; error bars show ±SEM.

Neuronal activation via thirst induction in wild type animals.

(A) Schedule of water restriction paradigm. Small blue droplets represent a restricted amount of water in a 24 hrs cycle according to the bodyweight (BW). (C) c-fos activation in the SFO of mice with water ad libitum and animals restricted for 72 hrs. (E) quantification of c-fos positive/DAPI nuclei in the SFO (n = 3). (B) Experimental setting of hyperosmolar sodium chloride injection. Animals get either isotonic (0.15 M) or 3 M sodium chloride intraperitoneally injection (150 µl/20 g mouse). c-fos analysis 50 min after NaCl injection (D) and quantification (F) (n = 6). Dashed lines indicate Nissl flounders confirming neuronal idendity of c-fos+ (G) and c-fos- (H) cells. Scale bars: (C), (D) 50 µm, (G), (H) 2 µm; error bars show ±SEM.

Dose dependent neuronal activity upon sodium chloride injection.

Experimental setting of hyperosmolar sodium chloride injection (A). Animals received i.p. injections (150 µl/20 g mouse) of either isotonic (0.15 M), 2 M or 3 M sodium chloride solution. After 50 min in the absence of water, the SFO was analyzed for c-fos (C) and quantified (B) (n = 3 per group). Raw data are presented in the additional source data file. Scale bars: 100 µm; error bars show ±SEM. Both thirst-inducing paradigms lead to a significant increase in c-fos+ neurons in the SFO of WT mice (Figure 8). We could also show a dose-dependent c-fos activation in thirst induction by hyperosmolar NaCl, comparing 2 M and 3 M solutions (Figure 8—figure supplement 1). Given that water restriction is a more physiological setting which reflects the restricted availability of resources in nature, we made use of this paradigm to investigate the influence of β-catenin GOF on neuronal activity in the SFO.
Figure 8—figure supplement 1.

Dose dependent neuronal activity upon sodium chloride injection.

Experimental setting of hyperosmolar sodium chloride injection (A). Animals received i.p. injections (150 µl/20 g mouse) of either isotonic (0.15 M), 2 M or 3 M sodium chloride solution. After 50 min in the absence of water, the SFO was analyzed for c-fos (C) and quantified (B) (n = 3 per group). Raw data are presented in the additional source data file. Scale bars: 100 µm; error bars show ±SEM.

Under control conditions, in which mice received water ad libitum, we could not detect any genotype-specific differences in c-fos+ nuclei in the SFO between control and GOF animals (data not shown). β-Catenin GOF and control mice were subjected to water restriction 26 days after induction by TAM (Figure 9A). In case of water restriction for 72 hrs (Figure 9A) a slight, but stable weight loss was induced in GOF and control mice in the same manner (Figure 9B). Analysis of c-fos activation revealed a significantly higher neuronal activity in the SFO of GOF mice (Figure 9D). This suggests that tightening SFO blood vessels may have physiological consequences for the water homeostasis in mice.
Figure 9.

Vascular tightening effects increased neuronal activity in the subfornical organ (SFO) under thirst conditions.

(A) Experimental setup of water restriction in β-catenin GOF and control mice after tamoxifen (TAM) injection. (B) Monitoring of BW for GOF and control mice under water restriction. (D) c-fos activation (dashed lines indicate the SFO) and (C) quantification of c-fos positive/DAPI nuclei in the SFO (n(Cre-) = 9, n(Cre+) = 8). Scale bars show 50 µm; error bars show ±SEM.

Vascular tightening effects increased neuronal activity in the subfornical organ (SFO) under thirst conditions.

(A) Experimental setup of water restriction in β-catenin GOF and control mice after tamoxifen (TAM) injection. (B) Monitoring of BW for GOF and control mice under water restriction. (D) c-fos activation (dashed lines indicate the SFO) and (C) quantification of c-fos positive/DAPI nuclei in the SFO (n(Cre-) = 9, n(Cre+) = 8). Scale bars show 50 µm; error bars show ±SEM.

Discussion

The present study deals with the regulation of the leaky vascular phenotype in the CVOs and in the SFO in particular. Specifically, we addressed the questions, a) if the Wnt/β-catenin pathway is operational in ECs of CVOs during murine development and in the adult mouse and zebrafish, b) if endothelial-specific, dominant activation of β-catenin transcription could convert the leaky vascular phenotype in CVOs and c) if the latter may have an effect on CVO function. The principle findings of this study are: 1) Wnt/β-catenin signaling is undetectable in CVO vessels during BAT-gal reporter mouse development; 2) similarly, β-catenin-mediated transcription is strongly reduced in the adult zebrafish OVLT; 3) SFO vessels are heterogenous regarding the expression of Plvap/Meca32 and Cldn5; 4) upon genetic β-catenin GOF in ECs, leaky SFO vessels are partially converted into tight vessels; 5) functional conversion of SFO vessel towards a BBB-like identity affects neuronal activity in the SFO. Wnt/β-catenin is crucial for brain vascularization and BBB development, by regulating endothelial sprouting as well as by promoting a BBB expression profile in ECs, respectively (Vanhollebeke et al., 2015; Liebner et al., 2008; Daneman et al., 2009; Stenman et al., 2008; Zhou et al., 2014). CVOs are well known, but poorly investigated, structures in the midline of vertebrate brains, conferring neurosensory and/or neurosecretory function. Because of this physiological function, CVO blood vessels were described for a long time to lack BBB characteristics, a feature that is considered to be important for allowing neurons to ‘sense’ salts, hormones, lipids and toxic compounds in the blood (Sisó et al., 2010; Kiecker, 2018). Indeed, it has been shown that neurons send axons into the extended perivascular space, which is in line with their sensory function (Morita and Miyata, 2012). The peculiar, leaky specialization of the CVO vascular system is well documented, showing tortuous and fenestrated vessels with poorly developed inter-endothelial junctions (McKinley et al., 2003). However, how this specialization is induced on a molecular level during development and how it is maintained is currently not well understood. Vascular endothelial growth factor (VEGF) is the best described inducing factor for endothelial fenestrations and is reported to be expressed in sensory CVOs as well as in other tissues that physiologically require endothelial fenestrations, such as the choroid and the ciliary body of the eye (Furube et al., 2014; Ford et al., 2012; Kinnunen and Ylä-Herttuala, 2012). As the Wnt/β-catenin pathway is considered a master switch for barriergenesis, we hypothesized that β-catenin transcription is not operational during CVO vascularization. The data provided here support this interpretation, as in BAT-gal reporter mice, from the initial identification of the SFO primordium at E13.5, none of the investigated developmental stages revealed a single β-galactosidase-positive vessel within the CVOs (Figure 1; Figure 1—figure supplements 1 and 2). Although this finding may formally not exclude low level activation of the pathway in ECs, the observation that neighboring, non-endothelial cells in the CVOs, do show Wnt pathway activation, supports the interpretation of low or absent Wnt/β-catenin signaling in CVO ECs. Specifically, we observed that the ependymal cells covering the SFO as well as stromal cells in the core of the organ show Wnt/β-catenin pathway activation (Figure 1). Quantitative RT-PCR revealed also expression of Wnt3a, Wnt7 as well as Fzd4 in the SFO, suggesting that at least the BBB-inducing machinery is expressed (data not shown). As also in the adult, β-catenin-mediated transcription in ECs is required to maintain BBB function, the absence of reporter activity in mouse (data not shown) or zebrafish models presented in this study, further underlines that Wnt is evidently not operational in CVO vessels. This may support the hypothesis that Wnt/β-catenin signaling is actively suppressed in the SFO and likely also in other CVOs that have fenestrated vessels. So far, no conclusive data are available demonstrating Wnt pathway inhibitors in the CVOs, however, it has been shown that expression of the soluble frizzled receptor protein 1 (Sfrp1) is about 30 times higher in the rat choroid plexus (CP), that also lacks BBB vessels, compared to the striatum and parietal cortex (Bowyer et al., 2013). Nevertheless, a detailed analysis of the CVOs regarding cell type-specific expression profiles has not been published yet. Still, it has to be noted that vessels in the SFO, OVLT and PP are heterogenous regarding the expression of Plvap/Meca32 and Cldn5 (Figure 3, Figure 3—figure supplement 1). Similarly, differentially tight vessels were also shown in other CVOs (Morita and Miyata, 2012). This raises the question if in the CVOs, unlike in the brain parenchyma a ‘…gradual phenotypic change (zonation) along the arteriovenous axis…’ is realized (Vanlandewijck et al., 2018), or if alternating endothelial differentiation might be established by factors yet to be discovered. The present findings may suggest that, at least to some degree, vascular phenotypes in the SFO are locally regulated, which would be in line with their role providing local access for neurons to the blood milieu. If vessel differentiation might also be dynamically regulated to control water homeostasis in a circadian rhythm (Gizowski et al., 2016), is currently unknown and subject to ongoing investigation. In this regard it is interesting to note however, that Cldn5 and Ocln mRNA were not significantly upregulated when analyzed in whole mount dissected SFOs from GOF mice (Figures 4H and 5D). This might be due to several reasons, such as signal masking by other vessels in the whole mount preparations. Alternatively, this finding might support the interpretation that Cldn5 and Ocln are not transcriptionally regulated by β-catenin, but rather regulated on a post-transcriptional level. Interestingly, there is still some controversy about Cldn5 regulation by Wnt/β-catenin, as it has been shown by Taddei et al. that β-catenin cooperates with FOXO1 to suppress Cldn5 at the promotor level under pro-angiogenic conditions (Taddei et al., 2008). On the other hand, it has been shown that Sox18, a member of the SOX family of high-mobility group box transcription factors, is instrumental in activating Cldn5 transcription, contributing to endothelial barrier formation (Fontijn et al., 2008). Given the high redundancy of SoxF genes (Sox7, 17, 18) (Zhou et al., 2015), it might be feasible that Sox17, that we report here to be upregulated in SFO vessels of β-catenin GOF mice (Figure 5—figure supplement 1), mediates Cldn5 regulation. Although the regulation of Cldn5 on the promotor level and the role of β-catenin herein requires additional investigation, the tightening of SFO vessels by Cldn5 protein upregulation in β-catenin GOF mice is consistent with previous reports in other regions of the brain (Zhou et al., 2014). Interestingly, in the SFO of GOF mice, we also observed a significantly augmented junctional localization of Ocln, which is in line with the endothelial tightening, but, like for Cldn5, at which molecular level the Ocln regulation occurs remains to be clarified. Moreover, the adherens and tight junction-associated protein ZO-1 qualitatively showed a slight increase in junctional continuity in the GOF condition, which fits with the overall formation of more elaborate junctional complexes between ECs. The fact that ZO-1 exhibits also junctional staining in the controls (Figure 5—figure supplement 1), is consistent with its role in VE-cadherin-based adherens junctions, which are also formed by SFO vessels (Figure 4—figure supplement 1) (Tornavaca et al., 2015). Beside the mere upregulation of Cldn5 and Ocln, endothelial β-catenin GOF resulted in the abolishment of fenestrations and strengthened inter-endothelial junctions. These findings are well in line with a reduction in VEGF signaling in glioma ECs upon Wnt/β-catenin activation via the downregulation of VEGF receptor 2 (VEGFR2, flk-1) and upregulation of VEGFR1 (Reis et al., 2012). This suggests that also upon β-catenin GOF in CVO vessels the responsiveness of ECs for VEGF could be reduced, leading to regression of fenestrations. Interestingly, the structural components of the NVU such as astrocytic endfeet and ECM, additional crucial BBB features, were not observed to be changed by the GOF condition (Figure 7—figure supplements 1 and 2). Also, the vessel coverage by pericytes showed no major changes in the SFO comparing GOF and controls (data not shown). If the perivascular fibroblasts, recently described by Vanlandewijck et al. (Vanlandewijck et al., 2018), are present at SFO vessels and if yes, whether they are affected by β-catenin GOF in ECs has to be determined in future investigations. Hence, to form the NVU structure might require additional cues and/or prolonged time to form, although the latter explanation might not be as likely as the first, given that even after sixty days after TAM injection the control-like phenotype persisted (data not shown). These findings support the conclusion that tightening the ECs in the SFO via β-catenin GOF does not lead to pronounced structural alterations at the NVU. As the leaky vessels of the SFO core are surrounded by a prominent perivascular space, which is considered to be important for the communication of neuronal axons with the blood milieu, it might be therapeutically beneficial that the NVU is not affected by the dominant activation of endothelial β-catenin. One of the main questions investigated in the present work is how the vasculature in the sensory CVOs like the SFO functionally cooperates with the neurons and other stromal cells to achieve proper physiological regulation of fundamental body parameters like water homeostasis. So far, the vasculature has drawn little attention in this respect, even though considerable progress has recently been made to unravel the regulation of drinking behavior by the SFO, OVLT and the PP (Gizowski et al., 2016; Matsuda et al., 2017; Oka et al., 2015; Zimmerman et al., 2016; Augustine et al., 2018). Specifically, it was shown for the SFO that two distinct populations of neurons expressing ETV-1 and Vgat mediate thirst-ON and thirst-OFF signals, respectively (Oka et al., 2015). Here we provide evidence for an essential role of endothelial barrier function in neuronal activation in water restricted mice, as neuronal c-fos reactivity was increased in water-deprived GOF animals (Figure 9). How this finding relates to the drinking behavior and to the activity of excitatory and inhibitory neuronal signals to and from the median preoptic nucleus (MnPO), which was shown to host the behavioral output neurons (Augustine et al., 2018), is beyond the scope of this study and is subject to future work. Moreover, it remains to be clarified if the increased c-fos signal in the SFO of GOF mice is directly caused by the tightened vessel phenotype, or indirectly affected by an altered angiocrine profile of the tightened endothelium, potentially leading to altered drinking behavior. Preliminary analysis of primary mouse brain microvascular ECs (MBMECs) treated with Wnt3a revealed no regulation of VEGF that was previously described to be neuroactive (data not shown) (Mackenzie and Ruhrberg, 2012). Although own preliminary experiments aiming to pharmacologically tighten CVO vessels with a systemically administered Wnt/β-catenin activator did not result in SFO vessel tightening (data not shown), this might be a potential way to therapeutically modulate water intake. Interestingly, patients that chronically receive LiCl, an FDA-approved drug for bipolar disorders and a potent Wnt/β-catenin activator, frequently develop polyuria that is linked to altered anti-diuretic hormone (ADH; vasopressin) function, which is released by the PP. Moreover, many patients develop polydipsia and urinate more frequently (Malhi, 2015). Hence in-depth investigation of the pharmacologic modulation of SFO vessel permeability is required. Although the detailed mechanisms underlying the neuro-vascular coupling in the CVOs have to be investigated in more detail, in light of the present work however, the CVO vasculature likely participates actively in controlling water homeostasis.

Materials and methods

Animal models

Mice were housed under standard conditions with 12 hrs light dark cycle and water and mouse chow available ad libitum if not declared otherwise. All experimental protocols, handling and use of mice were approved by the Regional Council Darmstadt, Germany (V54-19c20/15-FK/1052 and V54-19c20/15-FK/1108). Wildtype (WT) C57BL6/J as well as transgenic animals were used. The following mouse strains were included Cdh5(PAC)-CreERT2 (Wang et al., 2010), PDGFB-iCreERT2 (Claxton et al., 2008), Ctnnb1Ex3fl/fl (Harada et al., 1999), BAT-gal+/wt Wnt/β-catenin reporter (Maretto et al., 2003) and mT/mG (Muzumdar et al., 2007). Zebrafish (Danio rerio) were maintained under standard conditions at 28°C and a 14 hr light/10 hr dark cycle, in accordance with European and national animal welfare and ethical guidelines (protocol approval number: CEBEA-IBMM2017-22:65). Transgenic lines used in this study were Tg(kdrl:Hsa.HRAS-mCherry)s896 (Chi et al., 2008) and Tg(7xTCF-Xla.Siam:GFP)ia4 (Moro et al., 2012). After euthanasia with 0.3 mg.ml-1 Tricaine methanesulfonate (MS-222) for 10 min, adult brains aged 6 to 12 months were dissected and fixed overnight in sweet fixative (4% PFA, 4% sucrose in PBS). Brains were washed in PBS and embedded in 4% low-melting agarose. 300 μm sections were obtained using a LeicaVT1200s automated vibratome (Leica Biosystems). Sections were imaged on a Zeiss LSM710 confocal microscope using separate channels.

Development assays

To investigate β-catenin activity in ECs, Wnt/β-catenin reporter mice (BAT-gal+/wt) were bred with C57BL6/J mice to generate either heterozygous positive pups for β-galactosidase or homozygous negative control littermates. At different developmental stages (embryonic days E13.5, E17.5) embryos were harvested. For postnatal day 0 (P0) pups were sacrificed by decapitation, for postnatal day 21 (P21) pups were sacrificed by cervical dislocation. Brain preparation was performed in ice cold PBS and followed by overnight fixation in 4% PFA in PBS. For cryo-sectioning the whole brain was embedded in Tissue-Tek O.C.T. after incubation in 12/15/18% sucrose.

Tightening of SFO vessels

β-Catenin endothelial specific gain of function system was kept by the use of Ctnnb1Ex3fl/fl (Harada et al., 1999) mice crossed with the Cdh5(PAC)-CreERT2 (Wang et al., 2010). To activate the Cre-recombinase, tamoxifen (TAM, 500 µg/day in corn oil; central pharmacy, Steinbach, Germany) was i.p. injected on five consecutive days. Brains were harvested and embedded for cryo-sectioning at 16, 19 and 26 days after the first TAM injection. To investigate the tightening effect at different postnatal stages, pups were i.p. injected with TAM (50 µg/day in corn oil) at P0-P3 and analyzed on P6 and P14.

Tracer experiments

Animals were injected with TAM and kept for 26 days to assure SFO vessel tightening as described above. Mice were anesthetized and intravenously injected with 50 µl FITC-albumin (#A9771; Sigma-Aldrich). After 1.5 hr mice were sacrificed by cervical dislocation. The embedded brain was cryo sectioned (20 µm, counterstained for Podxl and analyzed after confocal imaging. For analysis the FITC covered area as well as the Podxl+ vessel area within the SFO was measured for each optical section of at least one stack. To quantify the tracer leakage, the FITC covered SFO area was normalized to the vessel area, indicated by Podxl staining.

Thirst inducing experiments

Water restriction

To induce thirst, animals were water restricted for 72 hr. Therefore, the animals had no free access to water and got only a restricted amount of water every 24 hr according to their initial body weight (Table 1). During the experimental period the body weight is stable between at least 80–85% of the initial weight at day 0. After 72 hr there was no more water provided to keep the thirsty state. Mice were sacrificed and SFO tissue analyzed for c-fos as an immediate early gene marker for neuronal activity. The neuronal identity of c-fos+ cells was confirmed by fluorescent Nissl co-staining (Key resource table).
Table 1.

Documentation of water provided to mice according to their body weight in the water restriction paradigm

Bodyweight (BW)Offered water [ml]
BW > 84%1.1
84% > BW > 83%1.2
83% > BW > 82%1.3
82% > BW > 81%1.4
81% > BW1.5

Hyperosmolar NaCl injection

Mice were i.p. injected with either 3 M or an isotonic (0.15 M) NaCl solution (150 µl/20 g mouse) as described in Zimmerman et al. (Zimmerman et al., 2016). After an incubation time of 50 min without any access to drinking water animals were sacrificed and SFOs were analyzed in cryo sections for c-fos activation.

SFO whole mount for light sheet microscopy

Sample preparation

To label blood vessels, 80 µl tomato lectin Alexa 649 (#DL-1178, Vector laboratories) were injected i.v. in adult mice. After 4 min of circulation time animals were sacrificed by cervical dislocation. After overnight fixation (4% PFA in PBS) whole mount tissue samples were blocked and permeabilized with 0.2% gelatin from bovine skin, Type B, 0.5% Triton in PBS from 24 hr up to one week according to their size. Antibodies (Key resource table) were applied in blocking buffer supplemented with 0.1% saponin. To fix the staining samples were incubated for one hour in 4% PFA.

Tissue dehydration and clearing

At first the tissue was embedded in low melt agarose. The following dehydration and delipidation protocol was adapted from Orlich et al. and Renier et al. (Orlich and Kiefer, 2018; Renier et al., 2014). In brief, MetOH (50/70/100%) in PBS was used for 1 hrs for each step in dark-brown glass vials slightly shaking at RT, followed by an overnight incubation in 100% MetOH. To remove lipids an incubation with dichlormethane followed until the tissue sank down. Afterwards ethylcinnamate (ECi) (#112372, Sigma-aldrich) clearing was performed as described in Klingberg et al. (Klingberg et al., 2017). Samples were stored in ECi solution that was renewed one day before the acquisition. Samples were imaged in ECi solution with an UltraMicroscope II (LaVision, Germany) and stacks with 1 µm step size were further processed for visualization either by Imaris 9 (BitPlane, Switzerland) or the volume visualization framework Voreen (volume rendering engine) (Meyer-Spradow et al., 2009).

Immunohistochemical staining

Either native frozen tissue or sucrose embedded samples were cryo-sectioned coronal or sagittal in 10 µm thickness and then fixed with 4% PFA for 10 min at room temperature or with ice cold MetOH for 3 min. To block/permeabilize tissue slides were incubated for 1 hr (overnight for vibratome section) (10% NDS, 0.1% Triton-X100 in PBS). Primary antibodies (Key resource table) were incubated for 2 hr (24 hr for vibratome section) and secondary for 1 hr (4 hr for vibratome section) in antibody incubation buffer (1% BSA, 0.1% Triton-X100 in PBS). If required, sections of PFA-fixed samples were subjected to antigen-retrieval (*) by boiling slides for 45 min in AR6 Buffer (#AR600250ML; Perkin Elmer). After cooling them down and an additional washing step, slides were stained as described above.

Image acquisition and analysis of cryo-sections

Images were acquired using either a Nikon 80i wide field fluorescent microscope, or a Nikon C1si Confocal Laser Scanning Microscope, together with NIS-Elements Microscope Imaging Software for image analysis (Nikon Instruments, Inc., Düsseldorf, Germany). SFO vessels were defined as regions of interest (ROI) for area measurements. Staining was evaluated as a ratio of Cldn5 or Plvap/Meca32 to vessel area, evidenced by Podxl or Cdh5 labeling. The number of c-fos+ neurons as well as the total number of nuclei within the SFO, defined as ROI, were counted and the ratio of c-fos + to total nuclei was calculated.

Electron microscopy

Animals were anesthetized and transcardially perfused with PBS/heparin for 1 min followed by 4 min with 4% PFA in cacodylate buffer (CB, pH 7.4). The SFO was whole mount prepared in ice cold PBS directly after brain isolation. Afterwards the tiny SFO whole mount tissue pieces were post-fixed with 4% PFA and 2% glutaraldehyde/CB overnight at 4°C. Prior to embedding the tissue was incubated in 1% Os for 2 hr at RT followed by dehydration in graded acetone including contrast enhancement with uranyl acetate solution at 4°C o/n. Samples were embedded in Epon finally polymerized at 60°C for 24 hr. Ultra-thin sections (50 nm) were cut with Leica Ultracut UCT and analyzed using a Tecnai Spirit BioTWIN FEI electron microscope at 120kV. Images were taken with an Eagle 4K CCD bottom-mount camera. For the quantification of fenestrations, 5 SFO vessels were analyzed for each animal (n = 4 per genotype).

RNA isolation, transcription and real time PCR analysis

RNA isolation was done using the RNeasy plus Microkit (Qiagen) according to the manufacturer recommendations with DNase on-column digestion (Qiagen) like suggested in the RNeasy Minikit (Quiagen). For cDNA synthesis (RevertAidTM H minus first strand cDNA synthesis kit, #K1632, Thermo Fisher Scientific) 57 ng RNA were used from SFO tissue of β-catenin GOF (Cre+) and control (Cre-) mice. Quantitative real time RT-PCR (qRT-PCR) was performed in technical triplicates for each sample using the Absolute qPCR SYBR Green Fluorescein Mix (AB-1219, Thermo Fisher Scientific) according to the manufacturer's protocol. Rplp0 was used as a housekeeping gene for normalization. Expression data were analyzed with ∆∆ct method. Primer sequences used for cDNA amplification by qRT-PCR are listed in Table 2.
Table 2.

List of primers used for real time PCR.

Primer forSequence 5'−3’ senseSequence 5’−3’ antisense
qmm_Cldn5TGTCGTGCGTGGTGCAGAGTTGCTACCCGTGCCTTAACTGG
qmm_Meca32CTTCATCGCCGCTATCATCCTCCTTGGAGCACACTGCCTTCT
qmm_Rplp0GTGTTTGACAACGGCAGCATTTCTCCACAGACAATGCCAGGA
qmm_OclnGTGAATGGCAAGCGATCATACCTGCCTGAAGTCATCCACACTCA

Statistical analyses

No statistical tests were used to predetermine sample size. Several independent experiments were performed to ensure reproducibility. The investigators were blinded by the experimental design during the analysis of the experiments shown in Figures 4E, 5F–H, 6D, 7E–F and 8C as well as in Figure 4—figure supplement 1C, Figure 5—figure supplement 1D, Figure 7—figure supplement 2B. Raw data are presented in the additional source data files. The number of biological replicates is provided as ‘n’ in the legend of each figure. Technical replicates, such as the number of sections analyzed or replicates for qRT-PCR analyses are indicated in the figure legend and the respective material and methods section, respectively. Results are shown as mean ±SEM. Statistical significance was assessed by an unpaired t-test using GraphPad Prism version 6.0 (GraphPad Software Inc., USA). p-Values were considered significant at p<0.05 and individual p-values are provided in each figure. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Low Wnt/β-catenin signaling determines leaky vessels in the subfornical organ and affects water homeostasis in mice." for consideration by eLife. Your article has been reviewed by three peer reviewers, including Elisabetta Dejana as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by K VijayRaghavan as the Senior Editor. The following individuals involved in the review of your submission have agreed to reveal their identity: Dritan Agalliu (Reviewer #2); Christer Betsholtz (Reviewer #3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. The reviewers have found your paper of interest and potentially acceptable for publication in eLife. However, all the three referees raise important points to be considered before acceptance. Summary: The paper from Liebner laboratory investigates how CVO vessels, known to lack BBB and be permeable to water, solutes, and hormones, are regulated in relation to Wnt/β-catenin signaling – a central inducer of the BBB. The authors find (1) using Wnt reporter technologies, that Wnt signaling is undetectable in CVOs throughout development in mice and in adult zebrafish. (2) They describe a cellular phenotypic heterogeneity in the CVO vessels regarding Plvap and Cldn5 expression and they suggest that the latter might be regulated in a circadian fashion. (3) Using an inducible genetic β-catenin GOF approach, they show conversion of the CVO vessel phenotype into a BBB-like phenotype. (4) They show results that may indicate that this conversion has consequences for neuronal activity in the CVO. This manuscript is an interesting and valuable contribution to the field that deserves publication in eLife. The manuscript is well-written and well-illustrated in general. While going through the comments, please note in particular: Additional controls for the role of canonical Wnt/β-catenin signaling in the observed control of permeability are asked for. If experimentally feasible, an earlier control of β-catenin signaling in SFO would also be important. Please see if these are speedily do-able and if not pleased adequately discuss these points. It will be useful to have this experimentally addressed, though. A more accurate analysis of the permeability properties of SFO vessels and of tight junction organization and more accurate analysis of astrocyte polarization and matrix protein organization are also asked. More specifically, the authors should make better images for their c-fos data and show that it is indeed neurons that express c-fos. The authors could remove the circadian Cldn5 data (premature), the Aqp4 and CD13 data (confusing). Essential revisions: The gain-of-function mutation of β-catenin is induced in endothelial cell specifically. It is known that endothelial cells can produce soluble neural mediators. An important question, therefore, is whether the observed neural hyperactivation in vivo, induced by β-catenin gain of function in endothelial cells, is due to reduced vascular permeability or to a change of endothelial cell angiocrine activity. This is a crucial aspect for a correct interpretation of the results. Would the authors be able to see the same c-fos upregulation in neural cells by limiting permeability with different tools? For instance, mice Meca32- PLVAP knock out? Src inhibitors? VEGF inhibitors? other more specific tools? If this these experiments are not speedily addressable, they should be carefully and frontally discussed. A point that should be clarified is whether β-catenin does not play any role in the early angiogenesis of the SFO. The authors could not see, using reporter mice, a significant increase in β-catenin activity of the SFO-endothelial cells starting from 13.5E. However, β-catenin may be important in the very first steps of angiogenesis of SFO and then decline, as it occurs in other regions of the brain microcirculation. It could be, therefore, that it is already undetectable at E13.5 while active at earlier times. This is not irrelevant to understand SFO vascularization mechanisms and function. Here too, if experiments to address this are not speedily feasible, please discuss this point adequately. A major functional feature of the BBB is to exclude various circulating molecules from entering the CNS. However, a functional assessment of barrier properties in SFO blood vessels after β-catenin stabilization is missing. The authors need to inject intravenously small or large MW tracers and assess their permeability into the SFOs under conditions of Wnt/β-catenin activation in endothelial cells. Does overexpression of a stabilized form of β-catenin in the adult mice induce expression of Claudin-5 and suppresses MEca32 at the SFO? Do the blood vessels in SFO acquire Occludin protein expression at cell junctions with β-catenin overexpression? The authors need to show some staining with Occludin antibodies. The TEM data, clearly show that in GFO mice, pericytes and astrocytes are in close contact with endothelial cells. However, astrocytes do not appear to be polarized (AqP4 is expressed all over the parenchyma, rather than restricted to blood vessels). Are other astrocyte polarity markers (e.g. Dystroglycan or Kir 4.1) absent in this region? One potential explanation for the observation that astrocytes do not form proper endfeet in the SFO region could be due to the absence of basement membrane proteins. The authors need to examine the expression of some of the key basement membrane proteins such as Collagen IV, Laminin α2 etc. The authors nicely demonstrate that β-catenin GOF mice have higher c-Fos levels with water restriction than wild-type mice. Underwater restrictions, mice may show abnormal behaviors under specific behavioral tasks (e.g. Goltstein et al., 2018). It may be useful to test if there are any potential behaviors (e.g. rewarding behaviors) where GOF mice may perform worse than wild-type mice due to higher c-Fos activation. The evidence for circadian regulation of Cldn5 expression weak. While the quantifications in Figure 4E may appear convincing, the immunostainings shown in Figure 4A-D are not convincing. The amount of vasculature captured in each section appears hugely variable and the Podxl staining for endothelium seems highly variable in strength. Podxl should be luminal and Cldn5 junctional (or is it?) and this is not at all apparent at the magnification shown. Also, if true, the circadian variation in Cldn5 immunoreactivity raises a number of important issues that should be addressed, including if it is junctional or non-junctional Cldn5 that varies, if the effect is transcriptional or not if other tight junction proteins such as occludin and ZO-1 are also regulated, and more. If it is true that TJs are regulated in a circadian fashion, it is obviously interesting, but the physiological consequences are unclear, given that Plvap expression is maintained, and therefore (presumably) fenestrations not regulated. Would TJ regulation matter for the permeability if fenestrations are kept? The authors speculate that the (possible) circadian regulation of Cldn5 could influence the circadian regulation of thirst and drinking behavior, but this is pure speculation, as far as I can judge. Again, how can Cldn5 matter on top of (presumably) open fenestrations? Given the many questions and the premature nature of this data, we suggest they be removed from the present manuscript, to allow a better focus on Wnt/β-catenin regulation of the CVO vessel phenotype. If Wnt signaling is involved in the circadian regulation of Cldn5 expression in CVO vessels, it would also make more sense to study short term effects of β-catenin GOF experiments; now the earliest time point studied in adults is 16 days following induction. Another area where conclusions are weak relates to the TEM analysis (Figure 6). The images shown do not appear to support the conclusions that vessels in the GOF mice are slimmer, less tortuous and have less ECM deposition. For the ECM, it does appear denser in GOF but this may reflect decreased water content of the ECM rather than a decreased amount of ECM per se. The data regards c-fos expression by neurons in the SFO are also an area where the conclusions do seem robust. Neuronal staining to show that this is neuronal and not glial localization is not there. Also, some of the staining patterns are puzzling. Should not c-fos should look similar at 0h and isotonic NaCl panels in Figure 7, but they look hugely different, casting doubt over the quantifications in Figure 7E and F. The authors find increased expression of Sox17 along with Cldn5 in GOF experiments and note in conjunction with the TEM data that this may signify arterial specification. However, this is unfounded speculation in my opinion. There are many markers for arterial EC in the brain (see Vanlandewijck et al., 2018) and Sox17 is not a particularly strong one. The authors should remove this statement or investigate possible arterialization more thoroughly. The authors investigate Aqp4 and CD13 staining patterns to check "other phenotypic BBB features", but although neither Aqp4 nor CD13 was found changed in the GOF situation, it is unclear why the experiments were done in the first place. In what way do the (negative) data display an absence of BBB features? The meaning of the homogenous-looking Aqp4 staining in the CVOs is interesting but may have nothing to do with the absence of a BBB. Does the staining reflect lack of end-foot restricted localization in astrocytes, or is it the tanycytes that express Aqp4 in the CVOs? Also, what does the CD13-staining mean? Is this mural cells or perivascular fibroblasts (see Vanlandewijck et al., 2018)? Essential revisions: The gain-of-function mutation of β-catenin is induced in endothelial cell specifically. It is known that endothelial cells can produce soluble neural mediators. An important question, therefore, is whether the observed neural hyperactivation in vivo, induced by β-catenin gain of function in endothelial cells, is due to reduced vascular permeability or to a change of endothelial cell angiocrine activity. This is a crucial aspect for a correct interpretation of the results. Would the authors be able to see the same c-fos upregulation in neural cells by limiting permeability with different tools? For instance, mice Meca 32- PLVAP knock out? src inhibitors? VEGF inhibitors? other more specific tools? If this these experiments are not speedily addressable, they should be carefully and frontally discussed. We thank the reviewer for getting into this discussion. Indeed, it is difficult, if not impossible to dissect the two effects downstream of β-catenin activation, namely the physical tightening of SFO vessels and the direct effects on endothelial cells, including their autocrine status.

8 week-old female C57Bl6 mice were treated by i.p. injections of 1mg/kg BIO-X/DMSO every third day for 21 days.

For the final 72 hours, mice were water-deprived and subsequently sacrificed and analyzed for Meca32 as well as for Cldn5 (n=10). Representative immunofluorescent images (A). Quantification of Meca32- and Cldn5-covered vessel area within the SFO (B). Error bars show ± SEM. Scale bars represent 100 µm. Because of the time constraints of the revision period, we could not establish genetic mouse models for Meca-32/Plvap deletion in endothelial cells. Although thoroughly addressing this question in vivo is a project on its own and would be beyond the scope of this manuscript, we have made an effort to repeat the water restriction experiments, using the Wnt pathway activator BIO-X (Author response image 1) as well as the Scr-inhibitor AZD0530 (Author response image 2).
Author response image 1.

8 week-old female C57Bl6 mice were treated by i.p. injections of 1mg/kg BIO-X/DMSO every third day for 21 days.

For the final 72 hours, mice were water-deprived and subsequently sacrificed and analyzed for Meca32 as well as for Cldn5 (n=10). Representative immunofluorescent images (A). Quantification of Meca32- and Cldn5-covered vessel area within the SFO (B). Error bars show ± SEM. Scale bars represent 100 µm.

Author response image 2.

8 week-old female C57Bl6 mice were mice were daily treated with 25mg/kg AZD0530 Scr-inhibitor by oral gavage for 7 days.

For the final 72 h, mice were water-deprived and subsequently sacrificed and analyzed for Meca32 as well as for Cldn5 (n=10). Representative immunofluorescent images (A). Quantification of Meca32- and Cldn5-covered vessel area within the SFO (B). Error bars show ± SEM. Scale bars represent 100 µm.

We systemically administered BIO-X by i.p. injections of 1mg/kg BIO-X/DMSO every third day for 21 days. For the final 72 hours, mice were water-deprived and subsequently sacrificed and analyzed for Meca32 as well as for Cldn5. Unfortunately, we cloud not detect significant down regulation of Meca32 and up regulation of Cldn5 in SFO vessels. Instead, the phenotype of physiologically leaky vessels persisted. Similar results were obtained, when mice were daily treated with 25mg/kg AZD0530 Scrinhibitor by oral gavage for 7 days. Scr inhibition did not result in any effects on Meca32 and Cldn5 expression evidenced by IF staining. Analysis of c-fos showed the expected increased staining in the SFO of water-restricted mice (data not shown).

8 week-old female C57Bl6 mice were mice were daily treated with 25mg/kg AZD0530 Scr-inhibitor by oral gavage for 7 days.

For the final 72 h, mice were water-deprived and subsequently sacrificed and analyzed for Meca32 as well as for Cldn5 (n=10). Representative immunofluorescent images (A). Quantification of Meca32- and Cldn5-covered vessel area within the SFO (B). Error bars show ± SEM. Scale bars represent 100 µm. Currently, we are further analyzing the samples of the BIO-X- and AZD0530-treated mice for activation of β-catenin, by staining for nuclear β-catenin as well as for Lef-1, which will be informative for future experiments but will not be relevant for the revision of the present manuscript. Additional experiments with other compounds such as VEGF-inhibitors could not be performed due to time limitation. To understand if activation of the Wnt/β-catenin pathway in ECs may alter their angiocrine profile, we have analyzed as a first step primary mouse brain microvascular endothelial cells (pMBMECs) that were stimulated with either Wnt3a or PBS/BSA control. Given the importance of vascular endothelial growth factor A (VEGFA) for neuronal function (“neurogenesis, neuronal migration, neuronal survival and axon guidance”, Mackenzie and Ruhrberg, 2012), we analysed VEGFA expression in Wnt-activated ECs by qRT-PCR. Despite robust induction of Axin2 as a well-established Wnt/β-catenin target, we did not observe a concomitant VEGFA regulation (Author response image 3).
Author response image 3.

pMBMECs were isolated and cultivated as previously published (Ziegler et al., 2016; Liebner et al., 2008), and after one passage stimulated for 9 days with 150mM recombinant mouse Wnt3a (#315-20, Peprotech).

Total RNA was harvested (n=2), converted into cDNA and subjected to qRT-PCR analysis.

pMBMECs were isolated and cultivated as previously published (Ziegler et al., 2016; Liebner et al., 2008), and after one passage stimulated for 9 days with 150mM recombinant mouse Wnt3a (#315-20, Peprotech).

Total RNA was harvested (n=2), converted into cDNA and subjected to qRT-PCR analysis. A point that should be clarified is whether β-catenin does not play any role in the early angiogenesis of the SFO. The authors could not see, using reporter mice, a significant increase in β-catenin activity of the SFO-endothelial cells starting from 13.5E. However, β-catenin may be important in the very first steps of angiogenesis of SFO and then decline, as it occurs in other regions of the brain microcirculation. It could be, therefore, that it is already undetectable at E13.5 while active at earlier times. This is not irrelevant to understand SFO vascularization mechanisms and function. Here too, if experiments to address this are not speedily feasible, please discuss this point adequately. We thank the reviewer for this comment. We completely agree and have also analyzed earlier stages of BAT-gal reporter mice however, E13.5 was the earliest timepoint at which we could identify and visualize the developing SFO. Indeed, at this timepoint angiogenesis of the SFO is ongoing. Still, we could not observe active Wnt/β-catenin signaling. Consequently, due to the fact that E13.5 was the earliest timepoint the SFO is identifiable, we could not go earlier in order to study Wnt/β-catenin activation. Maybe we haven’t made this point as clear as it should be. We have now introduced this explanation in the Results section. We hope that this clarifies the reviewer’s question. A major functional feature of the BBB is to exclude various circulating molecules from entering the CNS. However, a functional assessment of barrier properties in SFO blood vessels after β-catenin stabilization is missing. The authors need to inject intravenously small or large MW tracers and assess their permeability into the SFOs under conditions of Wnt/β-catenin activation in endothelial cells. We thank the reviewer for this important comment. The physiological assessment of barrier tightness is indeed one of the most relevant parameters to address changes in permeability. In order to tackle the reviewer’s comment, we have injected β-catenin GOF and controls with tamoxifen, waited for 26 days and injected the mice intravenously with FITC-BSA (~68 kDa) and 3 kDa TMR-dextran. The detailed procedure is incorporated in the Material and Methods section of the revised manuscript. We now describe that the permeability for FITC-BSA was significantly reduced in the GOF compared to control animals. This result is now shown in Figure 6. Unfortunately, we encountered technical problems with a new Lot of the 3kDa TMR-dextran tracer that, although injected the same way as the FITC-BSA tracer, did not reveal the vessels nor was it detectable in the parenchyma of the SFO and other CVOs. For the reviewers’ reference, we show the positive technical pilot with an older Lot, nicely demonstrating leakage of the small tracer (Author response image 4A). Unfortunately, the two experiments with the new Lot of the tracer failed and due to the restricted availability of double transgenic mice and of time for the revision we were not able to repeat this experiment.
Author response image 4.

3 kDa TMR-dextran tracer was injected iv (150µl of a 2mM solution in PBS) into C56Bl6 WT mice for the pilot experiment (A), or iv into Ctrl and GOF mice in case of the real experiment (B).

In the pilot experiment vessels were nicely filled and labeled by 3 kDa TMR-dextran (arrows). In the SFO (dashed line) tracer extravasation was visible. In the experiment with Ctrl and GOF mice, the tracer was not visible in the vessel lumen, although successful iv injection was confirmed by the larger tracer (FITC-BSA, main Figure 6).

We hope that the reviewers feel that we have sufficiently shown the physiological tightening of SFO vessels by the reduced leakiness of the ~68 kDa tracer and it clarifies the reviewers’ question.

3 kDa TMR-dextran tracer was injected iv (150µl of a 2mM solution in PBS) into C56Bl6 WT mice for the pilot experiment (A), or iv into Ctrl and GOF mice in case of the real experiment (B).

In the pilot experiment vessels were nicely filled and labeled by 3 kDa TMR-dextran (arrows). In the SFO (dashed line) tracer extravasation was visible. In the experiment with Ctrl and GOF mice, the tracer was not visible in the vessel lumen, although successful iv injection was confirmed by the larger tracer (FITC-BSA, main Figure 6). Does overexpression of a stabilized form of β-catenin in the adult mice induce expression of Claudin-5 and suppresses MEca32 at the SFO? We thank the reviewer for this question. It might be that we were not clear enough in the original submission of our manuscript, but the data that we’ve presented in the original Figure 5 (now Figure 4 in the revised manuscript) were derived from adult double transgenic mice. We have now clarified this in the figure legend as follows: “(A) Mouse model and (B) schedule of endothelial-specific β-catenin GOF induction by tamoxifen (TAM) in adult, 8-12 week old mice”. Additionally, we have added data on the RNA expression of occludin (Ocln), showing in Figure 5 of the revised manuscript similarly to Cldn5 no mRNA upregulation could be observed, although Meca32 was significantly decreased in the SFOs of β-catenin GOF mice. Although the lack of transcriptional regulation of the two junctional genes may suggest that they are no direct targets of βcatenin, we might also face problems of signal masking by tight vessels in the total RNA, isolated from whole mount preparations. We now discuss this in the Discussion section and suggest that future RNAseq analysis of FACS-sorted pools and/or single cells may help to answer this question. Do the blood vessels in SFO acquire Occludin protein expression at cell junctions with β-catenin overexpression? The authors need to show some staining with Occludin antibodies. We thank the reviewer for this comment. We have investigated occludin (Ocln) expression and localization in SFO vessels of β-catenin GOF and control mice. The staining procedure and the antibody is incorporated in the Material and methods section of the revised manuscript. We now show that beside Cldn5, also Ocln localization at cell-cell junctions is significantly increased in GOF mice (Figure 5 of revised manuscript). Additionally, we have analyzed the expression of Ocln on the mRNA level by qRT-PCR and now show that in line with the expression of Cldn5 also the RNA of Ocln was not significantly increased in the SFO of GOF mice. As mentioned above, this might be due to the masking of the specific endothelial RNA by the total RNA isolated from the whole mount preparations, which inevitably include the ependymal epithelium that also expresses Ocln. Analyzing FACS-sorted cells from the SFO unfortunately, was beyond the scope of the present work. In addition to Ocln, we have now also stained for the adherens and tight junction associated protein zonula occludens/tight junction protein 1 (ZO-/Tjp1), which we now show in Figure 5—figure supplement 1. As opposed to Cldn5 and Ocln, for ZO-1 we observed only a minor increase in junctional continuity of ZO-1 staining. This finding fits with a comparable distribution of VE-cadherin/Cdh5 in GOF and control vessels in the SFO (Figure suppl. 4), given that ZO-1 was shown to localize to adherens junctions if tight junctions are weak or absent (Tornavaca et al., 2015). This is now discussed in the Discussion section. The TEM data, clearly show that in GFO mice, pericytes and astrocytes are in close contact with endothelial cells. However, astrocytes do not appear to be polarized (AqP4 is expressed all over the parenchyma, rather than restricted to blood vessels). Are other astrocyte polarity markers (e.g. Dystroglycan or Kir 4.1) absent in this region? We thank the reviewer for bringing up this interesting issue. By showing the staining of Aqp4 for astrocytic endfeet and by CD13 for pericytes, our intention was to visualize potential changes to the entire neuro-vascular unit (NVU) in SFO vessels of β-catenin GOF compared to control mice. That the leaky vessels of the mouse SFO do not exhibit an organization as an NVU was previously shown by Pócsai et al., (2015). Indeed, we could not observe Aqp4 polarisation at astrocytic endfeet in the control conditions, but equally not along with barrier tightening in GOF mice. As suggested by the reviewer we now investigated the polarisation markers α-dystroglycan (α-Dag) and Kir4.1 and obtained comparable results now shown in Figure 7—figure supplement 1 of the revised manuscript, suggesting that end feet polarization does not follow endothelial tightening. Specifically, dystroglycan shows weak and not strictly polarized staining around SFO vessel, whereas Kir4.1 seems to be mainly expressed by cells morphologically resembling tanycytes in the SFO. The co-localized distribution of dystroglycan and Kir4.1 around BBB vessels nicely confirmed the specific staining of these markers. This was not only true 26 days after TAM injection but also after 60 day, supporting the interpretation that the proper cellular arrangement of the NVU requires additional cues than endothelial Wnt/β-catenin signaling. One potential explanation for the observation that astrocytes do not form proper endfeet in the SFO region could be due to the absence of basement membrane proteins. The authors need to examine the expression of some of the key basement membrane proteins such as Collagen IV, Laminin α2 etc. We thank the reviewer for this thoughtful comment. We have investigated collagen IV, laminin α2 (Lama2) with specific antibody staining in SFO vessels of β-catenin GOF and control mice. The staining procedure and the antibodies are incorporated in the Material and methods section of the revised manuscript. We now show that collagen IV and Lama2 are indeed expressed around SFO vessels, and their distribution and localization follows the outline of the vessels. At least from these observations we concluded that the lack of proper astrocytic endfoot formation around SFO vessels has no obvious correlation to a lack of the most abundant basement membrane components. These findings are shown in the revised manuscript in Figure 7—figure supplement 2. The authors nicely demonstrate that β-catenin GOF mice have higher c-Fos levels with water restriction than wild-type mice. Underwater restrictions, mice may show abnormal behaviors under specific behavioral tasks (e.g. Goltstein et al., 2018). It may be useful to test if there are any potential behaviors (e.g. rewarding behaviors) where GOF mice may perform worse than wild-type mice due to higher c-Fos activation. We thank the reviewer for this mindful comment. In the manuscript by Goldstein et al. the authors strictly compare food versus water restricted animals in their behaviour and conclude that there are little to no dramatic changes in overall behaviour due to water restriction. Specifically, water-deprived mice perform better regarding rewarding behaviour than food-deprived mice. In order to tackle the reviewer’s request, we contacted our collaborators Prof. Jochen Roeper and Dr. Natascha Diamantopoulou (Institute of Neurophysiology, Goethe University Frankfurt), with which we have already planned to investigate the impact of SFO vessel tightening on mouse drinking behaviour. It turned out that it was not feasible to establish and conduct a meaningful experiment within the two month revision timeframe, considering 26d of TAM induction, mouse adaptation and taming, as well as water deprivation and analysis. Although testing the behaviour of Ctrl and GOF mice is beyond the scope of the present study, we believe however, that there is good evidence, that the overall rewarding behaviour does not play a major role in our paradigm. This has been shown and discussed in Augustine et al., 2018, who stated that activation of neurons in the median preoptic nucleus (MnPO), as part of the terminal lamina “indicate that MnPOGLP1R neurons are activated purely by fluid consumption and not by reward-seeking behaviour or licking action per se. Consistent with the connection from MnPOGLP1R to SFOnNOS neurons, the activity of the SFOnNOS population mirrored precisely the calcium dynamics of MnPOGLP1R neurons”. The findings of Augustine et al. may therefore support our interpretation that, the increase in c-fos in the SFO of GOF water-deprived mice, relates to altered water homeostasis rather than altered overall behaviour. Moreover, we learned from our collaborators, that water deprivation as a widely used paradigm to augment the motivation of mice and other rodents, is not considered to lead to “abnormal” behaviour, given that water and food deprivation is the „normal “situation in wild mice, whereas water and food ad libitum could be rather considered as abnormal. Nevertheless, we would like to emphasis that the question raised by the reviewer is very valid and that it was and is on our future agenda as it requires substantial expertise in behavioural sciences and adequate equipment (both will be provided by the group of Prof. Roeper). We hope the reviewers appreciate the limitations we faced regarding this question and leave the answer to future work. The evidence for circadian regulation of Cldn5 expression weak. While the quantifications in Figure 4E may appear convincing, the immunostainings shown in Figure 4A-D are not convincing. The amount of vasculature captured in each section appears hugely variable and the Podxl staining for endothelium seems highly variable in strength. Podxl should be luminal and Cldn5 junctional (or is it?) and this is not at all apparent at the magnification shown. Also, if true, the circadian variation in Cldn5 immunoreactivity raises a number of important issues that should be addressed, including if it is junctional or non-junctional Cldn5 that varies, if the effect is transcriptional or not if other tight junction proteins such as occludin and ZO-1 are also regulated, and more. If it is true that TJs are regulated in a circadian fashion, it is obviously interesting, but the physiological consequences are unclear, given that Plvap expression is maintained, and therefore (presumably) fenestrations not regulated. Would TJ regulation matter for the permeability if fenestrations are kept? The authors speculate that the (possible) circadian regulation of Cldn5 could influence the circadian regulation of thirst and drinking behavior, but this is pure speculation, as far as I can judge. Again, how can Cldn5 matter on top of (presumably) open fenestrations? Given the many questions and the premature nature of this data, we suggest they be removed from the present manuscript, to allow a better focus on Wnt/β-catenin regulation of the CVO vessel phenotype. If Wnt signaling is involved in the circadian regulation of Cldn5 expression in CVO vessels, it would also make more sense to study short term effects of β-catenin GOF experiments; now the earliest time point studied in adults is 16 days following induction.

TEM images of SFO vessels taken from βcatenin control and GOF mice (26d after TAM injection) were analysed for vessels perimeter by measuring the perimeter of vessel using the polygon tool in ImageJ.

In total 14 and 10 vessels were analysed for control and GOF, respectively. n=3; unpaired student t test was applied. We thank the reviewers for this important comment. As suggested by the reviewers, we have removed the data on circadian regulation from the revised manuscript. Based on the other recommendations of the reviewers, we have now set Figure 5 of the original manuscript as Figure 4 and have included the novel data on occludin (Ocln) localisation and expression in SFO vessels of β-catenin GOF and control mice as Figure 5. We further thank the reviewer for the constructive suggestions on analyzing earlier time point after TAM induction, which we will consider in ongoing experiments Another area where conclusions are weak relates to the TEM analysis (Figure 6). The images shown do not appear to support the conclusions that vessels in the GOF mice are slimmer, less tortuous and have less ECM deposition. For the ECM, it does appear denser in GOF but this may reflect decreased water content of the ECM rather than a decreased amount of ECM per se. We thank the reviewer for this comment. As the description of vessels diameter and morphology in the TEM analysis was not based on any quantifications, we have analysed the vessel perimeter but could not identify a significant effect on vessel perimeter (Author response image 5). Consequently, we have removed the original note on vessel diameter and morphology from the revised manuscript. We also thank the reviewer for the comment on the ECM deposition. Indeed, it is impossible to judge if we face an increase of ECM in the GOF condition. We therefore have describe the vessels and the ECM in the revised manuscript as follows: “Although the vessel morphology did not show major differences regarding vessel perimeter and structure, the vessels of the GOF mice appeared to have a more compact ECM deposition in their circumference (Figure 7A-C).” (Results section). Together with the new Figure 7—figure supplement 2, showing the distribution of Lama2 and ColIV, we conclude that the ECM is not significantly affected by the induction of β-catenin signaling in ECs of the SFO.
Author response image 5.

TEM images of SFO vessels taken from βcatenin control and GOF mice (26d after TAM injection) were analysed for vessels perimeter by measuring the perimeter of vessel using the polygon tool in ImageJ.

In total 14 and 10 vessels were analysed for control and GOF, respectively. n=3; unpaired student t test was applied.

The data regards c-fos expression by neurons in the SFO are also an area where the conclusions do seem robust. Neuronal staining to show that this is neuronal and not glial localization is not there. Also, I some of the staining patterns are puzzling. Should not c-fos should look similar at 0h and isotonic NaCl panels in Figure 7, but they look hugely different, casting doubt over the quantifications in Figure 7E and F. We thank the reviewer for this important comment. We agree that the c-fos staining of the 0 hour water restricted mice and the NaCl controls should be comparable, given that we identified nearly no c-fos staining in these control conditions, which the images of the original submission did not support well, due to some background staining in the 0 h panel in Figure 7C. Moreover, the neuronal identity of cell that show nuclear c-fos staining was missing in the originally submitted manuscript. Therefore, we have performed novel staining of samples from the water-restricted mice, combining the vascular marker CD31 with the neuron-specific Nissl staining and c-fos. The novel images of the new Figure 8C, D now show a comparable staining pattern between water restriction at 0 hour and the isotonic NaCl injected mice. Additionally, the Nissl staining of the so-called Nissl flounders nicely documents the neuronal identity of the c-fos+ cells (Figure 8G). As opposed to the general nuclear staining by the fluorescent Nissl stain, the flounders are specific for neurons only, that we indicated by the dashed lines in Figure 8G. The images show a high magnification of a Nissl+/c-fos+ double positive neuron in Figure 8G and a Nissl+/c-fos- neuron in Figure 8H. We hope the pronounced differences in c-fos between the conditions are now comprehendible. The authors find increased expression of Sox17 along with Cldn5 in GOF experiments and note in conjunction with the TEM data that this may signify arterial specification. However, this is unfounded speculation in my opinion. There are many markers for arterial EC in the brain (see Vanlandewijck et al., 2018) and Sox17 is not a particularly strong one. The authors should remove this statement or investigate possible arterialization more thoroughly. We thank the reviewer for this comment. The intention to show Sox17 was exclusively to demonstrate the upregulation of a Wnt/β-catenin target, and it was only a note that Sox17 was previously shown as an arterial marker. As suggested by the reviewer, we have deleted the statement of arterialisation, but described Sox17 solely as a Wnt target (Results section). The authors investigate Aqp4 and CD13 staining patterns to check "other phenotypic BBB features", but although neither Aqp4 nor CD13 was found changed in the GOF situation, it is unclear why the experiments were done in the first place. In what way do the (negative) data display an absence of BBB features? The meaning of the homogenous-looking Aqp4 staining in the CVOs is interesting but may have nothing to do with the absence of a BBB. Does the staining reflect lack of end-foot restricted localization in astrocytes, or is it the tanycytes that express Aqp4 in the CVOs? Also, what does the CD13-staining mean? Is this mural cells or perivascular fibroblasts (see Vanlandewijck et al., 2018)? We thank the reviewer for making this comment. As mentioned above in context of the astrocytic end foot staining with α-dystroglycan (α-Dag), Kir4.1 and Lama2, we decided to keep and show also Aqp4. However, we clarified in the main text of the revised manuscript (Results section; Discussion section) that the intention to investigate Aqp4, and as suggested by the reviewers in addition α-Dag and Kir4.1, was to understand if the known lack of a BBB-like NVU organisation of astrocytes, pericytes and endothelial cells in the core of the SFO, was altered by β-catenin GOF in ECs. The combined findings from all markers stained suggest that dominant endothelial activation of β-catenin does not lead to a structural formation of an NVU in the core of the SFO. We believe that this is valuable information, opening new aspects of investigating cellular and molecular interactions at the NVU. Regarding the expression of Aqp4 in astrocytes or tanycytes, the novel data on Kir4.1 expression which likely resembles tanycytes and does not overlap with Aqp4, may suggest that Aqp4 is expressed in astrocytes. We agree with the reviewer that the data on pericytes were too preliminary and hence, we have removed these data from the revised manuscript. Just mentioning that we haven’t seen obvious effects on this cell type as “data not shown”, and that we haven’t investigated perivascular fibroblasts identified by Vanlandewick et al., 2018 (Discussion section).
Key resources table
Reagent type (species)or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strainbackground (Mus musculus)Wild-type miceENVIGO, The NetherlandsC57BL/6J
Strain, strainbackground (Mus musculus)Cdh5-cre miceRalf H. Adams, Max-Planck-Institute for Molecular Biomedicine, Münster, GermanyCdh5(PAC)-CreERT2
Strain, strainbackground (Mus musculus)Pdgfb-cre miceMarcus Fruttiger (University College London, London, UKPDGFB-iCreERT2
Strain, strainbackground (Mus musculus)β-Catenin exon3-floxed miceM. Mark Taketo, Kyoto University, JapanCtnnb1Ex3fl/fl
Strain, strainbackground (Mus musculus)Wnt/β-catenin reporter miceStefano Piccolo (University of Padua, Padova,Italy)B6.Cg-Tg(BAT-lacZ)3Picc/J
Strain, strainbackground (Mus musculus)Cre-reporter miceLiqun Luo, Stanford UniversitySTOCK Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J
Strain, strainbackground (Danio rerio)Vessel reporter fishD.Y.R. Stainier, Max-Planck-Institute for Heart and Lung Research, Bad Nauheim, GermanyTg(kdrl:Hsa.HRAS-mCherry)s896
Strain, strainbackground (Danio rerio)Wnt/β-catenin reporter fishFrancesco Argenton (University of Padua, Padova,Italy)Tg(7xTCF-Xla.Siam:GFP)ia4
AntibodyAnti-aquaporin 4 (Aqp4; rabbit, polyclonal)EMD MilliporeAB 2218, RRID: AB_112103661:200 PFA fixation
AntibodyAnti-β-galactosidase (βGal; rabbit, polyclonal)MP Biomedicals#559781:1000 PFA
AntibodyAnti-PECAM/CD31 (rat, monoclonal)BD Pharmingen#553370, RRID: AB_3948161:100 PFA
AntibodyAnti-Cdh5/VE-Cadherin (goat, polyclonal)Santa-Cruz Biotechnologysc-6458, RRID: AB_20779551:50 PFA/ MetOH
Antibodyc-fos (H-125) (rabbit, polyclonal)Santa-Cruz Biotechnologysc-7202, RRID: AB_21067651:1000 PFA
AntibodyAnti-claudin-5/Cldn5 (rabbit, polyclonal)Thermo Fisher Scientific#3416001:200 PFA/ MetOH
AntibodyAnti-Collagen IV (rabbit, polyclonal)BioRad#2150–1470, RRID: AB_20826601:300 PFA
AntibodyAnti-α-dystroglycan/α-Dag (mouse, monoclonal)Novus-BiologicalsNBP1-49634, RRID: AB_110155101:50 PFA*
AntibodyAnti-Kir4.1 (rabbit, polyclonal)Alomone labsAPC-035, RRID: AB_20401201:200 PFA*
AntibodyAnti-Laminin α 2/Lama2 (rat, monoclonal)Abcamab11576, RRID: AB_2981801:200 MetOH
AntibodyAnti-occludin (mouse, monoclonal)Thermo Fisher (Invitrogen)#33–1500, RRID: AB_25331011:100 PFA*
AntibodyAnti-Plvap/Meca32 (rat, monoclonal)BD Pharmingen#553849, RRID: AB_3950861:100 PFA/ MetOH
AntibodyAnti-podocalyxin/Podxl (goat, polyclonal)R and D SystemsAF1556, RRID: AB_3548581:100 PFA/ MetOH
AntibodyAnti-Sox17 (goat, polyclonal)R and D SystemsAF1924, RRID: AB_3550601:100 PFA
AntibodyAnti-ZO-1 (rabbit, polyclonal)Thermo Fisher (Invitrogen)#40–2300, RRID: AB_25334571:100 MetOH
AntibodyAnti-goat IgG DyLight 550-conjugated (donkey, polyclonal)Thermo Fisher ScientificSA5-10087, RRID: AB_25566671:500 PFA/ MetOH
AntibodyAnti-goat IgG DyLight 650- conjugated (donkey, polyclonal)Thermo Fisher ScientificSA5-10089, RRID: AB_25566691:500 PFA/ MetOH
AntibodyAnti-rabbit IgG DyLight 488-conjugated (donkey, polyclonal)Thermo Fisher ScientificSA5-10038, RRID: AB_25566181:500 PFA/ MetOH
AntibodyAnti-rabbit IgG DyLight 550-conjugated (donkey, polyclonal)Thermo Fisher ScientificSA5-10039, RRID: AB_25566191:500 PFA/ MetOH
AntibodyAnti-rat IgG DyLight 550-conjugated (donkey, polyclonal)Thermo Fisher ScientificSA5-10027, RRID: AB_25566071:500 PFA/ MetOH
OtherDAPIMolecular Biological Technology (Mo Bi Tec)D-1306300 µM (1:800)
OtherNeuroTraceTMGreen Fluorescent Nissl StainThermo Fisher ScientificN214801:300 PFA
OtherTissue-Tek O.C.T.Sakura Finetek Europe4583
OtherqPCR SYBR Green Fluorescein MixThermo Fisher ScientificAB-1219
ChemicalcompoundTricaine methanesulfonate (MS-222)Sigma-AldrichE10521
Chemical compoundTAMSigma-AldrichT5648
ChemicalcompoundFITC-albuminSigma-Aldrich#A9771
Chemicalcompoundtomato lectin Alexa 649Vector laboratories(#DL-1178
Chemicalcompoundethylcinnamate (ECi),)Sigma-Aldrich(#112372
ChemicalcompoundAR6 BufferPerkin Elmer(#AR600250ML
Commercial kitRNeasy plus Micro kitQiagen#74034
Commercial kitRevertAidTM H minus first strand cDNA synthesis kitThermo Fisher Scientific#K1632
Commercial kitRNeasy Mini kitQuiagen#74104
  61 in total

Review 1.  Making sense of it: roles of the sensory circumventricular organs in feeding and regulation of energy homeostasis.

Authors:  Mark Fry; Ted D Hoyda; Alastair V Ferguson
Journal:  Exp Biol Med (Maywood)       Date:  2007-01

Review 2.  Circumventricular organs: receptive and homeostatic functions and clinical implications.

Authors:  Eduardo E Benarroch
Journal:  Neurology       Date:  2011-09-20       Impact factor: 9.910

3.  A molecular mechanism for Wnt ligand-specific signaling.

Authors:  Marie Eubelen; Naguissa Bostaille; Pauline Cabochette; Anne Gauquier; Patricia Tebabi; Andra C Dumitru; Melanie Koehler; Philipp Gut; David Alsteens; Didier Y R Stainier; Abel Garcia-Pino; Benoit Vanhollebeke
Journal:  Science       Date:  2018-07-19       Impact factor: 47.728

4.  Ephrin-B2 controls VEGF-induced angiogenesis and lymphangiogenesis.

Authors:  Yingdi Wang; Masanori Nakayama; Mara E Pitulescu; Tim S Schmidt; Magdalena L Bochenek; Akira Sakakibara; Susanne Adams; Alice Davy; Urban Deutsch; Urs Lüthi; Alcide Barberis; Laura E Benjamin; Taija Mäkinen; Catherine D Nobes; Ralf H Adams
Journal:  Nature       Date:  2010-05-27       Impact factor: 49.962

Review 5.  Sensory circumventricular organs in health and disease.

Authors:  Sílvia Sisó; Martin Jeffrey; Lorenzo González
Journal:  Acta Neuropathol       Date:  2010-09-10       Impact factor: 17.088

6.  Differential distribution of tight junction proteins suggests a role for tanycytes in blood-hypothalamus barrier regulation in the adult mouse brain.

Authors:  Amandine Mullier; Sebastien G Bouret; Vincent Prevot; Bénédicte Dehouck
Journal:  J Comp Neurol       Date:  2010-04-01       Impact factor: 3.215

7.  Protein components of the blood-brain barrier (BBB) in the brainstem area postrema-nucleus tractus solitarius region.

Authors:  Nasren Maolood; Björn Meister
Journal:  J Chem Neuroanat       Date:  2008-12-25       Impact factor: 3.052

8.  A global double-fluorescent Cre reporter mouse.

Authors:  Mandar Deepak Muzumdar; Bosiljka Tasic; Kazunari Miyamichi; Ling Li; Liqun Luo
Journal:  Genesis       Date:  2007-09       Impact factor: 2.487

9.  Thirst driving and suppressing signals encoded by distinct neural populations in the brain.

Authors:  Yuki Oka; Mingyu Ye; Charles S Zuker
Journal:  Nature       Date:  2015-01-26       Impact factor: 49.962

10.  Tip cell-specific requirement for an atypical Gpr124- and Reck-dependent Wnt/β-catenin pathway during brain angiogenesis.

Authors:  Benoit Vanhollebeke; Oliver A Stone; Naguissa Bostaille; Chris Cho; Yulian Zhou; Emilie Maquet; Anne Gauquier; Pauline Cabochette; Shigetomo Fukuhara; Naoki Mochizuki; Jeremy Nathans; Didier Yr Stainier
Journal:  Elife       Date:  2015-06-08       Impact factor: 8.140

View more
  27 in total

1.  Tight junctions in the blood-brain barrier promote edema formation and infarct size in stroke - Ambivalent effects of sealing proteins.

Authors:  Lars Winkler; Rosel Blasig; Olga Breitkreuz-Korff; Philipp Berndt; Sophie Dithmer; Hans C Helms; Dmytro Puchkov; Kavi Devraj; Mehmet Kaya; Zhihai Qin; Stefan Liebner; Hartwig Wolburg; Anuska V Andjelkovic; Andre Rex; Ingolf E Blasig; Reiner F Haseloff
Journal:  J Cereb Blood Flow Metab       Date:  2020-02-13       Impact factor: 6.200

Review 2.  Neuronal and glial regulation of CNS angiogenesis and barriergenesis.

Authors:  Saptarshi Biswas; Azzurra Cottarelli; Dritan Agalliu
Journal:  Development       Date:  2020-05-01       Impact factor: 6.868

Review 3.  The Role of Brain Microvascular Endothelial Cell and Blood-Brain Barrier Dysfunction in Schizophrenia.

Authors:  Sovannarath Pong; Rakesh Karmacharya; Marianna Sofman; Jeffrey R Bishop; Paulo Lizano
Journal:  Complex Psychiatry       Date:  2020-09-14

4.  Wnt signaling mediates acquisition of blood-brain barrier properties in naïve endothelium derived from human pluripotent stem cells.

Authors:  Benjamin D Gastfriend; Hideaki Nishihara; Scott G Canfield; Koji L Foreman; Britta Engelhardt; Sean P Palecek; Eric V Shusta
Journal:  Elife       Date:  2021-11-10       Impact factor: 8.140

Review 5.  Neuronal regulation of the blood-brain barrier and neurovascular coupling.

Authors:  Luke Kaplan; Brian W Chow; Chenghua Gu
Journal:  Nat Rev Neurosci       Date:  2020-07-07       Impact factor: 34.870

6.  Endothelial cell-type-specific molecular requirements for angiogenesis drive fenestrated vessel development in the brain.

Authors:  Sweta Parab; Rachael E Quick; Ryota L Matsuoka
Journal:  Elife       Date:  2021-01-18       Impact factor: 8.140

7.  Brain Endothelial Cells Are Exquisite Sensors of Age-Related Circulatory Cues.

Authors:  Michelle B Chen; Andrew C Yang; Hanadie Yousef; Davis Lee; Winnie Chen; Nicholas Schaum; Benoit Lehallier; Stephen R Quake; Tony Wyss-Coray
Journal:  Cell Rep       Date:  2020-03-31       Impact factor: 9.423

Review 8.  Location Matters: Navigating Regional Heterogeneity of the Neurovascular Unit.

Authors:  Louis-Philippe Bernier; Clément Brunner; Azzurra Cottarelli; Matilde Balbi
Journal:  Front Cell Neurosci       Date:  2021-06-30       Impact factor: 5.505

Review 9.  Living on the Edge of the CNS: Meninges Cell Diversity in Health and Disease.

Authors:  Julia Derk; Hannah E Jones; Christina Como; Bradley Pawlikowski; Julie A Siegenthaler
Journal:  Front Cell Neurosci       Date:  2021-07-01       Impact factor: 5.505

10.  Scalable robust graph and feature extraction for arbitrary vessel networks in large volumetric datasets.

Authors:  Dominik Drees; Aaron Scherzinger; René Hägerling; Friedemann Kiefer; Xiaoyi Jiang
Journal:  BMC Bioinformatics       Date:  2021-06-26       Impact factor: 3.169

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.