| Literature DB >> 30931013 |
Niall J McKeown1, Amy L Taylor2, Paul W Shaw1.
Abstract
The big blue octopus, Octopus cyanea, occurs on coral reefs throughout the Indo-Pacific region from East Africa to the Hawaiian Islands, wherein it is of great ecological and socio-economic importance. However, many components of its intraspecific biodiversity, such as population structure, are unresolved due to a lack of informative genetic markers. To address this issue, which may compromise conservation and sustainability efforts, the development and characterisation of the first species-specific microsatellite loci for O. cyanea are described here. The eight loci were characterised by the genotyping of 40 adults from Madagascar, which revealed an average of 13.5 alleles per locus (range 9-18). The observed and expected heterozygosity per locus ranged from 0.432 to 0.949 and from 0.481 to 0.989, respectively. No evidence of linkage disequilibrium was detected between pairs of loci. Genotype proportions at six loci conformed to Hardy-Weinberg equilibrium expectations, with two loci exhibiting significant heterozygote deficits. These loci are applicable to multiple areas of eco-evolutionary research and, thus, represent a valuable resource for future studies of O. cyanea.Entities:
Keywords: Biodiversity; Conservation; Genetic; Management; Marine invertebrate; Population genetics
Year: 2017 PMID: 30931013 PMCID: PMC6404728 DOI: 10.1007/s12526-017-0717-0
Source DB: PubMed Journal: Mar Biodivers ISSN: 1867-1616 Impact factor: 1.533
Summary information for eight microsatellite loci developed for Octopus cyanea, including primer sequences, repeat motif observed in the clone used to develop each locus, allele numbers (N a), size range, observed (H O) and expected (H E) heterozygosity and P-values for tests of Hardy–Weinberg equilibrium (P HW) calculated from the analysis of 40 adults from Madagascan waters
| Locus | Primer sequences (5′–3′) | Repeat motif in cloned allele |
| Size range (bp) |
|
|
|
|---|---|---|---|---|---|---|---|
| Ocya-1 | F: TTTCATCCACCCATTGATATCTC | (GTAT)13 | 14 | 156–212 | 0.949 | 0.906 | 0.816 |
| Ocya-2 | F: TTCAACACTCAAATCGTTAGGG | (CATA)17 | 9 | 200–248 | 0.432 | 0.481 | 0.109 |
| Ocya-3 | F: TCCCGCATCAACCTTTAATG | (GATA)19 | 16 | 208–272 | 0.872 | 0.925 | 0.767 |
| Ocya-4 | F: AAATGCACACGCATAAAAACA | (CATA)20 | 14 | 172–224 | 0.850 | 0.989 | 0.128 |
| Ocya-5 | F: ACATCGACCCCAGGACTTAG | (CA)7…(CA)6…(CA)7…(CA)5 | 10 | 320–384 | 0.433 | 0.870 |
|
| Ocya-6 | F: TAAGTCCTGGGATCGAATGG | (GTAT)14 | 13 | 212–284 | 0.872 | 0.883 | 0.769 |
| Ocya-7 | F: TAGAATGTGCGTCGCAAAAG | (CATA)16 | 18 | 128–196 | 0.949 | 0.942 | 0.679 |
| Ocya-8 | F: TTATGAAATTGGGTGGACGG | (GT)6…(GT)15 | 14 | 215–253 | 0.556 | 0.989 |
|