Literature DB >> 30907867

qKAT: Quantitative Semi-automated Typing of Killer-cell Immunoglobulin-like Receptor Genes.

Jyothi Jayaraman1, Vitalina Kirgizova2, Da Di3, Christopher Johnson4, Wei Jiang5, James A Traherne6.   

Abstract

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a polymorphic cluster of genes on chromosome 19. Their best-characterized ligands are the human leukocyte antigen (HLA) molecules that are encoded within the major histocompatibility complex (MHC) locus on chromosome 6. There is substantial evidence that they play a significant role in immunity, reproduction, and transplantation, making it crucial to have techniques that can accurately genotype them. However, high-sequence homology, as well as allelic and copy number variation, make it difficult to design methods that can accurately and efficiently genotype all KIR genes. Traditional methods are usually limited in the resolution of data obtained, throughput, cost-effectiveness, and the time taken for setting up and running the experiments. We describe a method called quantitative KIR semi-automated typing (qKAT), which is a high-throughput multiplex real-time polymerase chain reaction method that can determine the gene copy numbers for all genes in the KIR locus. qKAT is a simple high-throughput method that can provide high-resolution KIR copy number data, which can be further used to infer the variations in the structurally polymorphic haplotypes that encompass them. This copy number and haplotype data can be beneficial for studies on large-scale disease associations, population genetics, as well as investigations on expression and functional interactions between KIR and HLA.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 30907867      PMCID: PMC6794157          DOI: 10.3791/58646

Source DB:  PubMed          Journal:  J Vis Exp        ISSN: 1940-087X            Impact factor:   1.355


Introduction

In humans, the killer immunoglobulin-like receptor(KIR) locus is mapped on the long arm of chromosome 19 within the leukocyte receptor complex (LRC). This locus is around 150 kb in length and includes 15 KIR genes arranged head-to-tail. The KIR loci that are currently known are KIR2DL1, KIR2DL2/KIR2DL3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR2DS1-5, KIR3DL1/KIR3DS1, KIR3DL2-3, and two pseudogenes, KIR2DP1 and KIR3DP1. The KIR genes encode for two-dimensional (2D) and three-dimensional (3D) immunoglobulin-like domain receptors with short (S; activating) or long (L; inhibitory) cytoplasmic tails, which are expressed by natural killer (NK) cells and subsets of T cells. Copy number variation exhibited within the KIR locus forms diverse haplotypes with variable gene content[1]. Non-allelic homologous recombination (NAHR), facilitated by a close head-to-tail gene arrangement and high-sequence homology, is the mechanism proposed to be responsible for the haplotypic variability. Over 100 different haplotypes have been reported in populations worldwide[1,2,3,4]. All these haplotypes could be divided into two major groups: A and B haplotypes. The A haplotype contains 7 KIR genes: KIR3DL3, KIR2DL1, KIR2DL3, KIR2DL4, KIR3DL1, and KIR3DL2, which are inhibitory KIR genes, and the activating KIR gene KIR2DS4. However, up to 70% of European-origin individuals who are homozygous for KIR haplotype A exclusively carry a non-functional "deletion" form of KIR2DS4[5,6]. All other KIR gene combinations form group B haplotypes, including at least one of the specific KIR genes KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS5, KIR3DS1, KIR2DL2, and KIR2DL5, and typically include two or more activating KIR genes. HLA Class I molecules have been identified as the ligands for certain inhibitory receptors (KIR2DL1, KIR2DL2, KIR2DL3, and KIR3DL1), activating receptors (KIR2DS1, KIR2DS2, KIR2DS4, KIR2DS5, and KIR3DS1), and for KIR2DL4, which is a unique KIR that contains a long cytoplasmic tails like other inhibitory KIR receptors but also has a positively charged residue near the extracellular domain which is a common feature of other activating KIR receptors. The combination of variants within the KIR genes and the HLA genes influences receptor ligand interaction that shapes potential NK cell responsiveness at the individual level[7,8]. Evidence from genetic association studies has indicated that KIR plays a role in viral resistance (e.g., human immunodeficiency virus [HIV][9] and hepatitis C virus [HCV][10]), the success of transplantation[11], the risk of pregnancy disorders and reproductive success[12,13], the protection against relapse after allogeneic hematopoietic stem cell transplantation (HSCT)[14,15,16], and the risk of cancers[17]. The combination of high-sequence homology and allelic and haplotypic diversity presents challenges in the task of accurately genotyping KIR genes. Conventional methods to type KIR genes include sequence-specific primer (SSP) polymerase chain reaction (PCR)[18,19,20], sequence-specific oligonucleotide probe (SSOP) PCR[21], and matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS)[22]. The drawbacks of these techniques are that they only provide partial insight into the genotype of an individual whilst also being laborious to perform. Recently next-generation sequencing (NGS) has been applied to type the KIR locus specifically. While this method is very powerful, it can be expensive to run, and it is time-consuming to conduct in-depth analysis and data checks. qKAT is a high-throughput quantitative PCR method. While conventional methods are laborious and time-consuming, this method makes it possible to run nearly 1,000 genomic DNA (gDNA) samples in five days and gives the KIR genotype, as well as the gene copy number. qKAT consists of ten multiplex reactions, each of which targets two KIR loci and one reference gene of a fixed copy number in the genome (STAT6) used for the relative quantification of the KIR gene copy number[23]. This assay has been successfully used in studies involving large population panels and disease cohorts on infectious diseases such as HCV, autoimmune conditions like type 1 diabetes, and pregnancy disorders such as preeclampsia, as well as providing a genetic underpinning to studies aimed at understanding the NK cell function[1,4,24,25,26]. Accurately quantify the gDNA concentration using a spectrophotometric or fluorometric instrument. Dilute DNA to 4 ng/μL on a 96-well deep-well plate. Include at least one control gDNA sample with a known copy number and one non-template control. Centrifuge the 96-well plates at 450 x g for 2 min. Using a liquid handling instrument, dispense each sample in quadruplicate onto 384-well qPCR plates so that every well has 10 ng of DNA (2.5 μL/well). Prepare at least ten 384-well plates, one for each qKAT reaction. If gDNA is being dispensed from more than one 96-well plate, perform a full-volume wash with 2% bleach and ultrapure water to clean the needles of the liquid handling system between each 96-well plate of gDNA samples. Air-dry the DNA by incubating the 384-well plates in a clean area at room temperature for at least 24 h.

Protocol

Preparation of the Primers and Probes

NOTE: qKAT consists of ten multiplex reactions. Each reaction includes three primer pairs and three fluorescence-labeled probes that specifically amplify two KIR genes and one reference gene. The probes that were published in Jiang et al.[27] were modified so that the oligonucleotides are now labeled with ATTO dyes since they offer improved photostability and long signal lifetimes. Pre-aliquoted primer combinations are commercially available (see Table of Materials). Prepare primer combinations for each reaction as per the dilutions given in Table 1.
Table 1

Combination and concentration of primers and probes used in each qKAT reaction[27].

AssayGenesForward PrimersConcentration (nM)Reverse PrimersConcentration (nM)ProbesConcentration (nM)
No 13DP1A4F250A5R250P4a150
2DL22DL2F4400C3R2600P5b150
STAT6STAT6F200STAT6R200PSTAT6150
No 22DS2A4F400A6R400P4a200
2DL3D1F400D1R400P9150
STAT6STAT6F200STAT6R200PSTAT6150
No 33DL3A8F500A8R500P4a150
2DS4Del2DS4Del2502DS4R2250P5b150
STAT6STAT6F200STAT6R200PSTAT6150
No 43DL1e4B1F250B1R125P4b150
3DL1e9D4F250D4R2500P9150
STAT6STAT6F200STAT6R200PSTAT6150
No 53DS1B2F250B1R250P4b150
2DL4C1F200C1R200P5b-2DL4150
STAT6STAT6F200STAT6R200PSTAT6150
No 62DL1B3F500B3R125P4b150
2DP1D3F250D3R500P9150
STAT6STAT6F200STAT6R200PSTAT6150
No 72DS1B4F500B4R250P4b150
2DL5D2F500D2R500P9150
STAT6STAT6F200STAT6R200PSTAT6150
No 82DS3B5F250B5R250P4b150
3DL2e9D4F250D5R125P9150
STAT6STAT6F200STAT6R200PSTAT6150
No 93DL2e4A1F200A1R200P4a150
2DS4FL2DS4FL2502DS4R2500P5b150
STAT6STAT6F200STAT6R200PSTAT6150
No 102DS5B6F2200B6R3200P4b150
2DS4C5F250C5R250P5b150
STAT6STAT6F200STAT6R200PSTAT6150
Prepare probe combinations for each reaction as per Table 1. Test each individual probe prior to making the combination.

Preparation of the Master Mix

NOTE The volumes mentioned below are for performing one qKAT reaction on a set of 10x 384-well plates. Ensure that the gDNA samples plated on the 384-well plates are completely dry. Conduct all steps on ice and keep the reagents covered from exposure to light as much as possible since the fluorescence-labeled probes are photo- and thermo-sensitive. Defrost the qPCR buffer, primer, and probe aliquots at 4 °C. On ice, prepare a master mix for 10x 384-well plates by adding 18.86 mL of ultrapure water, 20 mL of qPCR buffer, 1,000 μL of preprepared primer combination, and 180 μL of preprepared probe combination (Table 2).
Table 2

Volumes (μL) of 100 μM primer/probe stock solutions to make primer and probe combination aliquots.

ReactionPrimer Aliquots (μL)Probe Aliquots (μL)
R13DP1A4FA5R2DL2F4C3R2WATERSTAT6FSTAT6RP4AP5BPSTAT6
2DL21001001602402008080606060
R22DS2A2FA6RD1FD1RWATERSTAT6FSTAT6RP4AP9PSTAT6
2DL31601601601601608080806060
Note: need 20 μL less water in the MasterMix
R33DL3A8F A8FBA8R2DS4DELF2DS4R2WATERSTAT6FSTAT6RP4AP5BPSTAT6
2DS4DEL100 1002001001002008080606060
R43DL1E4B1FB1RD4FD4R2WATERSTAT6FSTAT6RP4BP9PSTAT6
3DL1E9100501002003508080606060
R53DS1B2FB1RC1FC1RWATERSTAT6FSTAT6RP4BP5B-2L4PSTAT6
2DL410010080804408080606060
R62DL1B3FB3RD3FD3RWATERSTAT6FSTAT6RP4BP9PSTAT6
2DP1200501002002508080606060
R72DS1B4FB4RD2FD2RWATERSTAT6FSTAT6RP4BP9PSTAT6
2DL52001002002001008080606060
R82DS3B5FB5RD4FD5RWATERSTAT6FSTAT6RP4BP9PSTAT6
3DL2E9100100100504508080606060
R93DL2E4A1FA1R2DS4WTF2DS4R2WATERSTAT6FSTAT6RP4AP5BPSTAT6
2DS4WT80801002003408080606060
R102DS5B6F2B6R3C5FC5RWATERSTAT6FSTAT6RP4BP5BPSTAT6
2DS4TOTAL80801001004408080606060
Distribute the master mix evenly across a 96-deep well plate using a multi-channel pipette, pipetting 415 μL into each well. Keep this plate in an ice box covered from light. Using a liquid handling instrument, dispense 9.5 μL of the master mix into each well of the 384-well plate with dried gDNA. Seal the plate with a foil and immediately place it at 4 °C. Repeat this process for the remaining plates, ensuring that the needles of the liquid handling system are washed with water between each plate. Centrifuge the 384-well plates at 450 x g for 3 min and incubate them at 4 °C overnight or between 6 - 12 h to resuspend the DNA and to dissipate any air bubbles. Following the overnight incubation, centrifuge at 450 x g for 3 min to dissipate any remaining air bubbles. For purposes of automation, connect the qPCR machine (e.g., LightCycler 480) to a microplate handler (see Table of Materials). Program the microplate handler to place the plates into the qPCR machine from a cooled storage dock that is protected from light. NOTE The assays should, in theory, work on other qPCR machines with compatible optic settings. Use the following cycling conditions: 95 °C for 5 min followed by 40 cycles of 95 °C for 15 s and 66 °C for 50 s, with data collection at 66 °C. Once the run is complete, have the robot collect the plate from the qPCR machine and place it in the discard dock. After amplification, calculate the quantification cycle (Cq) values using either the second derivative maximum method or the Fit Points method with the software of the qPCR machine (see Table of Materials), following the steps below. Open the qPCR software and, in the Navigator tab, open the saved reaction experiment file for one plate. For the analysis using the second derivative maximum method, select the Analysis tab, and create a new analysis using Abs Quant/Second Derivative Max method. In the Create new analysis window, select analysis type: Abs Quant/Second Derivative Max method, subset: All Samples, program: Amplification, name: Rx-DFO (where x is the reaction number). Select Filter Comb and choose VIC/HEX/Yellow555 (533-580). This ensures that the data collected for STAT6 is selected. Select Colour Compensation for VIC/HEX/Yellow555(533-580). Click Calculate. Repeat this for Fam (465-510) and Cy5/Cy5.5(618-660). Click Save file. For the analysis using the Fit Points method, select Abs Quant/Fit Points in the Analysis tab. In the Create new analysiswindow, select analysis type: Abs Quant/Fit Points method, subset: All Samples, program: Amplification, name: RxF-DFO(where x is the reaction number). Select the correct filters and color compensations for STAT6 and each of the KIR genes (Fam/Cy5). In the Noiseband tab, set the noise band to exclude the background noise. In the Analysis tab, set the fit points to 3 and select Show fit points. Click Calculate. Click Save file. In the qPCR software, open the Navigator tab. Select Results Batch Export. Open the folder in which the experiment files are saved and transfer the files into the right-hand side section of the window. Click Next. Select the name and the location of the export file. Select Analysis type Abs Quant/Second Derivative Max method or Abs Quant/Fit Points. Click Next. Check that the name of the file, the export folder, and the analysis type are correct and click Next to start the export process. Wait until the Export Status is Ok. The screen will automatically move to the next step. Check that all selected files have been exported successfully so that the number of files failed = 0. Click Done. Use scripts split_file.pl and roche2sds.pl to split the exported plates into individual reactions for each plate. NOTE The scripts are provided on request/GitHub. Open the copy number analysis software (e.g., CopyCaller). Select Import real-time PCR results file and load text files created by roche2sds.pl. Select Analyze and conduct the analysis by either selecting calibrator sample with known copy number or by selecting most frequent copy number. See Table 5 for the most frequent copy number of KIR genes typically observed in European-origin populations.
Table 5

Most frequent copy number for KIR genes commonly observed in European-origin samples.

KIR gene3DL32DS22DL22DL32DP12DL13DP12DL43DL1 EX93DL1 EX93DS12DL52DS32DS52DS12DS4 Total2DS4 FL2DS4 DEL3DL2 ex43DL2 EX9
Most frequent copy number21122222221111121122
Use R script KIR_CNVdata_analysis_for_Excel_ver020215.R to combine copy number data from all the plates into a spreadsheet. NOTE The scripts are provided on request/GitHub. Recheck the raw data on the copy number analysis software for samples that do not conform to the known linkage disequilibrium (LD) for KIR genes (Table 6).
Table 6

Linkage disequilibrium between KIR genes commonly observed in European-origin populations can be used to check copy number data[1,27].

Linkage disequilibrium rules for qKAT based on European populationsCopy number check
1KIR3DL3, KIR3DP1,KIR2DL4 and KIR3DL2 are framework genes present on both haplotypes.KIR3DL3, KIR3DP1,KIR2DL4 and KIR3DL2 = 2
2KIR2DS2 and KIR2DL2 are in LD with each other2DS2=2DL2
3KIR2DL2 and KIR2DL3 are alleles of the same gene2DL2+2DL3=2
4KIR2DP1 and KIR2DL1 are in LD with each other2DP1=2DL1
5Exon 4 of KIR3DL1 and KIR3DL2 is equal to exon 9 of KIR3DL1 and KIR3DL2 respectively.3DL1ex4=3DL1ex9 AND 3DL2ex4=3DL2ex9
6KIR3DL1 and KIR3DS1 are alleles3DL1+3DS1=2
7KIR2DS3 and KIR2DS5 are in LD with KIR2DL52DS3+2DS5=2DL5
8KIR3DS1 and KIR2DS1 are in LD3DS1=2DS1
9Presence of KIR2DS1 and KIR2DS4Total is mutually exclusive on a haplotype2DS1+2DS4TOTAL=2
10KIR2DS4FL and KIR2DS4del are variants of KIR2DS4TOTAL2DS4FL+2DS4DEL=2DS4TOTAL

Representative Results

Copy number analysis can be carried out by exporting the files to the copy number analysis software, which provides the predicted and estimated copy number based on the ΔΔCq method. The copy number can be predicted either based on the known copy number of control DNA samples on the plate or by inputting the most frequent gene copy number (Table 5). Figure 1 shows the results of a plate for a reaction that targets KIR2DL4 and KIR3DS1, as well as the reference gene STAT6. The most frequent copy number for KIR2DL4, a framework gene in the KIR locus, is two copies, whereas the most frequent copy number for KIR3DS1, an activating gene, is one copy. The results in the figure show the PCR amplification plots observed on the qPCR software and the copy number data generated from the qPCR data. As shown, the assay is able to distinguish between 0, 1, 2, 3, and 4 KIR gene copy numbers. The copy number analysis software also enables a viewing of the distribution of the copy number across the plate as a pie chart or a bar graph. The efficacy of the copy number prediction is lower for samples with a higher copy number.
Figure 1

Representative results of a plate for reaction number 5.

(A) This panel shows amplification plots. (B) This panel shows copy number plots. (C) This panel shows the copy number distribution. Please click here to view a larger version of this figure.

The quality of all the materials used in the reactions, gDNA, buffer, primers, and probes, can affect the accuracy of the results obtained. However, discordance in results is most likely to be caused due to variation in the concentration of DNA across a plate. The purity of the extracted gDNA, which can be measured using the 260/280 and 260/230 ratios, can also have an effect on the quality. A 260/280 ratio of 1.8 - 2 and a 260/230 ratio of 2 - 2.2 are desirable. An uneven range of DNA concentrations across a plate can lead to a high variability in the threshold cycle (Ct) between samples and discordance in the range of the estimated copy number. The results in Figure 2 show the effect the disparity between the Ct values across a plate can have on the accuracy in the prediction of the copy number. The red line indicates the range of the estimated copy number for a sample and, ideally, should be as close to an integer as possible.
Figure 2

Representative results of a plate with a variable DNA concentration for reaction number 5.

(A) This panel shows amplification plots. (B) This panel shows copy number plots. Please click here to view a larger version of this figure.

The copy number data, once analyzed, can be exported as a spreadsheet file in a 96-well format. We used an R script (available on request) to combine the copy number data of all 10 plates that are run as a set into one spreadsheet. Published data about KIRs from mostly European-origin populations enables the prediction of LD rules that exist between various genes in the KIR complex[1]. These predictions are used to conduct downstream checks on the copy number results obtained (Table 6). Samples that do not conform to the predicted LD between the genes might contain unusual polymorphism or haplotypic structural variations. A flowchart describing the protocol is shown in Figure 3.
Figure 3

Flowchart of the qKAT protocol. Please click here to view a larger version of this figure.

A tool called KIR Haplotype Identifier (http://www.bioinformatics.cimr.cam.ac.uk/haplotypes/) was developed to facilitate the imputation of haplotypes from the data set. The imputation works on the basis of a list of reference haplotypes observed in a European-origin population[1]. However, the tool also allows for a custom set of reference haplotypes to be used instead. Three separate files are generated; the first file lists all haplotype combinations for a sample, the second file provides a trimmed list of the haplotypes combinations that have the highest combined frequencies, and the third file lists the samples that cannot be assigned haplotypes. Non-assignment of haplotypes could be used as an indicator of novel haplotypes.

Discussion

We described a novel semi-automated high-throughput method, called qKAT, which facilitates copy number typing of KIR genes. The method is an improvement over conventional methods like SSP-PCR, which are low-throughput and can only indicate the presence or absence of these highly polymorphic genes. The accuracy of the copy number data obtained is dependent on multiple factors, including the quality and concentration-uniformity of the gDNA samples and the quality of the reagents. The quality and accuracy of the gDNA samples across a plate are extremely important since variations in concentration across the plate can result in errors in the calculation of the copy number. Since the assays were validated using European-origin sample sets, data from cohorts from other parts of the world require more thorough checks. This is to ensure that instances of allele dropout or non-specific primer/probe binding are not misinterpreted as copy number variation. While the assays were designed and optimized to run as high-throughput, they can be modified to run fewer samples. The confidence metric in the copy number analysis software is affected when analyzing fewer samples, but this can be improved if control genomic DNA samples with a known KIR gene copy number are included on the plate and additional sample replicates are included. For laboratories without liquid/plate-handling robots, master mix can be dispensed using multi-channel pipettes and plates can be manually loaded into the qPCR instrument. The main aim behind the development of qKAT was to create a simple, high-throughput, high-resolution, and cost-effective method to genotype KIRs for disease association studies. This was successfully achieved since qKAT has been employed in investigating the role of KIR in several large disease association studies, including a range of infectious diseases, autoimmune conditions, and pregnancy disorders[4,24,25,26].
Table 3

List of probes used in qKAT1,27.

The fluorescent dyes used at the 5' end of the oligo probes P5b, P5b-2DL4, P9, and PSTAT6 were modified to ATTO dyes.

NameDirection5´ modification3´ modificationSequence (5'→3')LengthTmGC%ExonPosition
P4aSenseFAMBHQ-1TCATCCTGCAATGTTGGTCAGATGTCA276044.44425-451
P4bAntisenseFAMBHQ-1AACAGAACCGTAGCATCTGTAGGTCCCT2862504576-603
P5bSenseATTO647NBHQ-2AACATTCCAGGCCGACTTTCCTCTG2560525828-852
P5b-2DL4SenseATTO647NBHQ-2AACATTCCAGGCCGACTTCCCTCTG2561565828-852
P9SenseATTO647NBHQ-2CCCTTCTCAGAGGCCCAAGACACC246062.591246-1269
PSTAT6ATTO550BHQ-2CTGATTCCTCCATGAGCATGCAGCTT266250
Table 4

Sequences of the primers used in qKAT[1,27].

GenePrimersDirectionSequence (5´-3´)LengthTmGC%ExonPositionAmplicon (bp)Alleles might be missed
3DL2e4A1FForwardGCCCCTGCTGAAATCAGG185261.14399-4161793DL2*008, *021, *027, *038.
A1RReverseCTGCAAGGACAGGCATCAA195352.6559-5773DL2*048
3DP1A4FForwardGTCCCCTGGTGAAATCAGA194952.64398-416112None
A5RReverseGTGAGGCGCAAAGTGTCA185255.6492-509None
2DS2A2FForwardGTCGCCTGGTGAAATCAGA194952.64398-416111None
A6RReverseTGAGGTGCAAAGTGTCCTTAT215142.9488-508None
3DL3A8FaForwardGTGAAATCGGGAGAGACG185055.64406-423139None
A8FbForwardGGTGAAATCAGGAGAGACG195052.6405-4233DL3*054, 3DL3*00905.
A8RReverseAGTTGACCTGGGAACCCG185161.1526-543None
3DL1e4B1FForwardCATCGGTCCCATGATGCT185155.64549-566853DL1*00505, 3DL1*006, 3DL1*054, 3DL1*086, 3DL1*089
B1RReverseGGGAGCTGACAACTGATAGG205255614-6333DL1*00502
3DS1B2FForwardCATCGGTTCCATGATGCG185155.64549-566853DS1*047; may pick up 3DL1*054.
B1RReverseGGGAGCTGACAACTGATAGG205255614-633None
2DL1B3FForwardTTCTCCATCAGTCGCATGAC2052504544-563962DL1*020, 2DL1*028
B3RReverseGTCACTGGGAGCTGACAC185061.1622-6392DL1*023, 2DL1*029, 2DL1*030
2DS1B4FForwardTCTCCATCAGTCGCATGAA195147.44545-563962DS1*001
B4RReverseGGTCACTGGGAGCTGAC174964.7624-640None
2DS3B5FForwardCTCCATCGGTCGCATGAG185361.14546-56396None
B5RReverseGGGTCACTGGGAGCTGAA185161.1624-641None
2DS5B6F2ForwardAGAGAGGGGACGTTTAACC195052.64475-493173None
B6R3ReverseTCCAGAGGGTCACTGGGC185366.7630-6472DS5*003
2DL4C1FForwardGCAGTGCCCAGCATCAAT185255.65808-82583None
C1RReverseCCGAAGCATCTGTAGGTCT195252.6872-8902DL4*018, 2DL4*019
2DL22DL2F4ForwardGAGGTGGAGGCCCATGAAT195257.95778-7961512DL2*009; 782G changed to A.
C3R2ReverseTCGAGTTTGACCACTCGTAT205145909-928None
2DS4C5FForwardTCCCTGCAGTGCGCAGC175770.65803-819120None
C5RReverseTTGACCACTCGTAGGGAGC195257.9904-9222DS4*013
2DS4Del2DS4DelForwardCCTTGTCCTGCAGCTCCAT195457.95750-768203None
2DS4R2ReverseTGACGGAAACAAGCAGTGGA205350933-952None
2DS4FL2DS4FLForwardCCGGAGCTCCTATGACATG195357.95744-762209None
2DS4R2ReverseTGACGGAAACAAGCAGTGGA205350933-952None
2DL3D1FForwardAGACCCTCAGGAGGTGA174858.891180-1196156None
D1RReverseCAGGAGACAACTTTGGATCA2050451316-13352DL3*010, 2DL3*017, 2DL3*01801 and 2DL3*01802
2DL5D2FForwardCACTGCGTTTTCACACAGAC20525091214-12331202DL5B*011 and 2DL5B*020
D2RReverseGGCAGGAGACAATGATCTT194947.41315-1333None
2DP1D3FForwardCCTCAGGAGGTGACATACGT20535591184-1203121None
D3RReverseTTGGAAGTTCCGTGTACACT2050451285-1304None
3DL1e9D4FForwardCACAGTTGGATCACTGCGT195252.691203-1221933DL1*061, 3DL1*068
D4R2ReverseCCGTGTACAAGATGGTATCTGTA235343.51273-12953DL1*05901, 3DL1*05902, 3DL1*060, 3DL1*061, 3DL1*064, 3DL1*065, 3DL1*094N, 3DL1*098
3DL2e9D4FForwardCACAGTTGGATCACTGCGT195252.691203-1221156None
D5RReverseGACCTGACTGTGGTGCTCG195463.21340-1358None
STAT6STAT6FForwardCCAGATGCCTACCATGGTGC205460129
STAT6RReverseCCATCTGCACAGACCACTCC205460
  26 in total

1.  Development of a PCR-SSOP approach capable of defining the natural killer cell inhibitory receptor (KIR) gene sequence repertoires.

Authors:  K A Crum; S E Logue; M D Curran; D Middleton
Journal:  Tissue Antigens       Date:  2000-10

2.  Donor selection for natural killer cell receptor genes leads to superior survival after unrelated transplantation for acute myelogenous leukemia.

Authors:  Sarah Cooley; Daniel J Weisdorf; Lisbeth A Guethlein; John P Klein; Tao Wang; Chap T Le; Steven G E Marsh; Daniel Geraghty; Stephen Spellman; Michael D Haagenson; Martha Ladner; Elizabeth Trachtenberg; Peter Parham; Jeffrey S Miller
Journal:  Blood       Date:  2010-06-25       Impact factor: 22.113

3.  HLA and NK cell inhibitory receptor genes in resolving hepatitis C virus infection.

Authors:  Salim I Khakoo; Chloe L Thio; Maureen P Martin; Collin R Brooks; Xiaojiang Gao; Jacquie Astemborski; Jie Cheng; James J Goedert; David Vlahov; Margaret Hilgartner; Steven Cox; Ann-Margeret Little; Graeme J Alexander; Matthew E Cramp; Stephen J O'Brien; William M C Rosenberg; David L Thomas; Mary Carrington
Journal:  Science       Date:  2004-08-06       Impact factor: 47.728

4.  Epistatic interaction between KIR3DS1 and HLA-B delays the progression to AIDS.

Authors:  Maureen P Martin; Xiaojiang Gao; Jeong-Hee Lee; George W Nelson; Roger Detels; James J Goedert; Susan Buchbinder; Keith Hoots; David Vlahov; John Trowsdale; Michael Wilson; Stephen J O'Brien; Mary Carrington
Journal:  Nat Genet       Date:  2002-07-22       Impact factor: 38.330

5.  Facilitation of KIR genotyping by a PCR-SSP method that amplifies short DNA fragments.

Authors:  C Vilches; J Castaño; N Gómez-Lozano; E Estefanía
Journal:  Tissue Antigens       Date:  2007-09-14

6.  Association of maternal killer-cell immunoglobulin-like receptors and parental HLA-C genotypes with recurrent miscarriage.

Authors:  S E Hiby; L Regan; W Lo; L Farrell; M Carrington; A Moffett
Journal:  Hum Reprod       Date:  2008-02-08       Impact factor: 6.918

7.  KIR2DS5 allotypes that recognize the C2 epitope of HLA-C are common among Africans and absent from Europeans.

Authors:  Jeroen H Blokhuis; Hugo G Hilton; Lisbeth A Guethlein; Paul J Norman; Neda Nemat-Gorgani; Annettee Nakimuli; Olympe Chazara; Ashley Moffett; Peter Parham
Journal:  Immun Inflamm Dis       Date:  2017-07-06

Review 8.  Deciphering the killer-cell immunoglobulin-like receptor system at super-resolution for natural killer and T-cell biology.

Authors:  Vivien Béziat; Hugo G Hilton; Paul J Norman; James A Traherne
Journal:  Immunology       Date:  2016-12-14       Impact factor: 7.397

9.  Copy number variation leads to considerable diversity for B but not A haplotypes of the human KIR genes encoding NK cell receptors.

Authors:  Wei Jiang; Chris Johnson; Jyothi Jayaraman; Nikol Simecek; Janelle Noble; Miriam F Moffatt; William O Cookson; John Trowsdale; James A Traherne
Journal:  Genome Res       Date:  2012-09-04       Impact factor: 9.043

10.  Killer cell immunoglobulin-like receptor (KIR) genes and their HLA-C ligands in a Ugandan population.

Authors:  Annettee Nakimuli; Olympe Chazara; Lydia Farrell; Susan E Hiby; Stephen Tukwasibwe; Olatejumoye Knee; Jyothi Jayaraman; James A Traherne; Alison M Elliott; Pontiano Kaleebu; Florence Mirembe; Ashley Moffett
Journal:  Immunogenetics       Date:  2013-08-24       Impact factor: 2.846

View more
  3 in total

1.  Diversity of KIR genes and their HLA-C ligands in Ugandan populations with historically varied malaria transmission intensity.

Authors:  Stephen Tukwasibwe; James A Traherne; Olympe Chazara; Jyothi Jayaraman; John Trowsdale; Ashley Moffett; Wei Jiang; Joaniter I Nankabirwa; John Rek; Emmanuel Arinaitwe; Samuel L Nsobya; Maxine Atuheirwe; Mubiru Frank; Anguzu Godwin; Prasanna Jagannathan; Stephen Cose; Moses R Kamya; Grant Dorsey; Philip J Rosenthal; Francesco Colucci; Annettee Nakimuli
Journal:  Malar J       Date:  2021-02-25       Impact factor: 2.979

Review 2.  HLA Class I Molecules as Immune Checkpoints for NK Cell Alloreactivity and Anti-Viral Immunity in Kidney Transplantation.

Authors:  Burcu Duygu; Timo I Olieslagers; Mathijs Groeneweg; Christina E M Voorter; Lotte Wieten
Journal:  Front Immunol       Date:  2021-07-06       Impact factor: 7.561

3.  Downregulation of HLA-I by the molluscum contagiosum virus mc080 impacts NK-cell recognition and promotes CD8+ T-cell evasion.

Authors:  Hana Elasifer; Eddie C Y Wang; Virginie Prod'homme; James Davies; Simone Forbes; Richard J Stanton; Mihil Patel; Ceri A Fielding; Dawn Roberts; James A Traherne; Nicole Gruber; Joachim J Bugert; Rebecca J Aicheler; Gavin W G Wilkinson
Journal:  J Gen Virol       Date:  2020-08       Impact factor: 5.141

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.