Literature DB >> 30851741

TRIB1 rs17321515 and rs2954029 gene polymorphisms increase the risk of non-alcoholic fatty liver disease in Chinese Han population.

Qun Liu1,2, Feng Xue3, Jing Meng3, Shou-Sheng Liu4,5, Li-Zhen Chen3, Hui Gao1,2, Ning Geng3, Wen-Wen Jin3, Yong-Ning Xin6,7,8,9, Shi-Ying Xuan10,11,12.   

Abstract

BACKGROUND: Dysregulation of the lipid homeostasis is an independent risk factor for non-alcoholic fatty liver disease (NAFLD). Some studies had demonstrated that TRIB1 gene polymorphisms affect the plasma lipids metabolism, but no related data was available for TRIB1 gene polymorphisms in the lipids metabolism in Chinses Han population. The present study was conducted to investigate the association between TRIB1 gene polymorphisms (rs17321515 and rs2954029) and the risk of NAFLD in Chinese Han population and their effects on serum lipid profiles. PATIENTS AND METHODS: TRIB1 rs17321515 and rs2954029 gene polymorphisms were genotyped using the polymerase chain reaction (PCR) in B-type ultrasonography-proven NAFLD patients (n = 146) and healthy controls (n = 175). Serum lipid profiles were determined using biochemical methods. Statistical analyses were performed using SPSS 22.0 statistical software.
RESULTS: The allele distributions of TRIB1 rs17321515 A and rs2954029 A were significant different between the NAFLD patients and healthy controls (P = 0.026, P = 0.045, respectively). The genotype distribution of TRIB1 rs17321515 was significant different between NAFLD patients and healthy controls (P = 0.038). The TRIB1 rs17321515 GA + AA genotype and TRIB1 rs2954029 TA + AA genotype markedly increase the NAFLD risk (OR = 1.885; 95%CI: 1.157-3.070; OR = 1.627; 95%CI: 1.011-2.619, respectively), after adjusted for age, gender, and body mass index, the NAFLD risk still significant (OR = 2.240; 95%CI: 1.196-4.197; OR = 2.050; 95%CI: 1.110-3.786, respectively). In addition, TRIB1 rs17321515 A and rs2954029 A carriers possess the higher lipid profiles in the included subjects.
CONCLUSIONS: TRIB1 rs17321515 and rs2954029 were significant associated with the risk of NAFLD in Chinese Han population. The rs17321515 A and rs2954029 A allele increases the serum lipid profiles in Chinese Han population.

Entities:  

Keywords:  Non-alcoholic fatty liver disease; Polymorphism, lipids metabolism; TRIB1

Mesh:

Substances:

Year:  2019        PMID: 30851741      PMCID: PMC6408849          DOI: 10.1186/s12944-019-1001-z

Source DB:  PubMed          Journal:  Lipids Health Dis        ISSN: 1476-511X            Impact factor:   3.876


Background

Non-alcoholic fatty liver disease (NAFLD), the most common form of chronic liver diseases, is now recognized as a severe public health concern in the worldwide [1]. The overall prevalence of NAFLD is approximately 25 and 27% in the world and Asian, respectively [2, 3]. Established risk factors for NAFLD including aging, insulin resistance, hyperlipidemia, obesity, type 2 diabetes, dysregulation of the lipid homeostasis, and genetic factors, and the prevalence of NAFLD is increased with the increasing body mass index [4-8]. Biopsy is still regarded as the diagnostic gold standard for NAFLD, but the deficiency of biopsy such as invasiveness and possible sample error remain could be ignored [9, 10]. In recent years, some non-invasive, genetics-based clinical diagnostic methods for NAFLD had been developed. Leon-Mimila et al. reported a genetic risk score system that could evaluate the risk of NASH by combining the variant alleles of PNPLA3 rs738409, LYPLAL1 rs12137855, GCKR rs1260326, and PPP1R3B rs4240624 [11]. Accumulated studies emphasized that finding the new SNPs site which associated with NAFLD is very meaningful for the prediction and diagnosis of NAFLD. Tribbles-1 (TRIB1) is one of the members of tribbles family that was first identified in Drosophila and possesses the function to regulate the cell division and migration [12, 13]. In 2008, genome-wide association studies (GWAS) first revealed the association of TRIB1 rs17321515 (A > G) and rs2954029 (A > T) gene polymorphisms with the serum level of triglycerides (TG) [14, 15]. Subsequent abundant studies had shown that TRIB1 rs17321515 and rs2954029 were significant associated with the dysregulation of serum lipids levels and the risk of cardiovascular disease. Tai et al. investigated the effect of TRIB1 rs17321515 in Malay population, the results showed that TRIB1 rs17321515 was significant associated with the elevated level of total cholesterol (TC) and low density lipoprotein (LDL), and the risk of cardiovascular disease (CVD) [16]. The elevated serum TG level and risk of coronary heart disease in TRIB1 rs17321515 A allele carriers in Chinese Han population were also be observed [17]. Varbo et al. conducted a study to test the effect of TRIB1 rs2954029 in the general population, the results showed that TRIB1 rs2954029 A allele carriers had the higher serum levels of TG, TC, apolipoprotein B, and LDL-C, and the lower high density lipoprotein (HDL) than A allele non-carriers [18]. The similar effect of TRIB1 rs2954029 in lipids metabolism was also observed in Japanese community-dwelling women, which showed an elevated TG concentration in AA genotype carriers [19]. There is no doubt about the significant role of TRIB1 rs17321515 and rs2954029 in the lipid metabolism and the risk of cardiovascular disease. In consideration of the tight association of NAFLD with the dysregulation of lipids metabolism and the risk of cardiovascular disease [20-22], it is meaningful to explore the effect of TRIB1 rs17321515 and rs2954029 in the NAFLD patients. The purpose of this study was to investigate the association of TRIB1 rs17321515 and rs2954029 with the risk of NAFLD and their effects on the lipid metabolism in Chinese Han population.

Patients and methods

Study subjects

This case-control study was approved by the Ethical Committee of Qingdao Municipal Hospital (Qingdao, China). This study was carried out in accordance with the principles of the declaration of Helsinki and its appendices [23]. All the subjects had written the informed consent before participated in this study. From June 2018 to November 2018, 146 NAFLD patients diagnosed by B-type ultrasonography (65 females and 81 males, mean age 61.08 ± 15.70 years) and 175 B-type ultrasonography confirmed healthy controls that matched for sex and age (87 females and 88 males, mean age 60.15 ± 11.96 years) were enrolled in this study. The NAFLD patients were collected from the Department of Gastroenterology and the healthy controls were collected from the Medical Center of Qingdao Municipal Hospital. All the individuals were unrelated Northern Han Chinese origin. The diagnosis of NAFLD was performed according to the guidelines of American association for the study of liver diseases (AASLD) [24]. Subjects with other causes of liver disease were excluded, including excess alcohol intake (≥ 210 g/week for males and ≥ 140 g/week for females), chronic viral hepatitis, drug-induced liver injury, Wilson’s disease, alphal-antitrypsin deficiency, viral and autoimmune hepatitis, alphal-antitrypsin deficiency and alpha-l-antitrypsin deficiency. The healthy controls were confirmed by the same examination at Qingdao Municipal hospital.

Biochemical analyses

The basic clinical information (name, gender, age, body height, and weight) were obtained by a standard study questionnaire. The body mass index (BMI) of each subject was calculated equals to mass (kg)/height (m)2. Blood sample was collected from median vein of each subject after a 12-h overnight, and the blood sample was placed into an ethylene diamine tetraacetic acid (EDTA)-containing tube. The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyltranspeptidase (GGT), alkaline phosphatase (ALP), triglyceride (TG), total cholesterol (TC), high-density lipoprotein (HDL), low-density lipoprotein (LDL), total bilirubin (TBIL), fasting plasma glucose (FPG) were measured by standard clinical laboratory techniques (IChem-540 automatic biochemical analyzer, Shenzhen, China), respectively. Environmental factors were excluded in the study.

Genomic DNA extraction and genotyping

Blood genomic DNA was isolated with a genomic DNA purification kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions and stored at − 20 °C until use. The genotyping of 2 SNPs, rs17321515 and rs2954029, in the TRIB1 gene was conducted using the polymerase chain reaction (PCR). Primers for PCR were 5′- ACGTTGGATGTAGAAGTCCCCTTCCCTTAG -3′ and 5′- ACGTTGGATGGAACAAGGACTTTCGTCCTC-3′(reverse) for rs17321515, 5′- ACGTTGGATGACGAGCTTTGTGTCATGAGG- 3′, and 5′- ACGTTGGATGAGCTGCTGATGGTATTTTAC-3′ for rs2954029. PCR amplification was performed under the following conditions: an initial denaturation at 94 °C for 5 min, followed by 45 cycles of denaturing at 94 °C for 20 s, annealing at 56 °C for 30 s, and extending at 72 °C for 1 min. The genotypes of rs17321515 and rs2954029 were detected by direct DNA sequencing using the ABI veriti-384 Prism sequence detection system, and the raw data were analyzed using MassARRAY TYPER4.0 software (Agena, Inc). Genotyping was performed in blinded fashion and the success rates were > 95%.

Statistical analysis

Statistical analysis was carried out using the statistical package for the social sciences (SPSS), version 22.0 (SPSS Inc. Chicago, IL, USA). The Hardy-Weinberg equilibrium between expected and observed genotype distribution and the distributions of genotype between patients and controls were analyzed by Pearson’s χ2 test. Baseline characteristics of each subjects were tested by t test and reported as mean ± standard deviation (S.D.). The Genotypes and allele frequencies were evaluated using the χ2 test, and the distributions between the NAFLD patients and the healthy controls were analyzed using the Fisher exact test or the Pearson χ2 test, where appropriate. The association between SNP and NAFLD risk was estimated by computing odds ratios (ORs) and 95% confidence intervals (CI) from the multivariate logistic regression analyses. P <  0.05 was considered as statistically significant.

Results

Clinical characteristics of the study population

The clinical characteristics of NAFLD patients and healthy controls are shown in the Table 1. The two groups were matched for gender and age (both P > 0.05). The NAFLD patients had higher BMI value and serum levels of ALT, GGT, TG, TC, LDL and FPG than healthy controls (all P <  0.05), besides, the serum level of HDL in NAFLD patients was significant low compared to the healthy controls (P <  0.05), No significant differences of serum AST, ALP, TBIL levels were observed between NAFLD patients and healthy controls (all P > 0.05).
Table 1

Clinical Characteristics of Patients with NAFLD and Healthy Controlsa

NAFLD patients (n = 146)Controls (n = 175)P Value
Female (%)65 (44.52)87 (49.71)0.353
Age (y)61.08 ± 15.7060.15 ± 11.960.561
BMI (kg/m2)26.93 ± 3.8522.44 ± 2.88< 0.001
ALT (U/L)29.95 ± 17.6922.21 ± 20.63<  0.001
AST (U/L)24.22 ± 9.0122.88 ± 13.030.299
GGT (U/L)39.56 ± 26.4829.57 ± 36.350.006
ALP (U/L)70.99 ± 16.6973.75 ± 24.390.234
TG (mmol/L)1.92 ± 1.311.33 ± 0.76< 0.001
TC (mmol/L)5.47 ± 0.824.24 ± 1.39< 0.001
HDL (mmol/L)1.20 ± 0.221.30 ± 0.370.001
LDL (mmol/L)3.28 ± 0.533.11 ± 0.700.012
TBIL (umol/L)13.15 ± 4.6713.11 ± 5.180.942
FPG (mmol/L)5.62 ± 1.934.63 ± 0.84< 0.001

Abbreviations: BMI body mass index, ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TG triglyceride, TC total cholesterol, HDL high-density lipoprotein, LDL low-density lipoprotein, TBIL total bilirubin, FPG fasting plasma glucose, NAFLD nonalcoholic fatty liver disease

aValues are expressed as mean ± SD and compared by Student’s t-test

Clinical Characteristics of Patients with NAFLD and Healthy Controlsa Abbreviations: BMI body mass index, ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TG triglyceride, TC total cholesterol, HDL high-density lipoprotein, LDL low-density lipoprotein, TBIL total bilirubin, FPG fasting plasma glucose, NAFLD nonalcoholic fatty liver disease aValues are expressed as mean ± SD and compared by Student’s t-test

Genotype and allele distribution of TRIB1 rs17321515 and rs2954029

The genotype distributions of TRIB1 rs17321515 and rs2954029 were in accordance with the Hardy-Weinberg equilibrium in both the NAFLD patients and healthy controls (all P > 0.05) (Table 2). As described in the Table 3, there were significant differences in the genotypes and alleles distribution of TRIB1 rs17321515 between NAFLD patients and controls group (P = 0.038; P = 0.026, respectively). The TRIB1 rs17321515 GA + AA genotype was the significant risk factor for the development of NAFLD (OR = 1.885; 95%CI: 1.157–3.070; P = 0.010), after adjusted for age, gender, and body mass index, the risk of TRIB1 rs17321515 GA + AA genotype was still marked (OR = 2.240; 95%CI: 1.196–4.197; P = 0.012) (Table 4). There was no significant difference in the genotype distribution of TRIB1 rs2954029, between NAFLD patients and controls group (P = 0.076), but a noteworthy difference of TRIB1 rs2954029 allele distribution was observed between NAFLD patients and controls group (P = 0.045) (Table 3). The TRIB1 rs2954029 TA + AA genotype was the significant risk factor for the development of NAFLD (OR = 1.627; 95%CI: 1.011–2.619; P = 0.045), after adjusted for age, gender, and body mass index, the risk of TRIB1 rs2954029 TA + AA genotype was still significant (OR = 2.050; 95%CI: 1.110–3.786; P = 0.022) (Table 4).
Table 2

Results of the Hardy-Weinberg Equilibriuma

Gene LocusGroupsχ2P Value
rs17321515NAFLD patients0.4030.526
Controls1.6930.193
rs2954029NAFLD patients0.0410.840
Controls2.9050.088

aData were compared by chi-square test

Table 3

Distribution of Genotypes and Allele Frequencies of TRIB1 in NAFLD Patients and Controlsa,b

NAFLD patientsControlsχ2P Value
rs17321515
 Genotypes6.5990.038
  GG37 (26.6)67 (40.6)
  GA73 (52.5)70 (42.4)
  AA29 (20.9)28 (17.0)
 Alleles4.9420.026
  G147 (52.9)204 (61.8)
  A131 (47.1)126 (38.2)
rs2954029
 Genotypes5.1600.076
  TT40 (27.4)69 (39.4)
  TA74 (50.7)73 (41.7)
  AA32 (21.9)33 (18.9)
 Alleles4.0030.045
  T152 (52.4)211 (60.3)
  A138 (47.6)139 (39.7)

aData were compared by chi-square test

bValues are expressed as No. (%)

Table 4

Association of Genotypes with NAFLD in the Study Group a

UnadjustedAdjusteda
OR (95% CI)P ValueOR (95% CI)P Value
rs17321515
 GG11
 GA + AA1.885 (1.157–3.070)0.0102.240 (1.196–4.197)0.012
rs2954029
 TT11
 TA + AA1.627 (1.011–2.619)0.0452.050 (1.110–3.786)0.022

aBinary logistic regression model was adjusted for age, gender, and body mass index

Results of the Hardy-Weinberg Equilibriuma aData were compared by chi-square test Distribution of Genotypes and Allele Frequencies of TRIB1 in NAFLD Patients and Controlsa,b aData were compared by chi-square test bValues are expressed as No. (%) Association of Genotypes with NAFLD in the Study Group a aBinary logistic regression model was adjusted for age, gender, and body mass index

Association of the TRIB1 polymorphisms with clinical parameters in each group subjects

To investigate the potential correlation of TRIB1 polymorphisms with the clinical parameters in each study group, we compared the TRIB1 rs17321515 A allele and TRIB1 rs2953029 A allele with the clinical parameters of the overall series subjects, NAFLD patients and healthy controls. As shown in the Table 5, TRIB1 A allele carriers had the higher serum levels of GGT, TG, TC and LDL than non-carriers in the overall series (all P <  0.05). The higher serum level of LDL in the A allele carriers compared to the non-carriers in the NAFLD patients was observed (P <  0.05). In the healthy controls, the A allele carriers also had the higher serum TC level than non-carriers (P <  0.05). For the TRIB1 rs2953029, there were higher serum levels of GGT and LDL in the A allele carriers than non-carriers in the overall series (both P <  0.05), and the serum level of TC in the A allele carriers was significant high compared to the non-carriers in the healthy controls (P <  0.05) (Table 6).
Table 5

Clinical Characteristics of TRIB1 rs17321515 A Carriers and Non-Carriers in the Study Populationa

CharacteristicOverall SeriesNAFLD PatientsControls
Carriers(n = 200)Non-Carriers(n = 104)P ValueCarriers(n = 102)Non-Carriers(n = 37)P ValueCarriers(n = 98)Non-Carriers(n = 67)P Value
Female, %94 (47.0)50 (48.1)0.85848 (47.1)17 (45.9)0.90746 (46.9)33 (49.3)0.770
Age, y60.40 ± 13.9660.82 ± 13.730.80160.37 ± 15.5362.83 ± 16.140.39960.42 ± 12.1859.76 ± 12.290.735
BMI, kg/m224.68 ± 4.2924.12 ± 3.570.25527.01 ± 4.1926.73 ± 2.860.70222.27 ± 2.8122.66 ± 3.020.397
ALT, U/L27.27 ± 22.0923.65 ± 14.970.09330.23 ± 17.1929.25 ± 19.070.76624.18 ± 25.9719.92 ± 9.900.143
AST, U/L23.74 ± 11.8823.19 ± 11.110.69124.26 ± 8.5724.12 ± 10.140.93723.21 ± 14.5722.50 ± 11.400.736
GGT, U/L36.88 ± 37.7829.70 ± 20.290.03240.72 ± 26.7436.68 ± 25.920.41132.88 ± 46.3925.70 ± 15.160.156
ALP, U/L72.94 ± 20.3870.80 ± 23.170.40771.83 ± 15.3168.90 ± 19.770.34474.09 ± 24.6172.08 ± 24.800.607
TG, mmol/L1.98 ± 1.201.56 ± 1.070.0031.95 ± 1.341.83 ± 1.240.5992.33 ± 0.721.35 ± 0.860.893
TC, mmol/L5.37 ± 1.404.58 ± 1.29< 0.0015.42 ± 0.805.60 ± 0.880.2544.09 ± 1.213.93 ± 1.460.002
HDL, mmol/L1.25 ± 0.291.25 ± 0.360.8911.19 ± 0.211.21 ± 0.220.6541.31 ± 0.341.29 ± 0.410.706
LDL, mmol/L3.28 ± 0.682.91 ± 0.68< 0.0013.44 ± 0.593.32 ± 0.490.0253.11 ± 0.773.09 ± 0.590.863
TBIL, umol/L12.83 ± 4.6213.56 ± 5.180.20912.79 ± 4.3614.06 ± 5.310.18012.87 ± 4.9013.16 ± 4.980.708
FPG, mmol/L5.20 ± 1.704.91 ± 1.120.1075.75 ± 2.145.30 ± 1.220.1154.64 ± 0.714.65 ± 0.950.887

Abbreviations: BMI body mass index, ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TG triglyceride, TC total cholesterol, HDL high-density lipoprotein, LDL low-density lipoprotein, TBIL total bilirubin, FPG fasting plasma glucose, NAFLD nonalcoholic fatty liver disease

aValues are expressed as mean ± SD and compared by Student’s t-test

Table 6

Clinical Characteristics of TRIB1 rs2954029 A Carriers and Non-Carriers in the Study Populationa

CharacteristicOverall SeriesNAFLD PatientsControls
Carriers(n = 212)Non-Carriers(n = 109)P ValueCarriers(n = 106)Non-Carriers(n = 40)P ValueCarriers(n = 106)Non-Carriers(n = 69)P Value
Female, %97 (45.8)55 (50.5)0.42444 (41.5)21 (52.5)0.23353 (50)34 (49.3)0.925
Age, y60.70 ± 13.7960.08 ± 13.840.70460.94 ± 15.6061.39 ± 16.100.87460.48 ± 11.9059.64 ± 12.110.650
BMI, kg/m224.53 ± 4.2924.26 ± 3.480.56627.01 ± 4.2226.74 ± 2.840.69622.19 ± 2.7922.83 ± 2.990.157
ALT, U/L26.71 ± 21.7823.97 ± 15.290.24329.82 ± 17.0030.23 ± 19.410.90023.77 ± 25.2119.82 ± 9.900.217
AST, U/L23.68 ± 11.7423.23 ± 10.920.73824.12 ± 8.6024.46 ± 10.020.83623.27 ± 14.1122.28 ± 11.240.623
GGT, U/L36.53 ± 37.6029.64 ± 20.110.03541.06 ± 27.2836.08 ± 24.460.30432.26 ± 44.9525.42 ± 15.250.151
ALP, U/L73.09 ± 20.4471.19 ± 23.030.45271.59 ± 15.0869.60 ± 20.090.51674.51 ± 24.4372.58 ± 24.460.611
TG, mmol/L1.65 ± 1.171.49 ± 0.910.2331.95 ± 1.351.83 ± 1.210.6091.36 ± 0.871.28 ± 0.540.515
TC, mmol/L4.71 ± 1.394.94 ± 1.780.1425.44 ± 0.825.54 ± 0.840.5354.57 ± 1.204.03 ± 1.470.008
HDL, mmol/L1.26 ± 0.291.25 ± 0.350.7211.20 ± 0.201.19 ± 0.240.9231.32 ± 0.341.27 ± 0.400.376
LDL, mmol/L3.17 ± 0.652.94 ± 0.720.0033.23 ± 0.512.88 ± 0.540.0563.12 ± 0.763.08 ± 0.590.705
TBIL, umol/L12.90 ± 4.6713.55 ± 5.470.26812.72 ± 4.3914.16 ± 5.180.09213.06 ± 4.9413.20 ± 5.560.860
FPG, mmol/L5.16 ± 1.674.94 ± 1.180.2255.74 ± 2.125.35 ± 1.370.2724.61 ± 0.774.67 ± 0.940.656

Abbreviations: BMI body mass index, ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TG triglyceride, TC total cholesterol, HDL high-density lipoprotein, LDL low-density lipoprotein, TBIL total bilirubin, FPG fasting plasma glucose, NAFLD nonalcoholic fatty liver disease

aValues are expressed as mean ± SD and compared by Student’s t-test

Clinical Characteristics of TRIB1 rs17321515 A Carriers and Non-Carriers in the Study Populationa Abbreviations: BMI body mass index, ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TG triglyceride, TC total cholesterol, HDL high-density lipoprotein, LDL low-density lipoprotein, TBIL total bilirubin, FPG fasting plasma glucose, NAFLD nonalcoholic fatty liver disease aValues are expressed as mean ± SD and compared by Student’s t-test Clinical Characteristics of TRIB1 rs2954029 A Carriers and Non-Carriers in the Study Populationa Abbreviations: BMI body mass index, ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TG triglyceride, TC total cholesterol, HDL high-density lipoprotein, LDL low-density lipoprotein, TBIL total bilirubin, FPG fasting plasma glucose, NAFLD nonalcoholic fatty liver disease aValues are expressed as mean ± SD and compared by Student’s t-test

Discussion

NAFLD is one of the most prevalent chronic liver diseases in the world and causes related morbidity and mortality of HCC [25]. NAFLD is a complicated manifestation of metabolic syndrome which characterized with obesity, insulin resistant, type 2 diabetes mellitus, hyperlipidemia, the risk of NAFLD development is significant associated with the environmental factors and genetic factors and so on [26-28]. Single nucleotide polymorphism (SNP) as a significant genetic factor, plays an important role in the development of NAFLD [29]. Many variants in PNPLA3, TM6SF2, MBOAT7, GCKR and so on which are significant associated with the risk of NAFLD had been found by genome-wide association studies [30]. In this study, we investigated the relationship of TRIB1 rs17321515 and rs2954029 gene polymorphisms with the risk of NAFLD in the Chinese Han population for the first time. We found that TRIB1 rs17321515 A and rs2954029 A alleles were significantly associated with the risk of development of NAFLD, and the genotype distribution of TRIB1 rs17321515 was significant different between NAFLD patients and healthy controls. Tribbles-1 (TRIB1) is one of the member of tribbles family that was first identified in Drosophila and possesses the function to regulate the cell division and migration [12, 13], subsequent studies confirmed that TRIB1 encodes a human homologue of the Drosophila tribbles protein and the association of TRIB1 variant with the serum lipids metabolism was discovered by GWAS in the European population [14, 31]. In view of the new role of TRIB1 in lipoprotein metabolism, Burkhardt et al. investigated the role of hepatic TRIB1 on the serum lipoproteins in mice, they found the serum levels of TG and cholesterol were significant variational in the TRIB1-knockout mice or mice with TRIB1 hepatic-specific overexpression [32]. Accumulated evidences had been reported which focus on the significant role of TRIB1 rs17321515 and rs2954029 in the development of NAFLD in different ethnic groups. In a Spanish familial hypercholesterolemia cohort study, the higher waist circumference and higher serum TG level were observed in the rs1732151 A/A carriers [33]. In a 10-year follow-up of the GLACIER study, Varga et al. reported that TRIB1 rs2954029 was strongly associated with the 10-year changes in lipid levels [34]. In consideration of deficient data of TRIB1 rs17321515 and rs2954029 in the lipids metabolism in Chinese Han population, we investigated the relationship of TRIB1 rs17321515 and rs2954029 with the risk of NAFLD and their effects on lipid profiles in Chinese Han population. We observed that TRIB1 rs17321515 A and rs2954029 A alleles were significantly associated with the development risk of NAFLD, and the genotype distribution of rs17321515 was markedly different between NAFLD patients and healthy controls. In addition, rs17321515 A carriers possess the higher serum levels of GGT, TG, TC, and LDL in the overall series, higher LDL level in NAFLD patients and higher TC level in healthy controls. Similar, rs2954029 A carriers possess the higher serum levels of GGT and LDL in the overall series and higher TC levels in healthy controls, the results above-mentioned were consist with the previous studies which conducted in other countries. There are some limitations of our study that must be acknowledged, 1) the lacking of liver biopsy is the main limitation of our study, however, liver biopsy is invasive, which may lead to a small risk of serious morbidity. Thereby, we used abdominal ultrasound to diagnose NAFLD in the present study; 2) all the included subjects in this study are Han nationality, our conclusion may not be applicable to other nationality absolutely; 3) the amount of subjects were still relative small, more subjects should be included in the future study.

Conclusion

In summary, we investigated the relationship of TRIB1 rs17321515 and rs2954029 with the development of NAFLD and lipids metabolism in Chinese Han population for the first time. Our results showed that TRIB1 rs17321515 and rs2954029 were significant associated with the risk of NAFLD, and the rs17321515 A and rs2954029 A alleles affect the serum levels of multiple lipid profiles in included subjects. Further studies in larger and multiple ethnic populations are needed to confirm the present data.
  34 in total

1.  HUMAN EXPERIMENTATION. CODE OF ETHICS OF THE WORLD MEDICAL ASSOCIATION. DECLARATION OF HELSINKI.

Authors:  P P RICKHAM
Journal:  Br Med J       Date:  1964-07-18

2.  TRIB1 and GCKR polymorphisms, lipid levels, and risk of ischemic heart disease in the general population.

Authors:  Anette Varbo; Marianne Benn; Anne Tybjærg-Hansen; Peer Grande; Børge G Nordestgaard
Journal:  Arterioscler Thromb Vasc Biol       Date:  2010-11-11       Impact factor: 8.311

Review 3.  Tribbles: a family of kinase-like proteins with potent signalling regulatory function.

Authors:  Z Hegedus; A Czibula; E Kiss-Toth
Journal:  Cell Signal       Date:  2006-09-11       Impact factor: 4.315

4.  Guidelines for the diagnosis and management of nonalcoholic fatty liver disease: update 2010: (published in Chinese on Chinese Journal of Hepatology 2010; 18:163-166).

Authors:  Jian Gao Fan; Ji Dong Jia; You Ming Li; Bing Yuan Wang; Lun Gen Lu; Jun Pin Shi; Lik Yuen Chan
Journal:  J Dig Dis       Date:  2011-02       Impact factor: 2.325

5.  Trib1 is a lipid- and myocardial infarction-associated gene that regulates hepatic lipogenesis and VLDL production in mice.

Authors:  Ralph Burkhardt; Sue-Anne Toh; William R Lagor; Andrew Birkeland; Michael Levin; Xiaoyu Li; Megan Robblee; Victor D Fedorov; Masahiro Yamamoto; Takashi Satoh; Shizuo Akira; Sekar Kathiresan; Jan L Breslow; Daniel J Rader
Journal:  J Clin Invest       Date:  2010-11-15       Impact factor: 14.808

6.  Polymorphism at the TRIB1 gene modulates plasma lipid levels: insight from the Spanish familial hypercholesterolemia cohort study.

Authors:  A Garcia-Rios; P Perez-Martinez; P Mata; F Fuentes; J Lopez-Miranda; R Alonso; J Caballero; N Mata; F Perez-Jimenez; J M Ordovas
Journal:  Nutr Metab Cardiovasc Dis       Date:  2010-08-06       Impact factor: 4.222

7.  Polymorphisms at newly identified lipid-associated loci are associated with blood lipids and cardiovascular disease in an Asian Malay population.

Authors:  E Shyong Tai; Xue Ling Sim; Twee Hee Ong; Tien Yin Wong; Seang Mei Saw; Tin Aung; Sekar Kathiresan; Marju Orho-Melander; Jose M Ordovas; Jonathan T Tan; Mark Seielstad
Journal:  J Lipid Res       Date:  2008-11-05       Impact factor: 5.922

8.  Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans.

Authors:  Sekar Kathiresan; Olle Melander; Candace Guiducci; Aarti Surti; Noël P Burtt; Mark J Rieder; Gregory M Cooper; Charlotta Roos; Benjamin F Voight; Aki S Havulinna; Björn Wahlstrand; Thomas Hedner; Dolores Corella; E Shyong Tai; Jose M Ordovas; Göran Berglund; Erkki Vartiainen; Pekka Jousilahti; Bo Hedblad; Marja-Riitta Taskinen; Christopher Newton-Cheh; Veikko Salomaa; Leena Peltonen; Leif Groop; David M Altshuler; Marju Orho-Melander
Journal:  Nat Genet       Date:  2008-01-13       Impact factor: 38.330

9.  Nonalcoholic fatty liver disease in lean individuals in the United States.

Authors:  Zobair M Younossi; Maria Stepanova; Francesco Negro; Shareh Hallaji; Youssef Younossi; Brian Lam; Manirath Srishord
Journal:  Medicine (Baltimore)       Date:  2012-11       Impact factor: 1.889

10.  Newly identified loci that influence lipid concentrations and risk of coronary artery disease.

Authors:  Cristen J Willer; Serena Sanna; Anne U Jackson; Angelo Scuteri; Lori L Bonnycastle; Robert Clarke; Simon C Heath; Nicholas J Timpson; Samer S Najjar; Heather M Stringham; James Strait; William L Duren; Andrea Maschio; Fabio Busonero; Antonella Mulas; Giuseppe Albai; Amy J Swift; Mario A Morken; Narisu Narisu; Derrick Bennett; Sarah Parish; Haiqing Shen; Pilar Galan; Pierre Meneton; Serge Hercberg; Diana Zelenika; Wei-Min Chen; Yun Li; Laura J Scott; Paul A Scheet; Jouko Sundvall; Richard M Watanabe; Ramaiah Nagaraja; Shah Ebrahim; Debbie A Lawlor; Yoav Ben-Shlomo; George Davey-Smith; Alan R Shuldiner; Rory Collins; Richard N Bergman; Manuela Uda; Jaakko Tuomilehto; Antonio Cao; Francis S Collins; Edward Lakatta; G Mark Lathrop; Michael Boehnke; David Schlessinger; Karen L Mohlke; Gonçalo R Abecasis
Journal:  Nat Genet       Date:  2008-01-13       Impact factor: 38.330

View more
  8 in total

1.  TRIB1 regulates LDL metabolism through CEBPα-mediated effects on the LDL receptor in hepatocytes.

Authors:  Katherine Quiroz-Figueroa; Cecilia Vitali; Donna M Conlon; John S Millar; John W Tobias; Robert C Bauer; Nicholas J Hand; Daniel J Rader
Journal:  J Clin Invest       Date:  2021-11-15       Impact factor: 14.808

2.  Association between the LRP5 rs556442 gene polymorphism and the risks of NAFLD and CHD in a Chinese Han population.

Authors:  Dongli Han; Haiying Zhang; Shousheng Liu; Likun Zhuang; Zhenzhen Zhao; Hongguang Ding; Yongning Xin
Journal:  BMC Gastroenterol       Date:  2022-06-22       Impact factor: 2.847

3.  PIN1, a perspective on genetic biomarker for nonalcoholic fatty liver disease (NAFLD).

Authors:  Jing-Zhang Wang; Yu-Hua Zhang; Jing Bai; Yan-Wei Liu; Wen-Tao Du
Journal:  Metabol Open       Date:  2019-08-06

Review 4.  Mitochondrial Mutations and Genetic Factors Determining NAFLD Risk.

Authors:  Siarhei A Dabravolski; Evgeny E Bezsonov; Mirza S Baig; Tatyana V Popkova; Ludmila V Nedosugova; Antonina V Starodubova; Alexander N Orekhov
Journal:  Int J Mol Sci       Date:  2021-04-24       Impact factor: 5.923

Review 5.  The genetic interactions between non-alcoholic fatty liver disease and cardiovascular diseases.

Authors:  Nicholas W S Chew; Bryan Chong; Cheng Han Ng; Gwyneth Kong; Yip Han Chin; Wang Xiao; Mick Lee; Yock Young Dan; Mark D Muthiah; Roger Foo
Journal:  Front Genet       Date:  2022-08-10       Impact factor: 4.772

6.  Interaction between Coffee Drinking and TRIB1 rs17321515 Single Nucleotide Polymorphism on Coronary Heart Disease in a Taiwanese Population.

Authors:  Yin-Tso Liu; Disline Manli Tantoh; Lee Wang; Oswald Ndi Nfor; Shu-Yi Hsu; Chien-Chang Ho; Chia-Chi Lung; Horng-Rong Chang; Yung-Po Liaw
Journal:  Nutrients       Date:  2020-05-02       Impact factor: 5.717

Review 7.  Genetics of Non-Alcoholic Fatty Liver and Cardiovascular Disease: Implications for Therapy?

Authors:  Karthik Chandrasekharan; William Alazawi
Journal:  Front Pharmacol       Date:  2020-01-08       Impact factor: 5.810

Review 8.  Peroxisome Proliferator-Activated Receptors and Their Novel Ligands as Candidates for the Treatment of Non-Alcoholic Fatty Liver Disease.

Authors:  Anne Fougerat; Alexandra Montagner; Nicolas Loiseau; Hervé Guillou; Walter Wahli
Journal:  Cells       Date:  2020-07-08       Impact factor: 6.600

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.