| Literature DB >> 30847083 |
Feng-Ming Ren1,2, Ying-Wei Wang3, Zhi-Chao Xu1, Ying Li1, Tian-Yi Xin1, Jian-Guo Zhou1, Yao-Dong Qi1, Xue-Ping Wei1, Hui Yao1, Jing-Yuan Song1.
Abstract
The genus Corydalis is recognized as one of the most taxonomically challenging plant taxa. It is mainly distributed in the Himalaya-Hengduan Mountains, a global biodiversity hotspot. To date, no effective solution for species discrimination and taxonomic assignment in Corydalis has been developed. In this study, five nuclear and chloroplast DNA regions, ITS, ITS2, matK, rbcL, and psbA-trnH, were preliminarily assessed based on their ability to discriminate Corydalis to eliminate inefficient regions, and the three regions showing good performance (ITS, ITS2 and matK) were then evaluated in 131 samples representing 28 species of 11 sections of four subgenera in Corydalis using three analytical methods (NJ, ML, MP tree; K2P-distance and BLAST). The results showed that the various approaches exhibit different species identification power and that BLAST shows the best performance among the tested approaches. A comparison of different barcodes indicated that among the single barcodes, ITS (65.2%) exhibited the highest identification success rate and that the combination of ITS + matK (69.6%) provided the highest species resolution among all single barcodes and their combinations. Three Pharmacopoeia-recorded medicinal plants and their materia medica were identified successfully based on the ITS and ITS2 regions. In the phylogenetic analysis, the sections Thalictrifoliae, Sophorocapnos, Racemosae, Aulacostigma, and Corydalis formed well-supported separate lineages. We thus hypothesize that the five sections should be classified as an independent subgenus and that the genus should be divided into three subgenera. In this study, DNA barcoding provided relatively high species discrimination power, indicating that it can be used for species discrimination in this taxonomically complicated genus and as a potential tool for the authentication of materia medica belonging to Corydalis.Entities:
Keywords: Corydalis; DNA barcoding; biodiversity hotspot; matK; species identification; the internal transcribed spacer
Year: 2019 PMID: 30847083 PMCID: PMC6392370 DOI: 10.1002/ece3.4886
Source DB: PubMed Journal: Ecol Evol ISSN: 2045-7758 Impact factor: 2.912
Figure 1The specialized habitats of Corydalis saxicola in dry limestone cliffs
Primers, their sequences, and the PCR amplification conditions used in this study
| Regions | Primer pairs | Sequence 5ʹ−3ʹ | Thermocycling conditions | Source |
|---|---|---|---|---|
| ITS | ITS‐5F | GGAAGTAAAAGTCGTAACAAGG | 94°C 3 min; [35 cycles: 94°C 60 s, 53°C 90 s, 72°C 90 s]; 72°C 10 min | White, Bruns, Lee, & Taylor, ( |
| ITS‐4R | CCTTATCATTTAGAGGAAGGAG | |||
| ITSa | ITS‐5F | GGAAGTAAAAGTCGTAACAAGG | 94°C 3 min; [35 cycles: 94°C 60 s, 53°C 90 s, 72°C 90 s]; 72°C 10 min | Chen et al. ( |
| ITS‐300R | ATTCACACCAAGTATCGCAT | |||
| ITSb | ITS2‐2F | ATTCACACCAAGTATCGCAT | ||
| ITS‐4R | CCTTATCATTTAGAGGAAGGAG | |||
|
| 3F‐KIM | CGTACAGTACTTTTGTGTTTACGAG | 94°C 3 min; [35 cycles: 94°C 60 s, 52°C 60 s, 72°C 90 s]; 72°C 10 min | CBOL Plant Working Group ( |
| 1R‐KIM | ACCCAGTCCATCTGGAAATCTTGGTTC |
Evaluation of three DNA barcoding regions
| DNA regions | ITS |
| ITS2 |
|---|---|---|---|
| Percentage PCR success (%) | 100 | 100 | / |
| Sequencing using a single primer pair (%) | 89.0 | 100 | / |
| No. accessions/total | 121 | 121 | 121 |
| Sequence length (bp) | 519–581 | 842–858 | 222–246 |
| Aligned sequence length (bp) | 680 | 883 | 275 |
| No. variable sites (%) | 258 (37.9) | 219 (26.3) | 123 (44.7) |
| No. informative sites (%) | 194 (28.5) | 167 (18.9) | 94 (34.2) |
| No. indel (length in bp) | 26 (1–22) | 10 (1–12) | 9 (1–22) |
| Intraspecific distance mean (range) | 0.0103 (0–0.0317) | 0.0016 (0–0.0062) | 0.0159 (0–0.0579) |
| Interspecific distance mean (range) | 0.0705 (0.0024–0.1185) | 0.0474 (0–0.0878) | 0.1026 (0.0014–0.1981) |
Figure 2Relative distributions of intraspecific and interspecific K2P distances
The comparative analysis of different analytical methods for species resolution
| Species resolution (%) of the potential barcodes | |||||
|---|---|---|---|---|---|
| Method | ITS |
| ITS2 | ITS + matK | ITS2 + |
| BLAST | 65.2 | 56.5 | 60.9 | 69.6 | 60.9 |
| K2P‐distance | 56.5 | 52.2 | 52.2 | 65.2 | 65.2 |
| NJ tree | 65.2 | 47.8 | 60.9 | 65.2 | 65.2 |
| ML tree | 60.9 | 52.2 | 56.5 | 60.9 | 60.9 |
| MP tree | 52.2 | 47.8 | 52.2 | 60.9 | 60.9 |
Figure 4The maximum likelihood tree of 28 Corydalis species and two outgroup species of Papaveraceae based on ITS + matK regions
Figure 3Two closely related medicinal plants Corydalis tomentella and Corydalis saxicola