| Literature DB >> 30847077 |
Fitri Y Amandita1,2, Katja Rembold3,4, Barbara Vornam1, Sri Rahayu5, Iskandar Z Siregar6, Holger Kreft3, Reiner Finkeldey1,7.
Abstract
The rapid conversion of Southeast Asian lowland rainforests into monocultures calls for the development of rapid methods for species identification to support ecological research and sustainable land-use management. Here, we investigated the utilization of DNA barcodes for identifying flowering plants from Sumatra, Indonesia. A total of 1,207 matK barcodes (441 species) and 2,376 rbcL barcodes (750 species) were successfully generated. The barcode effectiveness is assessed using four approaches: (a) comparison between morphological and molecular identification results, (b) best-close match analysis with TaxonDNA, (c) barcoding gap analysis, and (d) formation of monophyletic groups. Results show that rbcL has a much higher level of sequence recoverability than matK (95% and 66%). The comparison between morphological and molecular identifications revealed that matK and rbcL worked best assigning a plant specimen to the genus level. Estimates of identification success using best-close match analysis showed that >70% of the investigated species were correctly identified when using single barcode. The use of two-loci barcodes was able to increase the identification success up to 80%. The barcoding gap analysis revealed that neither matK nor rbcL succeeded to create a clear gap between the intraspecific and interspecific divergences. However, these two barcodes were able to discriminate at least 70% of the species from each other. Fifteen genera and twenty-one species were found to be nonmonophyletic with both markers. The two-loci barcodes were sufficient to reconstruct evolutionary relationships among the plant taxa in the study area that are congruent with the broadly accepted APG III phylogeny.Entities:
Keywords: DNA marker; EFForTS project; Sumatra; matK; molecular identification; rbcL
Year: 2019 PMID: 30847077 PMCID: PMC6392390 DOI: 10.1002/ece3.4875
Source DB: PubMed Journal: Ecol Evol ISSN: 2045-7758 Impact factor: 2.912
Universal primers of matK and rbcL used in DNA amplification and sequencing
| No. | Region | Name of primer | Primer sequence (5′ → 3′) | References |
|---|---|---|---|---|
| 1 |
|
| CGTACAGTACTTTTGTGTTTACGAG | Ki‐Joong Kim (unpublished) |
|
| ACCCAGTCCATCTGGAAATCTTGGTTC | Ki‐Joong Kim (unpublished) | ||
|
| CGATCTATTCATTCAATATTTC | Cuenoud et al. ( | ||
|
| GGACAATGATCCAATCAAGGC | Dayananda, Ashton, Williams, & Primack ( | ||
| 2 |
|
| ATGTCACCACAAACAGAGACTAAAGC | Krees and Erickson ( |
|
| GAAACGGTCTCTCCAACGCAT | Fazekas et al. ( |
Figure 1Frequency (%) distribution of intraspecific and interspecific divergences of pairwise sequences of matK (a), rbcL (b), and matK+rbcL(c)
Percentage of monophyletic clades recovered in nine reconstructed phylogenetic trees
| Barcode | Monophyletic with support value >70% | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Maximum Parsimony (MP) | Neighbor Joining (NJ) | Maximum Likelihood (ML) | |||||||
| Family | Genus | Species | Family | Genus | Species | Family | Genus | Species | |
|
| 95.9 | 68.4 | 73.9 | 93.9 | 66.7 | 69.6 | 98.0 | 64.9 | 68.9 |
|
| 95.9 | 63.2 | 60.3 | 93.9 | 63.2 | 64.0 | 89.9 | 63.2 | 55.9 |
|
| 100.0 | 71.9 | 73.3 | 100.0 | 64.9 | 73.9 | 100.0 | 70.2 | 75.2 |
Figure 2Comparison between ordinal‐level phylogeny of flowering plants based on DNA barcodes and APG III (2009). The dash lines indicate that the two orders are not clearly separated. *Santalales in rbcL phylogeny tree is a nonmonophyletic clade