Literature DB >> 30828502

Development of 15 microsatellite loci in the endangered Streptanthus glandulosus subsp. niger (Brassicaceae).

Sarah M Swope1, Alan E Pepper2, Geneva T Lee1, Brittany A Burnett1, Hannah M Horten3.   

Abstract

PREMISE OF THE STUDY: The endangered Streptanthus glandulosus subsp. niger (Brassicaceae) is endemic to a single peninsula in California and threatened by fragmentation. We developed microsatellite markers to investigate genetic diversity in the two extant populations and the degree to which they have diverged from one another. METHODS AND
RESULTS: We used Illumina HiSeq high-throughput sequencing to develop 15 microsatellite markers, 14 of which were polymorphic. These di- and trinucleotide repeats yielded one to 11 alleles per locus in 61 plants across the two populations. Levels of observed and expected heterozygosities ranged from 0.108 to 0.946 and 0.257 to 0.839, respectively. We demonstrated cross-amplification in a second rare subspecies, S. glandulosus subsp. secundus, and in the widespread congener S. tortuosus.
CONCLUSIONS: These are the first microsatellites reported for this subspecies, and they will aid in the inclusion of genetic information in conservation planning. Cross-amplification was demonstrated in two related taxa, including one of conservation concern.

Entities:  

Keywords:  Brassicaceae; Streptanthus glandulosus subsp. niger; Streptanthus glandulosus subsp. secundus; Streptanthus tortuosus; conservation; fragmentation; microsatellite; population genetics

Year:  2019        PMID: 30828502      PMCID: PMC6384297          DOI: 10.1002/aps3.1215

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


The genus Streptanthus Nutt. (Brassicaceae) is noteworthy for the remarkable morphological diversity, adaptations to unusual soil types, and rarity of its ~35 species (Cacho et al., 2014). Streptanthus glandulosus Hook. subsp. niger (Greene) Al‐Shehbaz, M. S. Mayer & D. W. Taylor is adapted to serpentine soils that are characterized by high concentrations of heavy metals and low concentrations of macronutrients. It has one of the most restricted ranges of all members of this group, confined to the 6‐km‐long Tiburon Peninsula (Marin County, California, USA). It is pollinated by bees and is capable of self‐pollination. Streptanthus glandulosus subsp. niger occupied a large portion of the Tiburon Peninsula prior to suburban development in the mid‐20th century but now persists as two populations separated by 1.5 km of dense housing and is listed as Endangered at both the state and federal levels (California Department of Fish and Wildlife, 2014; U.S. Fish and Wildlife Service, 2019). The population at Middle Ridge Park is smaller than the population at Old St. Hilary's Preserve. The total number of plants ranges from ~500 to 3000 depending on annual precipitation (Swope, unpublished data). Nothing is known about the genetic diversity or structure of the two remaining populations or gene flow between them. Although microsatellites are widely used to answer these questions and may be useful in conservation planning, none exist for this subspecies.

METHODS AND RESULTS

Fresh leaves were collected from 40 individuals at Old St. Hilary's Preserve and 24 at Middle Ridge Park, stored in separate envelopes at room temperature with silica beads (PolyLam Products, Williamsville, New York, USA), and extracted within one week of collection. DNA was extracted by placing 3–4 mm of dried leaf tissue in 300 μL of a 10% Chelex solution (Bio‐Rad Laboratories, Hercules, California, USA), vortexing samples for 10 s, then spinning them for another 10 s to ensure that plant material was in the solution. The solution was incubated at 65°C for 10 min, followed by another round of vortexing for 10 s. Finally, we centrifuged the samples for 10 s to separate contaminants and Chelex beads from the DNA in the supernatant. We diluted the supernatant from the Chelex extraction 1 : 1 with distilled H2O. A microsatellite library was created using extracted genomic DNA from three individuals, one from the Middle Ridge Park population and two collected from opposite ends of the larger Old St. Hilary's Preserve population. Due to restrictions on collecting, our specimens were vouchered with existing herbarium collections (Appendix 1). DNA was sent to the QB3 Genomics Sequencing Laboratory at the University of California, Berkeley, for shotgun library preparation and 2 × 300‐bp paired‐end Illumina HiSeq genome sequencing. Approximately nine million FASTQ reads per sample were filtered for minimum length (50 bp) and trimmed for quality using Trimmomatic version 0.23.3 (Bolger et al., 2014) using a window size of 4 bp with a threshold average quality of Phred = 25, and a minimum score of 15 at the leading and trailing ends of the read. Reads were assembled de novo with ABySS (Simpson et al., 2009) using a K‐mer size of 41 bp, a minimum bubble identity of 0.9, and a minimum contig size of 300 bp. To avoid acquisition bias, we selected loci that were identified as microsatellites in all three genomic DNA assemblies using misa.pl (Beier et al., 2017) in a search for dimeric and trimeric repeats with a minimum of six repeat units. Loci were pre‐screened for polymorphism by “round‐robin” mapping trimmed reads from each genomic DNA to the other two genome assemblies using Bowtie2 (Langmead and Salzberg, 2012) using pre‐set default parameters, followed by variant calling using NGSEP version 3.0.3 (Perea et al., 2016) with a ploidy of two. Evidence from transcriptome sequencing indicates that a common ancestor to S. glandulosus subsp. niger and other members of the tribe Thelypodieae underwent a major (possibly whole genome) duplication event ~8–10 mya (Kagale et al., 2014; Hawkins et al., 2017). A diploid chromosome number of 2n = 28 is almost universally conserved across the tribe (Warwick and Al‐Shehbaz, 2006). Rare reports of unusual karyotypes (e.g., 2n = 14, 2n = 56) show no phylogenetic pattern (Cacho et al., 2014) and thus appear to be sporadic in nature. In Caulanthus amplexicaulis S. Watson, a 2n = 28 sister taxon to S. glandulosus subsp. niger, 250 of 258 microsatellite markers (97%) produced a single amplification product from each of two distinct homozygous inbred lines. Considered together, these lines of evidence justify the selection of diploid as a ploidy parameter. Genomic coordinates identified as microsatellites by misa.pl were thus filtered for the presence of dimeric and trimeric repeats in all three assemblies that were in all cases called by NGSEP as “STR” and “INDEL” with a minimum confidence score of 100. Forty‐one microsatellite loci met these criteria. Primers for the 41 loci were designed to have 35–55% GC content, a target melting temperature of 64–65°C (salt‐adjusted, 50 mM NaCl), and an amplicon size of 90–150 bp. A subset of 23 loci were screened for amplification by electrophoresing the products on a 4% SFR agarose gel (VWR Life Science, Philadelphia, Pennsylvania, USA) with an Invitrogen 100‐bp ladder (Invitrogen, Carlsbad, California, USA) using nine S. glandulosus subsp. niger individuals. Of those 23 loci, 15 produced consistent and robust amplification products and thus were suitable for genotyping. Sequence library data were deposited into the National Center for Biotechnology Information Sequence Read Archive (BioProject ID PRJNA503999). PCR conditions were optimized using a Bio‐Rad T100 Thermal Cycler (Bio‐Rad Laboratories). Amplification reactions were singleplexed in a final volume of 25.5 μL containing approximately 2 ng of DNA, 12.5 μL of Q5 High‐Fidelity DNA Polymerase (New England BioLabs, Ipswich, Massachusetts, USA), 1 μL of Milli‐Q water (MilliporeSigma, Burlington, Massachusetts, USA), and 0.5 μM of each forward and reverse primer. The PCR program consisted of one cycle of denaturation at 98°C for 30 s; followed by 34 cycles at 98°C for 40 s, 60°C for 30 s, 72°C for 20 s; and an extension phase at 72°C for 1 min. Forward primers were fluorescently labeled at the 5′ end with HEX or FAM (Eurofins, Louisville, Kentucky, USA). PCR products were diluted (1 : 30 to 1 : 75) and run with 0.2 μL of GeneScan 600 LIZ‐labeled internal size standard (Thermo‐Fisher Scientific, Waltham, Massachusetts, USA) and 9 μL of Hi‐Di Formamide (Applied Biosystems, Foster City, California, USA) in a single lane and analyzed using an Applied Biosystems 3730XL DNA Analyzer. Allele sizes (Table 1) and peaks were determined using Peak Scanner 2.0 (Thermo‐Fisher Scientific).
Table 1

Characteristics of 15 microsatellite loci developed for Streptanthus glandulosus subsp. niger

Locus Primer sequences (5′–3′)Repeat motifAllele size range (bp) T a (°C)Fluorescent labelGenBank accession no.
Sn50F: CTATGTCCTCCATAAACCTCAACGC(CAA)7 132–138 68FAM MG029359
R: GTTGAAGGTAAGGTACATTTGCCCTG
Sn255F: GGTTCCAGAACAGAAGAACTCAGC(CT)13 138–18266FAM MG029360
R: GCATTATTATCTGCTCTCTCATGTTGG
Sn262F: CATCTAACTTCTCTGTTAGATGAAAACG(CT)9 147–175 64FAM MG029357
R: CTCATACTTCTCTGCTTGAAGTTGG
Sn313F: GATGTCCACACAAACCATATGTACC(AT)10 157–171 65HEX MH316554
R: CAAACTAAATAGCTGAAAAGGGTTAAAAGG
Sn347F: CAATTGATTCCTTGATCTTCAATATTACC(TA)9 95–105 63FAM MG029355
R: GATCGCAGAAGTTACCGATGAAGG
Sn430F: GGCAGAGTGCATTAGGAGTTGACG(TA)8 131–14567FAM MG029364
R: CTAAACGGTAAAACCCAACATATGGTG
Sn463F: AAGAGAGGTTATCATGGCTAATGAAGC(AAC)4 82–10967FAM MG029358
R: CGACCGACGAGAAACCGAACG
Sn558F: GGAGACATGCAGCATCTCAACG(TC)11 92–114 64HEX MG029356
R: TCAACCCAAATTTAGAAAATCTATTGATTTGG
Sn588F: GAAATCGTTGCCACTACCTTCTGC(TCC)8 128–18263HEX MG029361
R: GAGAAGGAATACGAAGTAGAGAAC
Sn715F: CCCGTCAATCTCTAACGTCTAGC(TA)9 92–118 68FAM MH316555
R: TAGATGATTCAACCCACTGATTGTGC
Sn803F: GTTTAATATGGTTCAAAGCAGGACTGG(TA)8 141–197 63FAM MG029362
R: CTTTATTGGCTAATTGAATATTTGTAATCTCC
Sn1015F: TCATCGTATAACGGGAAAGGATCCA(TA)4 96–154 66HEX MH316558
R: CACGAAATTCGTGGTAGTATTTCGAG
Sn1434F: TGTATCTGTATTATCCTCACATGTAAATCC(TA)7 81 64HEX MH316552
R: CTGGAAGATTGTGACCTTATTCTTGG
Sn1618F: GAAATAGAGAGAGGAATCTCTGTCTG(CTT)6 139–16965FAM MG029363
R: GTGGGTTAGCACTACAATCTGGTG
Sn2378F: CAACAGTGTATATCAATTTGATATCACTGG(TAA)7 124–220 64FAM MH316557
R: CGTGCTTAGACCTACGAAGTTCC

T a = annealing temperature.

Characteristics of 15 microsatellite loci developed for Streptanthus glandulosus subsp. niger T a = annealing temperature. We used GenAlEx (Peakall and Smouse, 2012) to measure the number of alleles per locus and observed and expected heterozygosities. We used GENEPOP 4.7.0 (Rousset, 2008) to test for linkage disequilibrium and deviations from Hardy–Weinberg equilibrium using a sequential Bonferroni correction for multiple tests, and MICRO‐CHECKER 2.2.3 (van Oosterhout et al., 2004) to assess the presence of null alleles. The average number of alleles across all loci was 5.70 (±0.46 SE; range 1–11) (Table 2). Three loci (Sn313, Sn715, and Sn803) may harbor null alleles. We detected significant linkage disequilibrium between loci Sn558 and Sn463. Of the 15 loci, 12 deviated from Hardy–Weinberg equilibrium at the Old St. Hilary's Preserve site and five deviated at the Middle Ridge Park site (Table 2).
Table 2

Genetic diversity of 15 microsatellites developed for Streptanthus glandulosus subsp. niger and tested for cross‐amplification in S. glandulosus subsp. secundus and S. tortuosus.a

Locus Streptanthus glandulosus Cross‐amplificationc
Old St. Hilary's Preserve (n = 40)Middle Ridge Park (n = 24)
A H o b H e N A H o b H e N S. glandulosus subsp. secundus (n = 6) S. tortuosus (n = 10)
Sn5030.4050.4653720.3910.44023180–220 180–200
Sn25570.3780.3303790.5830.48524150–180 160–210
Sn26250.265** 0.6873470.391** 0.50423143–151147–153
Sn31360.450** 0.7293030.3000.48520
Sn34760.500** 0.5933650.2920.4442410080–140
Sn43080.946** 0.6663760.833** 0.79324136–142 134–144
Sn46340.378* 0.5153770.6670.7172488–94 100–140
Sn55870.361** 0.7663670.5000.7152486–94 150–300
Sn58840.541** 0.7173750.5000.55624128–144182
Sn71570.667** 0.75730100.714** 0.78820+
Sn803100.548** 0.73331110.800** 0.83920
Sn101550.243** 0.6693760.375** 0.67924
Sn143410.000NA 0.0003710.000NA 0.000248181
Sn161860.297** 0.2913730.4170.48724142–154 169
Sn237860.108** 0.4633740.2380.25721180–220 200–220

— = no amplification; + = amplification of more than two amplification products; A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled; N = number of successfully genotyped individuals.

Locality and voucher information are provided in Appendix 1.

Significant deviation from Hardy–Weinberg equilibrium (*P < 0.05, **P < 0.01, NA = not applicable).

Values represent allele size range in base pairs.

Genetic diversity of 15 microsatellites developed for Streptanthus glandulosus subsp. niger and tested for cross‐amplification in S. glandulosus subsp. secundus and S. tortuosus.a — = no amplification; + = amplification of more than two amplification products; A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled; N = number of successfully genotyped individuals. Locality and voucher information are provided in Appendix 1. Significant deviation from Hardy–Weinberg equilibrium (*P < 0.05, **P < 0.01, NA = not applicable). Values represent allele size range in base pairs. We tested all 15 loci for amplification in another rare subspecies (S. glandulosus subsp. secundus Greene) and a congener (S. tortuosus Kellogg) using the same protocol. Streptanthus glandulosus subsp. secundus is restricted to approximately three dozen populations in two neighboring counties, whereas S. tortuosus spans nearly the entire 1200‐km length of California. Eleven loci successfully amplified in both taxa (Table 2), producing one or two resolvable amplification products per individual, suggesting they amplified a single locus. Three loci produced no amplification products in either species, and one locus amplified more than one product in S. glandulosus subsp. secundus (Table 2).

CONCLUSIONS

We developed microsatellite markers for the endangered S. glandulosus subsp. niger and two congeners. Optimization of these markers will be useful in quantifying the genetic diversity in the two remaining populations of S. glandulosus subsp. niger and the degree to which these populations have diverged from one another. These markers may also be useful in comparative studies with S. glandulosus subsp. secundus, which is also of conservation concern.

AUTHOR CONTRIBUTIONS

S.M.S. conceived of the project, collected leaf tissue, supervised the lab and field work, conducted allele scoring and analyses, and wrote the manuscript. A.E.P. conducted the whole‐genome shotgun sequencing, contig assembly, and variant calling, and co‐authored the manuscript. G.T.L., B.A.B., and H.M.H. conducted the lab work and reviewed the manuscript.
TaxonCollection localityGeographic coordinatesb Voucher specimen accession no.c
Streptanthus glandulosus Hook. subsp. niger (Greene) Al‐Shehbaz, M. S. Mayer & D. W. TaylorTiburon Peninsula, Marin Co., CA, USA37°52′N, 122°27′WCAS‐BOT‐BC87245, CAS‐BOT‐BC87246, CAS‐BOT‐BC87253, UC163931, JEPS2879, JEPS73882, JEPS77161, JEPS9284
Streptanthus glandulosus subsp. secundus GreeneCarson Ridge, Marin Co., CA, USA37°57′N, 122°37′WCAS‐BOT‐BC87281, UC1492744
Bolinas Road, Marin Co., CA, USA37°57′N, 122°37′WCAS‐BOT‐BC87272
Terra Linda‐Sleepy Hollow, Marin Co., CA, USA38°01′N, 122°34′WCAS‐BOT‐BC87286
Streptanthus tortuosus KelloggGold Lake region, Plumas Co., CA, USA39°56′36″N, 121°08′03″WCAS‐BOT‐BC87795
Confluence of Rock Creek and north fork of Feather River, Plumas Co., CA, USA39°54′01″N, 121°21′31″WCAS‐BOT‐BC87797
Confluence of Granite Creek and north fork of Feather River, Plumas Co., CA, USA39°57′20″N, 121°17′44″WCAS‐BOT‐BC87783
East fork of Feather River, north of Red Hill, Plumas Co., CA, USA40°03′21″N, 121°12′28″WCAS‐BOT‐BC87785

Due to the protected status of S. glandulosus subsp. niger, new voucher specimens were not collected for this study; the vouchered specimens listed here are representative of the plants used in this study.

Geographic coordinates for S. glandulosus subsp. niger and S. glandulosus subsp. secundus have been reduced to minutes due to the protected status of these taxa.

Vouchers with the prefix CAS are deposited at the California Academy of Sciences Herbarium (CAS), San Francisco, California, USA; vouchers with the prefixes UC and JEPS are deposited at University and Jepson Herbaria (JEPS), University of California, Berkeley, California, USA.

  10 in total

1.  ABySS: a parallel assembler for short read sequence data.

Authors:  Jared T Simpson; Kim Wong; Shaun D Jackman; Jacqueline E Schein; Steven J M Jones; Inanç Birol
Journal:  Genome Res       Date:  2009-02-27       Impact factor: 9.043

2.  Novel nuclear markers inform the systematics and the evolution of serpentine use in Streptanthus and allies (Thelypodieae, Brassicaceae).

Authors:  N Ivalú Cacho; A Millie Burrell; Alan E Pepper; Sharon Y Strauss
Journal:  Mol Phylogenet Evol       Date:  2013-12-12       Impact factor: 4.286

3.  genepop'007: a complete re-implementation of the genepop software for Windows and Linux.

Authors:  François Rousset
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

4.  Fast gapped-read alignment with Bowtie 2.

Authors:  Ben Langmead; Steven L Salzberg
Journal:  Nat Methods       Date:  2012-03-04       Impact factor: 28.547

5.  Polyploid evolution of the Brassicaceae during the Cenozoic era.

Authors:  Sateesh Kagale; Stephen J Robinson; John Nixon; Rong Xiao; Terry Huebert; Janet Condie; Dallas Kessler; Wayne E Clarke; Patrick P Edger; Matthew G Links; Andrew G Sharpe; Isobel A P Parkin
Journal:  Plant Cell       Date:  2014-07-17       Impact factor: 11.277

6.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

7.  Bioinformatic analysis of genotype by sequencing (GBS) data with NGSEP.

Authors:  Claudia Perea; Juan Fernando De La Hoz; Daniel Felipe Cruz; Juan David Lobaton; Paulo Izquierdo; Juan Camilo Quintero; Bodo Raatz; Jorge Duitama
Journal:  BMC Genomics       Date:  2016-08-31       Impact factor: 3.969

8.  Transcriptome Signatures of Selection, Drift, Introgression, and Gene Duplication in the Evolution of an Extremophile Endemic Plant.

Authors:  Angela K Hawkins; Elyssa R Garza; Valerie A Dietz; Oscar J Hernandez; W Daryl Hawkins; A Millie Burrell; Alan E Pepper
Journal:  Genome Biol Evol       Date:  2017-12-01       Impact factor: 3.416

9.  MISA-web: a web server for microsatellite prediction.

Authors:  Sebastian Beier; Thomas Thiel; Thomas Münch; Uwe Scholz; Martin Mascher
Journal:  Bioinformatics       Date:  2017-08-15       Impact factor: 6.937

10.  Trimmomatic: a flexible trimmer for Illumina sequence data.

Authors:  Anthony M Bolger; Marc Lohse; Bjoern Usadel
Journal:  Bioinformatics       Date:  2014-04-01       Impact factor: 6.937

  10 in total
  1 in total

1.  Corrigendum.

Authors: 
Journal:  Appl Plant Sci       Date:  2021-12-03       Impact factor: 1.936

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.