Literature DB >> 30814421

Detection of Sarcocystis spp. and Shiga toxin-producing Escherichia coli in Japanese sika deer meat using a loop-mediated isothermal amplification-lateral flow strip.

Yoshiko Sugita-Konishi1, Naoki Kobayashi1, Kazuto Takasaki2, Takumi Kanno1, Miku Itoh1, Satoshi Futo2, Hiroshi Asakura3, Kensuke Taira4, Yasushi Kawakami1.   

Abstract

Game meat potentially harbors a number of parasitic and bacterial pathogens that cause foodborne disease. It is thus important to monitor the prevalence of such pathogens in game meats before retail and consumption to ensure consumer safety. In particular, Sarcocystis spp. and Shiga toxin-producing Escherichia coli (STEC) have been reported to be causative agents of food poisoning associated with deer meat consumption. To examine the prevalence of these microbiological agents on-site at a slaughterhouse, the rapid, simple and sensitive detection method known as the "DNA strip" has been developed, a novel tool combining loop-mediated isothermal amplification and a lateral flow strip. This assay has achieved higher sensitivity and faster than conventional PCR and is suitable for on-site inspection.

Entities:  

Keywords:  DNA strip; STEC; Sarcocystis spp.; deer meat; loop-mediated isothermal amplification

Mesh:

Substances:

Year:  2019        PMID: 30814421      PMCID: PMC6483920          DOI: 10.1292/jvms.18-0372

Source DB:  PubMed          Journal:  J Vet Med Sci        ISSN: 0916-7250            Impact factor:   1.267


Due to increasing numbers of sika deer (Cervus nippon) in Japan, the government recommends hunting these animals and consuming their meats as game meat in local restaurants and retail meat shops [12]. However, since Japanese abattoir law does not apply to the slaughter of game animals, the hunters must dissect and inspect the game by themselves. To guarantee the meat’s sanitation, a easy and quick assay that can be used during the slaughter of game animals to determine the presence of foodborne agents is needed. Many rapidly assay methods have been developed for foodborne bacteria, viruses and parasites, including immunochemical assays, conventional polymerase chain reaction (PCR), real time PCR and the loop-mediated isothermal amplification (LAMP) assay [18, 21, 28]. However, few of these methods have been validated using deer meat. Outbreaks of food poisoning have been caused by parasites, bacteria and viruses associated with the consumption of deer meat in Japan [1, 15, 24]. We recently reported that Sarcocystis spp. was one of such causative agents of food poisoning [14]. Kabeya et al. [13] also reported that Shiga toxin-producing Escherichia coli (STEC) detected in the feces of sika deer possessed potential human pathogenicity. Due to the high contamination frequency in meat or feces in Japan, Sarcocystis spp. and STEC [9, 13] were chosen as the subjects in this study. Given this background, we developed an easy, rapid and sensitive assay for the detection of Sarcocystis spp. and STEC in deer meat. The assay is called the “DNA strip” [23] and may be useful for on-site inspection in slaughterhouses. The “DNA strip” enables the detection of the amplification products by LAMP on a lateral flow DNA strip and has been validated by Takasaki et al. [23]. Specific primers for the detection of Sarcocystis spp. and STEC were designed by attaching unique oligonucleotides as a tag modification at the 5-terminal of the forward inner primer, while the 5′-terminal of the backward inner primer was biotin-modified. In this way, successfully amplified target DNA will have unique oligonucleotide tags attached and bind to immobilized complementary tags on the DNA strip. The biotin will bond to streptavidin provided in the DNA strip buffer, generating blue color enhancement. First, to confirm the performance of the “DNA strip” for the detection of 18S rRNA of Sarcocystis spp. (SarcoR) as well as the Shiga toxin genes (stx1 and stx2) of STEC, a LAMP assay was performed using the Sarcocyctis spp. and STEC isolates in PBS solution. Cyst of Sarcocystis spp. was collected from deer meat obtained from Yamanashi Prefecture, Japan. The STEC O157:H7 strain NIHS0106, which possesses both the stx1 and stx2 genes, was used as a positive control. These DNA were extracted using a QIAamp DNA mini kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The DNA concentration was measured by a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, U.S.A.), and the extracted DNA was prepared at 10-fold dilution to be amplified with the reaction mixture. The reaction mixture contained of 1.5x Isothermal Master Mix (OptiGene Ltd., West Sussex, U.K.), tagged specific primer for the detection of Sarcocyctis spp. and STEC, respectively, and 10 × template DNA. DNA amplification was performed for 60 min at 65°C. The tubes were put on ice for a minimum of 5 min to avoid contamination by completely stopping the reaction and performing evaporation at the end of the amplification. The amplification product (1 µl) was diluted 40-fold with distilled water and then mixed with 20 µl of development solution containing Latex beads (TBA Co., Ltd., Sendai, Japan). The DNA strip was dipped into the solution for 15 min, and the results were determined visually. The specific primer of SarcoR in Sarcocystis spp. and stx1 and stx2 in STEC for the LAMP assay are shown in Table 1.
Table 1.

The sequences and modification of the LAMP and PCR primers used in this study

MethodAssayPrimar nameSequenceRef.
DNA strip18S rRNA of Sarcocystis spp. (SarcoR)F3TGAAAACCTTGGCCGATAGGThis study
B3CCTTGTTACGACTTCTCCTTCCTC
FIP[tag]-GTAATCGGCGCAAGCTGCTGACGGTAATCTTTTGAGTATGCATCG
BIP[bi]-TGTACACACCGCCCGTCGCTCTTTCCATTCCGCACACGTTG
LFCTACTAGGCATTCCTCGTTGAAGAT
LBCTACCGATTGAGTGTTCCGGTGA

stx1F3GCGATTTATCTGCATCCCCGTATGTCTGGTGACAGTAGCTAT [4]
B3GGAACCTCACTGACGCAGTCCTTCAGCTGTCACAGTAACA
FIPACTGATCCCTGCAACACG
BIPTGTGGCAAGAGCGATGTT
LFACAACAGCGGTTACATTGT
LBGATCATCCAGTGTTGTACGAA

stx2F3GGCGTCATCGTATACACAGGAGCGCTTCAGGCAGATACAG
B3AGACGTGGACCTCACTCTGAAACTCTGACACCATCCTCTC
FIPCAGACAGTGCCTGACGAA
BIPGGCGAATCAGCAATGTGC
LFGCATCCAGAGCAGTTCTG
LBCAGTATAACGGCCACAGTC

Conventional PCR18S rRNA of Sarcocystis spp. (SarcoR)FGGATAACCGTGGTAATTCTATG [18]
RTCCTATGTCTGGACCTGGTGAG

stx1mStx1_FGGATAATTTGTTTGCAGTTGATGTC [17]
stx1mStx1_RCAAATCCTGTCACATATAAATTATTTCGT
stx2mStx2_FGGGCAGTTATTTTGCTGTGGA
stx2mStx2_RGAAAGTATTTGTTGCCGTATTAACG
According to a previous paper, some species of Sarcocystis have been parasitic to Japanese sika deer [9], such as S. wapiti, S. sybillensis, and S. hofmanni. However, except for S. wapiti, the DNA sequences of these species have never deposited in databases, so the sequences of the predominant Sarcocystis species in deer meat obtained from Yamanashi Prefecture, Japan, were determined in order to construct LAMP primers for SarcoR. The 18S rRNA region was PCR-amplified from DNA extracted from deer meat using universal 18S rRNA region primers, as described by Pritt et al. [20], that were able to detect the 18S rRNA region of Sarcocystis spp. universally (Table 1). We then followed by cloning into pCRTM 2.1-TOPO® in E. coli TOP10 obtained from the TOPO® TA Cloning Kit for Sequencing (Thermo Fisher Scientific Inc.). The successful transformants were then subjected to a cycle sequencing reaction using the BigDye terminator in an ABI 3730×l system to determine the target gene sequences. Finally, six sequences were obtained (LC405946-LC405951), and the LAMP primers were designed based on the obtained consensus sequences using a LAMP Designer (OptiGene, Ltd.). We used the oligonucleotide primers for the stx1 and stx2 genes reported elsewhere [6]. As shown in Fig. 1, we first evaluated the detection performance of the three target genes by LAMP-DNA strip testing. The results indicated that these genes could be discriminated on the DNA strip based on the attached tag sequences.
Fig. 1.

Performance of the DNA strip for the detection of the Sarcocystis spp. 18S rRNA gene (SarcoR) and the stx1 and stx2 genes. The template DNA was prepared from a cyst of Sarcocystis spp. or STEC O157:H7 strain NIHS0106. The primer mix:1,2: Sarco R, 3,4: stx 1, 5,6: stx 2 and 1,3 and 4 was with template. The arrow indicates each LAMP product.

Performance of the DNA strip for the detection of the Sarcocystis spp. 18S rRNA gene (SarcoR) and the stx1 and stx2 genes. The template DNA was prepared from a cyst of Sarcocystis spp. or STEC O157:H7 strain NIHS0106. The primer mix:1,2: Sarco R, 3,4: stx 1, 5,6: stx 2 and 1,3 and 4 was with template. The arrow indicates each LAMP product. Next, to determine the limit of detection (LOD) of this assay for both targets, LODs of conventional PCR for these targets were compared using various concentrations of bradizoids and the STEC strain. Conventional PCR for the rRNA of Sarcocystis spp. and for the stx1 and stx2 genes was performed according to the method of Pritt et al. [20] and Nielsen et al. [19], respectively. The bradizoids were prepared from Sarcocystis spp. according to the previous paper [9]. The Sarcocystis spp. (3.6 × 105 bradizoids/ml) or STEC strain (3.4 × 108 cfu/ml) was added to PBS containing 10% deer meat extract that had been confirmed to be free from Sarcocystis spp. as well as STEC and the solutions were diluted serially. The DNA in these dilutions was extracted using a QIAamp DNA mini kit (QIAGEN). In STEC, all serial dilutions of extracted DNA were used for this assay and conventional PCR. In Sarcocystis spp., dilutions from 3.6 × 105 to 3.6 × 101 bradizoids/ml were used for both assays. As a negative control, 10% deer meat extract alone in PBS was used. As a positive control for conventional PCR, 3.4 × 108 cfu/ml in PBS for STEC or a cyst of Sarcocystis spp. with 3.6 × 106 bradizoids/ml (data not shown) in PBS was used. As shown in Fig. 2, the visual LOD of bradizoids in this assay was determined to be 3.6 × 103 bradizoids/ml (Fig. 2A), which was 100 times more efficient than that of conventional PCR (Fig. 2B). The negative control showed no visual signals. The difference in the sensitivity seemed to be due to the amplification efficiency and detection procedure.
Fig. 2.

Sensitivity of (A) the DNA strip and (B) conventional PCR forthe detection of the 18S rRNA gene of Sarcocystis spp. 1: 3.6 × 105 bradizoids/ml in 10% deer meat extract, 2: 3.6 × 104 bradizoids/ml in 10% deer meat extract, 3: 3.6 × 103 bradizoids/ml in 10% deer meat extract, 4: 3.6 × 102 bradizoids/ml in 10% deer meat extract, 5: 3.6 × 101 bradizoids/ml in 10% deer meat extract, 6: negative sample (10% deer meat extract only), 7: positive sample (Sarcocyst) in PBS. M: molecular marker, SarcoR: Sarcocystis spp.18S rRNA gene.

Sensitivity of (A) the DNA strip and (B) conventional PCR forthe detection of the 18S rRNA gene of Sarcocystis spp. 1: 3.6 × 105 bradizoids/ml in 10% deer meat extract, 2: 3.6 × 104 bradizoids/ml in 10% deer meat extract, 3: 3.6 × 103 bradizoids/ml in 10% deer meat extract, 4: 3.6 × 102 bradizoids/ml in 10% deer meat extract, 5: 3.6 × 101 bradizoids/ml in 10% deer meat extract, 6: negative sample (10% deer meat extract only), 7: positive sample (Sarcocyst) in PBS. M: molecular marker, SarcoR: Sarcocystis spp.18S rRNA gene. The LODs of the stx1 and stx2 genes with the DNA strip were 3.4 × 104 and 3.4 × 103 cfu/ml of STEC, respectively (Fig. 3A). In contrast, the LODs of these genes with conventional PCR were 3.4 × 106 cfu/ml of STEC for both targets (Fig. 3B). The results revealed that the DNA strip showed 100- and 1000-fold greater sensitivity for the stx1 and stx2 genes, respectively, than conventional PCR. Our previous study revealed that the LAMP assay showed increased sensitivity for the detection of the stx1 and stx2 genes from STEC O157 compared with real-time PCR [26]. The difference in sensitivity is likely related to the high performance of the LAMP procedure in the DNA strip.
Fig. 3.

Sensitivity of (A) the DNA strip and (B) conventional PCR for the detection of stx1 and stx2 genes. 1: 3.4 × 108 CFU/ml in 10% deer meat extract, 2: 3.4 × 107 CFU/ml in 10% deer meat extract, 3: 3.4 × 106 CFU/ml in 10% deer meat extract, 4: 3.4 × 105 CFU/ml in 10% deer meat extract, 5: 3.4 × 104 CFU/ml in 10% deer meat extract, 6: 3.4 × 103 CFU/ml in 10% deer meat extract, 7: 3.4 × 102 CFU/ml in 10% deer meat extract, 8: negative sample (10% deer meat extract only), 9: positive sample (3.4 × 108/ml in PBS), M: molecular marker.

Sensitivity of (A) the DNA strip and (B) conventional PCR for the detection of stx1 and stx2 genes. 1: 3.4 × 108 CFU/ml in 10% deer meat extract, 2: 3.4 × 107 CFU/ml in 10% deer meat extract, 3: 3.4 × 106 CFU/ml in 10% deer meat extract, 4: 3.4 × 105 CFU/ml in 10% deer meat extract, 5: 3.4 × 104 CFU/ml in 10% deer meat extract, 6: 3.4 × 103 CFU/ml in 10% deer meat extract, 7: 3.4 × 102 CFU/ml in 10% deer meat extract, 8: negative sample (10% deer meat extract only), 9: positive sample (3.4 × 108/ml in PBS), M: molecular marker. The specificity of the DNA strip for each hazard was examined. To validate the specificity for stx1 and stx2 genes in STEC, DNA extracts obtained from genera non-Shiga toxin-producing E. coli and other pathogenic bacteria were used. To investigate the specificity of Sarcocystis spp. in Japanese sika deer, DNA extracts obtained from the closely related genera (Toxoplasma gondii, Theileria parva) and Sarcocystis fayeri were used. As shown in Table 2, none of the bacterial DNA extracts used in this experiment showed cross reactions, suggesting that the DNA strip had high sensitivity for the stx1 and stx2 genes in STEC. However, the DNA strip showed cross-reactions for T. gondii and S. fayeri, but not T. parva, demonstrating that our primer reacted with the 18S rRNA of T. gondii and S. fayeri because the 18S rRNA of these parasites were similar. And T. gondii has been reported to infect in Japanese sika deer [4] and cause food poisoning [16]. The results also suggested that this DNA strip might be applicable to the detection of Sarcocystis spp. in other animals, including wild deer and T. gondii.
Table 2.

The specificity of DNA strip for detection of Sarcocystis spp. and STEC in Japanese sika deer

Subject of DNA stripStrainSpeciesCross reaction
STECPE7EAECa)Negative
HP1001EPECb)Negative
WHO1ETECc)Negative
NIHS_00214STEC O157: H7 stx (−)Negative
NIHS_00069Salmonella EnteritidisNegative
ATCC8739Commensal E. coliNegative
ATCC43864Citrobacter freundiiNegative
ATCC10145Pseudomonas aeruginosaNegative
Lm0132Listeria monocytogenesNegative

Sarcocystis spp.AFSS-0002Sarcocystis fayeriPositive
RH strain (NIHS)Toxoplasma gondiiPositive
AV-Tp001Theileria parvaNegative

a) EAEC: enteroaggregative Escherichia coli, b) EPEC: enteropathogenic Escherichia coli, c) ETEC: enterotoxigenic Escherichia coli.

a) EAEC: enteroaggregative Escherichia coli, b) EPEC: enteropathogenic Escherichia coli, c) ETEC: enterotoxigenic Escherichia coli. Finally, we assessed the prevalence of Sarcocystis spp. and STEC in a total of 47 samples of meat from deer that had been slaughtered and processed in Yamanashi Prefecture, Japan using the DNA strip in combination with the conventional PCR approach. Toxoplasma gondii in serum was examined for 36 samples out of 47 samples using commercial ELISA kit (ID Screen® Toxoplasmosis Indirect Multi-species, ID.Vet, Grabels, France). As shown in Table 3, 32 samples were positive for conventional PCR while 37 samples were positive for the DNA strip, and T. gondii was negative in all samples assayed. Therefore it is considered that the positive samples in this study were contaminated with Sarcocystis spp. predominantly. Since the negative samples detected by the DNA strip were also negative on conventional PCR, we concluded that the DNA strip was able to detect Sarcocystis spp. from deer meat more efficiently than conventional PCR. Parallel experiments revealed that no STEC were detected in either assay. We previously reported that STEC OUT:H25 was isolated from only 1 out of 120 venison samples [2]. This suggests that the prevalence rates of STEC in deer meat might be less than roughly 1–2%.
Table 3.

Comparison of conventional PCR and DNA strip for detection of Sarcocyctis spp., Toxoplasma gondii and STEC in Japanese sika deer

SampleNo.SexSarcocystis spp.Toxoplasma gondiiSTEC



Conventional PCRDNA stripELISAConventional PCRDNA strip
1M--NT--
2F--NT--
3M--NT--
4M--NT--
5F--NT--
6M-+NT--
7M--NT--
8F++NT--
9F++---
10F++---
11F-----
12M-----
13F++---
14F++NT--
15F++---
16M++---
17F++---
18F++---
19M++---
20F++---
21M++---
22M++---
23M++---
24M-+---
25M-+---
26F++---
27F++---
28F++---
29F++---
30F++---
31F-+---
32F++---
33F-----
34F++---
35F++---
36M++---
37F++---
38F++---
39M++---
40F-+---
41unknown++---
42M++---
43F-----
44M++---
45unknown++---
46unknown++NT--
47unknown++NT--
Total number of positive sample3237000

NT, not tested; +, positive; -, negative.

NT, not tested; +, positive; -, negative. In slaughterhouses for game meat in Japan, self-sanitation systems are needed to ensure excellent food hygiene, as laws concerning slaughter are not applied to these meats. Therefore on-site sanitary check systems should be required. Since the DNA strip method is rapid (within 60 min after DNA extraction), simple, and requires no special equipment, it will prove a promising method for on-site investigations in slaughterhouses. Game meat, including deer meat, carries many different risk factors for food poisoning. Sarcocystis spp. is one such novel intrinsic risk factor for food poisoning [10]. We previously reported the presence of at least four species of Sarcocystis spp. in Japanese sika deer meat samples obtained from Yamanashi Prefecture, Japan [9], and designed our primers based on information in the 18S rRNA region of the predominant Sarcocystis spp., among the 21 reported species. The results of cross-reaction experiment suggested that DNA strip for Sarcocystis spp. could be applied to other species of deer [8, 22] and T. gondii. However, whether or not the stx1 and stx2 gene primers used in this study collectively detect a series of stx variants is unclear. As deer-originating STEC can show variations in their stx genotypes [3, 5, 7, 11, 13], further studies will be required to clarify the above issues and expand the application of this detection method. Despite these issues, the DNA strip approach developed in this study has several advantages, including its rapidity, multiplicity, and no need for special equipment, over other detection methods, such as conventional PCR, immunochromatography, and real-time PCR. Of further note, LAMP-lateral flow combined assays have also been recently developed for the detection of several other pathogenic microbes, such as Toxoplasma [17] and Staphylococcus aureus [25, 27]. In conclusion, our study showed that the “DNA strip” was able to detect Sarcocystis spp. and STEC in deer meat with high sensitivity. However, the improvement for the specificity of DNA strips is required to achieve specific reaction of the pathogens. Nevertheless, the application of this system will enable the quick and simple on-site inspection of food poisoning factors in deer meat.
  2 in total

1.  Rapid detection of Clostridium perfringens in food by loop-mediated isothermal amplification combined with a lateral flow biosensor.

Authors:  Thanawat Sridapan; Wanida Tangkawsakul; Tavan Janvilisri; Wansika Kiatpathomchai; Sirintip Dangtip; Natharin Ngamwongsatit; Duangjai Nacapricha; Puey Ounjai; Surang Chankhamhaengdecha
Journal:  PLoS One       Date:  2021-01-07       Impact factor: 3.240

2.  Morphological and molecular characteristics of seven Sarcocystis species from sika deer (Cervus nippon centralis) in Japan, including three new species.

Authors:  Niichiro Abe; Kayoko Matsuo; Junji Moribe; Yasuhiro Takashima; Takao Irie; Takashi Baba; Bjørn Gjerde
Journal:  Int J Parasitol Parasites Wildl       Date:  2019-10-09       Impact factor: 2.674

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.