Literature DB >> 30807577

Impact of miR-223-3p and miR-2909 on inflammatory factors IL-6, IL-1ß, and TNF-α, and the TLR4/TLR2/NF-κB/STAT3 signaling pathway induced by lipopolysaccharide in human adipose stem cells.

Juan Wu1, Ping Niu1, Yueqiang Zhao1, Yanyang Cheng1, Weiping Chen1, Lan Lin1, Jingmei Lu1, Xue Cheng1, Zhiliang Xu1.   

Abstract

MicroRNAs (miRNAs) are small non-coding RNA molecules that play an important role in the regulation of gene expression related to inflammatory responses. Human adipose stem cells are characterized by pluripotent differentiation potential and isolated from adipose tissues. These cells regulate inflammation mainly by interacting with immune cells and affecting the secretion of immune factors; details of this interaction are currently unknown. In the current study, we successfully established an acute inflammation model and a chronic inflammation model involving adipose stem cells. We used high-throughput miRNA microarray analysis to identify miRNAs that were significantly (p < 0.05) differentially expressed during both acute and chronic inflammation. Lipopolysaccharide (LPS) significantly (p < 0.05) reduced the expression of miR-223-3P and miR-2909, while promoting the production of pro-inflammatory cytokines, interleukin (IL) 6, IL-1β, and tumor necrosis factor (TNF)-α via the Toll-like receptor (TLR) 4/TLR2/nuclear factor (NF)-κB/signal transducer and activator of transcription (STAT) 3 signaling pathway in human adipose stem cells. Further, miR-223-3P expression was significantly (p < 0.05) reduced in human adipose stem cells during activation by IL-6 stimulation. The inducible down-regulation of miR-223-3P resulted in the activation of STAT3, which was directly targeted by miR-223-3P. STAT3 directly targeted TLR4 and TLR2, promoting the production of the pro-inflammatory cytokine, IL-6, and formed a positive feedback loop to regulate IL-6 levels. Similarly, TNF-α significantly (p < 0.05) increased the expression of miR-223-3p, with LPS and TLR4/TLR2/NF-κB/STAT3 forming a negative feedback loop to regulate TNF-α levels. In addition, miR-2909, which depends on NF-κB, targeted Krueppel-like factor (KLF) 4 to regulate the levels of pro-inflammatory cytokines, IL-6, IL-1β, and TNF-α. We conclude that miR-223-3p and miR-2909 form a complex regulatory network with pro-inflammatory factors and signaling pathways in adipose stem cells stimulated by LPS. These findings will inform the development of therapies against autoimmune and inflammatory diseases.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 30807577      PMCID: PMC6391004          DOI: 10.1371/journal.pone.0212063

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Human mesenchymal stem cells (hMSCs) repair tissues and modulate the immune system. Adipose stem cells are a type of MSCs. It has been demonstrated that hMSCs down-regulate the activity of the nuclear factor (NF) κB signaling pathway by up-regulating the expression of phagocytosis-related molecules in macrophages and down-regulating tumor necrosis factor (TNF)-α to reduce inflammation [1]. Macrophages co-cultured with MSCs produce a large amount of the anti-inflammatory cytokine, interleukin (IL) 10, and produce more IL-6 and less TNF-α than macrophages alone [2]. MSCs also interact with other cells [3]. Although a large number of studies have confirmed that MSCs can regulate the proliferation, functional status, and phenotype transformation of various immune cells in vitro and in vivo, the potential immunosuppressive mechanism of MSCs is not fully understood. Toll-like receptor(TLR)4 recognizes and binds lipopolysaccharide (LPS) to trigger a signaling cascade via MyD88-dependent and/or MyD88-independent pathways, resulting in the activation of mitogen-activated protein kinase (MAPK) and NF-κB, and ultimately leading to the production of pro-inflammatory cytokines. NF-κB is a ubiquitous inducible transcription factor, which stimulates the expression of genes, particularly those that promote immune and inflammatory responses. TLR-mediated signaling is dependent on the activation of NF-κB to activate the expression of IL-6 and TNF-α [4]. NF-κB likely controls the expression of inflammation-related genes, IL6 and TNFA [5]. TLR4 itself can also stimulate the production of cytokines. Inhibition of TLR4 signaling or interference with TLR4 via TLR4-neutralizing antibodies can lead to a reduction of cellular inflammatory factor production [6]. Similarly, upon TLR4 activation by its natural ligand (such as LPS), MSCs undergo a pro-inflammatory transition, with a reduced ability to suppress the immune response [7]. In addition to the effects in MSCs, the effects of TLR4 signaling in other cells have been described [8-11]. In addition to studying LPS, TLR4, TLR2, and their relationship with inflammatory factors, the relationship between TLR4/TLR2 signaling pathways and inflammatory factors is of interest. For example, it has been reported that resveratrol may exert neuroprotective effects via the TLR4/NF-κB/signal transducer and activator of transcription (STAT) signaling cascade. [12]. Further, argon protects against IL-8 inhibition effect by the TLR2/TLR4/STAT3/NF-κB pathway in a neuroblastoma cell apoptosis model [13]. Furthermore, it has been shown that TLR2-dependent NF-κB signaling induces the secretion of pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 by monocytes-macrophages [14]. In the LPS-induced acute lung injury model, the activation of TLR2/NF-κB (phosphorylation of the NF-κB subunit p65) promotes the secretion of TNF-α, IL-6, and IL-1β [15,16]. LPS stimulates TLR2 expression and protein kinase B (AKT) phosphorylation in ARPE cells to further activate the NF-κB signaling pathway, thereby increasing IL-6 expression [17]. Increased expression of TLR2 and NF-κB genes, and secretion of TNF-α, IL-1β, and IL-6 by human PBMCs stimulated by LPS has been reported [18]. The relationship between signaling cascades and inflammatory factors has indeed been investigated. Exploring the relationship between miRNAs and signal transduction factors in signaling cascades and downstream inflammatory factors is a natural next stage of enquiry. miRNAs are non-coding RNA molecules (18–25-nt long) that regulate gene expression at post-transcriptional level. An miRNA molecule recognizes the target mRNA by interacting with a 5′-seed sequence of an miRNA regulatory element in the 3′ untranslated region (UTR) of the target mRNA. It has been suggested that miRNAs regulate TLR signaling primarily through three different mechanisms: (1) by directly targeting components of the TLR signaling system; (2) by being directly regulated by TLR signaling; and (3) by directly activating RNA-sensing TLRs. It has been shown that miR-223 negatively regulates the expression of STAT3 in the mouse heart, and that miR-223 directly regulates the expression of IL-6 [19]. According to other studies, miR-223 regulates IL-6 signaling by directly targeting STAT3 to enhance TLR-driven inflammatory responses. It was also found that IL-6 induces down-regulation of miR-223 levels and promotes the enhancement and activation of STAT3, which in turn, promotes the production of IL-6 and IL-1β, but not that of TNF-α [20]. Further, plasma exosome miR-223 also down-regulates IL-6 levels in monocytes [21]. In Helicobacter pylori-infected macrophages, miR-223 can inhibit the expression of inflammatory cytokines, such as IL-6 and TNF-α [22]. Further, transient decrease in miR-223 levels leads to an increase in IL-6 expression and secretion in bone marrow mesenchymal stem cells [23]. In addition to affecting inflammatory factors of signaling pathways or affecting a target gene that then affects the expression of inflammatory factors, miRNA may directly affect the activation of signaling pathways. TLR4 plays a role not only in the TLR4/MAPK/NF-κB signaling pathway, but also in the phospholipase C/polo-like kinase/phosphoinositide 3-kinase (PI3K)/AKT signaling pathway [24]. It has been shown that miR-223 negatively regulates the activation of the TLR4/NF-κB pathway and that the PI3K/AKT pathway can also be up-regulated by miR-223. This may proceed by up-regulation of miR-223 to activate the PI3K/AKT pathway to block the TLR4/MAPK/NF-κB signaling pathway [25]. Previous studies have demonstrated that NF-κB activation can induce the expression of another miRNA, miR-2909, in PBMCs [26]. In addition, miR-2909 targets Krueppel-like factor (KLF) 4 and impacts the production of inflammatory cytokines (IL-6 and TNF-α) by regulating KLF4. Finally, increased expression of miR-2909 is always accompanied by increased expression of genes encoding the pro-inflammatory cytokines IL-6 and TNF-α [27]. It remains to be determined whether the above mechanisms are operational in human adipose stem cells. Consequently, the aim of the current study was to determine the role of miRNA signaling in human adipose stem cells. We show that miR-223 and miR-2909 play important roles in the immune-regulatory activity of these cells.

Materials and methods

Cells and reagents

The cells were purchased from Wuhan Hamilton Biotechnology Co., Ltd. (Wuhan, China); they are third-generation frozen human adipose stem cells. All the chemicals and reagents with their catalog numbers and companies used in the experiment study are in Table 1.
Table 1

Chemicals and reagents with their catalog numbers and companies.

chemicals/reagentscatalog numberscompany
LPSL-2880Sigma
Standard fetal bovine serumSH30088.03GIBCO
Dulbecco’s modified Eagle’s medium F12SH30023.01GIBCO
CCK8 kitPH0534China Biyuntian Biotechnology Co., Ltd
BCA protein concentration assay kitNCI-3225China Biyuntian Biotechnology Co., Ltd
site-directed mutagenesis kitKM101China Biyuntian Biotechnology Co., Ltd
SDS-PAGE Sample Loading BufferP0015China Biyuntian Biotechnology Co., Ltd
horseradish peroxidase-labeled goat anti-rabbit antibodyORB175845,China Biyuntian Biotechnology Co., Ltd
Rabbit polyclonal anti-TLR2 antibodyab191458Abcam
rabbit polyclonal anti-TLR4 antibodyab13556Abcam
rabbit monoclonal anti-STAT3 antibodyab32500Abcam
rabbit antibody anti-p-STAT3Tyr-705Abcam
rabbit monoclonal anti-NF-kB antibodyab59238Abcam
rabbit monoclonal anti- p-NF-kB antibodyab16502Abcam
rabbit monoclonal anti-KLF4 antibodyab80230Abcam
mouse monoclonal anti-b-actin antibodyHC201-01Abcam
IL-6 Enzyme-linked immunosorbent assay (ELISA) kitsE-EL-H0102Wuhan Elitet Biotechnology Co., Ltd
IL-1β Enzyme-linked immunosorbent assay (ELISA) kitsE-EL-H0149Wuhan Elitet Biotechnology Co., Ltd
TNF-α Enzyme-linked immunosorbent assay (ELISA) kitsE-EL-H0109Wuhan Elitet Biotechnology Co., Ltd
human IL-6–stimulating factorPeproTech 96-200-06-5Wuhan Elitet Biotechnology Co., Ltd
human TNF-a–stimulating factorPeproTech 96-300-01A-10Wuhan Elitet Biotechnology Co., Ltd
p-STAT3 inhibitorS1155 S3I-201Wuhan Elitet Biotechnology Co., Ltd
NF-kB inhibitorBAY 11–7082Wuhan Elitet Biotechnology Co., Ltd
Real-time polymerase chain reaction (PCR) special reagentDRR802ATAKARA
SYBR Premix Ex TaqTM II (Perfect Real-Time)DRR081ATAKARA
Trizol10296010Invitrogen
P004ECL luminescence detection kitW028-1Vigorous
miR-223-3p mimicsRuiboBio (Guangzhou, China)
miR-223-3p mimics controlsRuibo Bio (Guangzhou, China)
miR-2909 mimicsRuibo Bio (Guangzhou, China)
miR-2909 mimics controlsRuibo Bio (Guangzhou, China)
miR-223-3p inhibitorRuibo Bio (Guangzhou, China)
miR-223-3p inhibitor controlsRuibo Bio (Guangzhou, China)
miR-2909 inhibitorRuibo Bio (Guangzhou, China)
miR-2909 inhibitor controlsRuibo Bio (Guangzhou, China)
STAT3 siRNARuibo Bio (Guangzhou, China)
si-IL-6Ruibo Bio (Guangzhou, China)
si-TNF-αRuibo Bio (Guangzhou, China)
control siRNARuibo Bio (Guangzhou, China)
Lipofectamine 200011668019Thermo Fisher

Sample processing and testing

Cells were routinely grown in medium under 5% CO2 incubator at 37 °C. For the experiments, cell suspension with a density of approximately 1 × 105 /mL was uniformly seeded in a 96-well plate (100 μL per well). The cells were incubated in a 5% CO2 incubator at 37 °C. The experiments were started once the cell fusion rate exceeded 80%. 0.0102 g LPS was added to 10 mL PBS to make 1 g/L LPS mother liquor, and then diluted to the corresponding concentration (1 μg/mL, 10 μg/mL, and 100 μg/mL) with complete medium. The acute inflammation model was established as follows. After removing the spent culture medium with a sample gun, three different concentrations of LPS (1 μg/mL, 10 μg/mL, and 100 μg/mL; 100 μL/well) were added to stimulate adipose stem cells at three stimulation time-points 2, 6, and 12 h. The control cells were incubated with 100 μL/well of the complete medium(without LPS)at three stimulation time-points 2, 6, and 12 h. All treatments were conducted in three replicate wells. The control group was counted together, a total of four concentrations of LPS-stimulated adipose stem cells at three-time stimulation points, and 12 groups were collected for cell supernatant and pellet. For the chronic inflammation model, 1000 adipose stem cells were transferred to 6-well plates and divided into eight groups (four experimental groups + four control groups). After 24 h of culturing, the four experimental groups cells were stimulated with LPS (1 μg/mL and 100 μL/well),the four control groups were incubated with 100 μL/well of the complete medium(without LPS). After 5-d stimulation, one of the four experimental groups was selected as the first experimental group, and the supernatant was collected for the first experimental group ELISA analysis. In addition, the pellet was collected for qPCR analysis and protein determination for the first experimental group, one of the four control groups was selected as the first control group, and the supernatant was collected for the first control group ELISA analysis. In addition, the pellet was collected for qPCR analysis and protein determination for the first control group. The medium was discarded, and 10 μL of CCK8 reagent and 100 μL of medium were added to each well for cell proliferation activity of the first experimental group and the first control group; at this point, the samples for the first experimental group and the first control group had been used up. For the other three experimental groups and three control groups, half of the supernatant was collected, centrifuged, and the cells processed further, and the withdrawn volume was replaced with fresh medium. After 1-d culture, second LPS-stimulation was performed [the medium was aspirated, half of LPS (1 μg/mL, 100 μL/well) was added to the fresh medium, and then half of the previously collected medium was added]to the rest of three experimental groups. The rest of three control groups were incubated with 100 μL/well of the complete medium(without LPS). After additional 5 d, one of the three experimental groups was selected as the second experimental group, one of the three control groups was selected as the second control group and then half of the supernatant was collected for ELISA analysis for the second experimental group and control group; the pellet was collected for the second experimental group and control group qPCR analysis and protein determination. Next, 10 μL of CCK8 reagent and 100 μL of medium were added to each well for cell proliferation activity of the second experimental group and control group; at this point, the samples for the second experimental group and control group had been used up. Treat the remaining two experimental groups and two control groups in this manner, the adipose stem cells were subjected to LPS treatment four times. There was no difference in the processing of the four experimental groups, mainly except the accumulation of inflammatory factors over time, as the supernatant (half) collected during each operation was replaced during the last operation. One set of the collected cell pellets was treated every week; eight supernatant samples and eight cell pellets were collected in the course of the experiment. The medium volume at any given time was 100 μL/well. The model was established in three replicate wells. The culture supernatant from the treatment and control wells was transferred to a 1.5-mL centrifuge tube and centrifuged at 4 °C for 10 min (3000 rpm). The supernatant was collected and stored at –20 °C for ELISA analysis. A portion of the cell pellet was immediately used for RNA extraction, reverse-transcribed into cDNA, and stored at –20 °C for real-time quantitative PCR (qPCR). Another portion of the pellet was used for protein determination. The sample was denatured at 100 °C for 10 min and stored at –20 °C before western blotting. dx.doi.org/10.17504/protocols.io.vzhe736.Detailed experimental protocols are provided in the supporting information.

Cell transfection

A 0.5-mL cell suspension containing 2 × 105 cells was inoculated into each well of a 24-well plate and incubated overnight under 5% CO2 incubator at 37 °C. The following were used to transfect human adipose stem cells using Lipofectamine 2000 reagent, according to the manufacturer’s instructions: h-miR-223-3p mimic (5′-UGUCAGUUUGUCAAAUACCCCA-3′), h-miR-223-3p inhibitor (5′-UGGGGUAUUUGACAAACUGACA-3′), h-miR-223-3p mimic normal control (NC) and h-miR-223-3p inhibitor NC, h-miR-2909 mimic (5′-GUUAGGGCCAACAUCUCUUGG-3′), h-miR-2909 inhibitor (5′-CCAAGAGAUGUUGGCCCUAAC-3′), h-miR-2909 mimic NC and h-miR-2909 inhibitor NC, si-h-IL-6 (5′-GCCACTCACCTCTTCAGAA-3′), si-h-STAT3 (5′-GGGUCUGGCUAGACAAUAUTT-3′), si-h-TNF-α (5′-GGCGTGGAGCTGAGAGATA-3′), si-h-STAT3NC, si-h-IL-6NC, si-h-TNF-αNC, and virus-infected STAT3 overexpression plasmids.

Detection of cell proliferation activity

The cell concentration was adjusted to 1 × 10 5/mL. The cell suspension used to inoculate 96-well plates at 100 μL/well per well, with three replicate wells per treatment. After cell attachment, the medium was discarded, and the effect of CCK8 reagent on the proliferation of adipose stem cells was measured using the CCK8 kit. For the acute inflammation model, the adipose stem cells were incubated with three concentrations of LPS (1 μg/mL, 10 μg/mL, and 100 μg/mL). After 2, 6, and 12 h of treatment, the medium was discarded, and 10 μL of CCK8 reagent and 100 μL of medium were added to each well. After 2 h, sample absorbance was measured at 450 nm using a microplate reader. The cell growth curve was plotted with time as the x-coordinate and cell growth as the y-coordinate. For the chronic inflammation model, four groups of adipose stem cells were treated with 1 μg/mL LPS, intermittently over the course of 4 weeks. After each week, the medium in one cell group was discarded, and CCK8 assay was performed as above. The effect of LPS on cell viability (%) was calculated as follows: (experimental well OD value—blank well OD value)/(control well OD value—blank well OD value). The blank wells contained the medium and CCK8 reagent; the control wells contained the cells, medium, and CCK8 reagent; the experimental wells contained the LPS, cells, medium, and CCK8 reagent.

Detection of cytokine production

The frozen culture supernatants and ELISA kits (for the detection of IL-6, IL-1β, TNF-α, reactivity: human; detection range: 7.81–500 pg/mL; sensitivity: 4.69 pg/mL) were equilibrated to ambient temperature for approximately 30 min. Next, the blank (without adding anything) and standard wells were set. The standard solutions (IL-6, TNF-α, and IL-1β diluted to concentrations of 400, 200, 100, 50, 25, 12.504, 6.248, and 0 pg/mL) were added into the standard wells at 50 μL/well. For the sample wells, concentrations of IL-6 and TNF-α diluted 10 times were added; that is, 10 μL supernatant + 40 μL diluted sample. Next, 50 μL of HRP-labeled anti-human IL-6 (or TNF-α or IL-1β) antibody was added into each well, except the blank well. Thereafter, the plate was covered and incubated for 60 min in a 37°C water bath. Next, the reaction plate was removed from the water bath, the solutions were removed from each well, and then the plate was gently stricken against an absorbent paper until it was dry. Thereafter, the washing solution was added into each well, and the wells were allowed to stand for 1 min at room temperature, after which the plate was gently stricken against an absorbent paper until it was dry; the washing step was repeated 5 times. Next, 50 μL each of substrates A and B was added into all wells, and then the wells were incubated in the dark for 15 min at 37 °C. Thereafter, 50 μL of the stop solution was added into the wells to terminate the reaction, and the OD value at 450 nm was measured by a multi-function microplate reader within 10 min. The experiment was performed in triplicate.TNF-α, IL-1β, and IL-6 levels were calculated using a standard curve, as per the manufacturer’s instructions.

RNA isolation and qPCR

Primers were synthesized by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd., and primer sequences are shown in Table 2. Total RNA was extracted from the inflammatory model cells (treatment group) and untreated cells (control group) according to the manufacturer’s instructions using a Trizol kit, and reverse-transcribed into cDNA. The reverse-transcription reaction using a HiScript Reverse Transcriptase (RNase H) kit proceeded by incubating the samples at 25 °C for 5 min, 50 °C for 15 min, 85 °C for 5 min, and finally at 4 °C for 10 min. The cDNA was diluted 1-fold for real-time PCR (QuantStudio 6). The qPCR conditions were as follows: 50 °C for 2 min, 95 °C for 10 min; and 40 cycles of 95 °C for 30 s, and 60 °C for 30 s. The dissolution curve was plotted and the relative expression of IL-6, TNF-α, IL-1β, TLR2, TLR4, STAT3, NF-κB, and KLF4 was normalized to β-actin gene expression using the 2-ΔΔCt method. The relative levels of miR-223-3P, miR-2909, miR-126-3p, miR-126-5p, miR-96-5p, miR-141-3p, miR-133a-3p, and miR-150-3p were normalized to the level of U6. The data were analyzed using the 2-ΔΔCt method.
Table 2

Sequences of the primers for qPCR.

NamePrimer sequence (5’-3’)
h-miR-223-3p F5‘-ACACTCCAGCTGGGTGTCAGTTTGTCAAAT-3’
h-miR-223-3p R5‘-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGGGTAT-3’
h-miR-2909 F5‘-ACACTCCAGCTGGGGTTAGGGCCAACATC-3’
h-miR-2909 R5‘-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCAAGAGA-3’
h-IL-6 F5‘-AGGGCTCTTCGGGAAATGT-3’
h-IL-6 R5‘-GAAGAAGGAATGCCCATTAACAAC-3’
h-TNF-a F5‘-CTCATCTACTCCCAGGTCCTCTTC-3’
h-TNF-a R5‘-CGATGCGGCTGATGGTGTG-3’
h-IL-1β F5‘-CGAATCTCCGACCACCACTA-3’
h-IL-1β R5‘-AAGCCTCGTTATCCCATGTGT -3’
h-NF-κB F5‘-AATCATCCACCTTCATTCTCAACTTG-3’
h-NF-κB R5‘-CTCCACCACATCTTCCTGCTTAG-3’
h-KLF4 F5‘-TTCAACCTGGCGGACATCAAC-3’
h-KLF4 R5‘-GCTGCTGCGGCGGAATG-3’
h-TLR4 F5‘-CACAGACTTGCGGGTTCTACATC-3’
h-TLR4 R5‘-AGTTCATAGGGTTCAGGGACAGG-3’
h-TLR2 F5‘-CTACCAGATGCCTCCCTCTTACC-3’
h-TLR2 R5‘-GTGCTTGCTGCTCCTGAGTG-3’
h-STAT3 F5‘-ACCACCAAGCGAGGACTGAG-3’
h-STAT3 R5‘-CCAGCCAGACCCAGAAGGAG-3’
h-miR-126-3p F5‘TGCGCTCGTACCGTGAGTAATA—3’
h-miR-126-3p L5‘-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATTAT -3’
h-miR-126-5p F5‘-TGCGCCATTATTACTTTTGGT-3’
h-miR-126-5p L5‘-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCGTACC -3’
h-miR-141-3p F5‘-TGCGCTAACACTGTCTGGTAAA-3’
h-miR-141-3p L5‘-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCATCTTT -3’
h-miR-133a-3p F5‘-TGCGCTTTGGTCCCCTTCAACC-3’
h-miR-133a-3p L5‘-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGCTGGT-3’
h-miR-96-5p F5‘-TGCGCTTTGGCACTAGCACATTT-3’
h-miR-96-5p L5‘-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCAAAAA -3’
h-miR-150-3p F5‘-TGCGCCTGGTACAGGCCTGGGG-3’
h-miR-150-3p L5‘-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGTCCCC -3’
h-β-actin F5’- AGCGAGCATCCCCCAAAGTT -3’
h-β-actin R5’- GGGCACGAAGGCTCATCATT -3’
U6 F5‘- CGCTTCGGCAGCACATATAC -3’
U6 R5‘- AAATATGGAACGCTTCACGA -3’

F: forward; R: reverse;L: loop

F: forward; R: reverse;L: loop

Immunoblotting

Total protein was extracted from cell pellets using RIPA total protein lysate buffer, and protein concentration was determined using the BCA protein concentration assay kit. The amount of sample analyzed was adjusted based on protein concentration to ensure that 40 μg total protein was loaded per well of a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. An appropriate amount of 5× protein loading buffer was added to the samples, and the samples were boiled at 100 °C for 5 min. The samples were resolved by SDS-PAGE and the proteins were then transferred to a polyvinylidene fluoride membrane. After blocking in TBST buffer containing 5% skim milk, the membrane was incubated with anti-TLR2, anti-TLR4, anti-STAT3, anti-pSTAT3, anti-NF-κB, anti-pNF-κB, anti-KLF4, and anti–β-actin antibodies, overnight at 4 °C. The membrane was washed with TBST three times (5 min each) and subsequently incubated with horseradish peroxidase-labeled secondary antibody for 30 min at 37 °C. The signal was developed in the darkroom in the presence of the ECL reagent. Protein band intensity analysis was performed using β-actin as an internal reference.

miRNA microarray and data analysis

High-throughput miRNA sequencing was performed by Shanghai Lie Bing Information Technology Co., Ltd. as follows; first, the purified total RNA was ligated with the 5′ base group and the 3′ base group of the two libraries by RNA ligase, reverse-transcribed into cDNA, and then amplified by PCR. The cDNA sequence was constructed, and the miRNA library was constructed. The quality of the constructed library was checked. The 140–160-bp PCR products were recovered by PAGE to purify the enriched library. The purified miRNA library was amplified and enriched again, and single-ended sequencing was performed using Ion Proton. The sequencing data were processed. Sequence data were discarded if: (1) a sequence with the base information ratio >10% could not be determined; (2) the sequencing quality was low; 3) the sequence lacked the insert; 4) none sequence of 5′-linker or 3′-linker sequence; (5) the sequence contained polyA stretch; or (6) the sequence was smaller than 18 nt. The selected sequences were compared with the miRBase database(http://www.mirbase.org/) and the Rfam database (http://rfam.xfam.org/) to remove tRNA, snRNA, snoRNA, rRNA, and piRNA; the degraded exon or intron fragments were filtered out; and the miRNA sequences were screened and classified. Significantly different miRNA sequences were screened using the EBSeq algorithm. The screening conditions were: log2FC > 1 or <-1, FDR < 0.05. FC, mean (model group/control group), FDR, false discovery rate; FDR < 0.05 means that the difference was statistically significant.

Target gene prediction, gene ontology (GO) enrichment, and pathway analysis

Target mRNAs of differentially expressed miRNAs were predicted using 12 predictive databases (miRWalk, Microt4, miRanda, mirbridge, miRDB, miRMap, miRNAMap, Pictar2, PITA, RNA22, RNAhybrid, and Targetscan). To predict the function, target mRNAs whose prediction was supported by nine databases were used for gene annotation (GO analysis) and information enrichment. GO analysis was performed using the Integration Discovery (DAVID) software, version 6.7 (http://david.abcC.ncifcrf.gov) to identify biological processes, cellular components, and molecular functions. Simultaneously, pathway analysis was performed on the basis of pathways generated by the Kyoto Encyclopedia of Genes and Genomes (http://www.genome.jp/kegg/) to predict the possible signaling pathways of the selected miRNA targeted genes.

Prediction of target gene binding sites

After overlapping with TargetScan, CLIP-Seq, miRDB, and miRanda, miR-223-3p was found to bind to the 3′ UTR of STAT3 mRNA and IL6 mRNA [19-20,28], and miR-2909 was found to bind to the 3′ UTR of KLF4 mRNA [27]. Analysis using the bioinformatics database JASPAR (default threshold score of 85.0), revealed seven potential TLR4 gene promoter binding sites in the coding region of the STAT3 gene and four potential TLR2 gene promoter binding sites. It is highly probable that STAT3 regulates the expression of TLR4 and TLR2 genes. In other tissues, it has been documented that miR-223-3p targets STAT3 [20,28-] and IL6 [19] and that miR-2909 targets KLF4 [27]. The available data indicate that miRNA function is highly tissue-dependent and that defined biological target genes or functions of an miRNA in a particular tissue cannot serve as a universal target/function prediction for the miRNAs in all types of cells and tissues [29]. According to the miRNA target gene database (TarBasev. 5c), screening, and related literature search, the relationship between STAT3, IL6, and miR-223-3p, and miR-2909 and KLF4, STAT3, TLR4, and TLR2 in adipose stem cells has not been determined.

Dual luciferase assay

The wild-type human STAT3 3′ UTR was constructed by amplifying the 3′ UTR of human STAT3 gene, and cloning it into the pMIR-TM reporter luciferase vector [20,28]. The wild-type human IL6 3′ UTR was constructed by amplifying the 3′ UTR of human IL6 and cloning it into a dual luciferase vector (psi-CHECK2) downstream of the Renilla luciferase open reading frame [19]. The wild-type human KLF4 3′ UTR was constructed by amplifying the KLF4 3′ UTR and cloning it into the pMIR green fluorescent protein reporter vector [27]. All 3′ UTR-binding sites were mutated using a site-directed mutagenesis kit and sequenced. The coding sequence of the STAT3 gene was inserted into the pLVX-IRES-Puro vector; the TLR4 gene promoter sequence and TLR2 gene promoter sequence were inserted into PGL3 vectors. A construct harboring a mutation in the binding site was also generated, and used as a control. The designed miRNA mimic, control, or promoter sequence was then used to co-transfect human adipose stem cells together with the corresponding plasmid. After 24 h, the luciferase activity was determined using a dual luciferase reporter assay system (Promega) according to the manufacturer’s instructions. The transfection combinations of the plasmids are shown in Table 3 below.
Table 3

Transfection plasmid combinations of dual luciferase.

NumberTransfection plasmid combinations of dual luciferase
1NC+IL-6-wt
2NC+IL-6-mut
3miR-223-3Pmimic+IL-6-mut
4miR-223-3Pmimic+IL-6-wt
1NC+STAT3-wt
2NC+STAT3-mut
3miR-223-3Pmimic+STAT3-mut
4miR-223-3Pmimic+STAT3-wt
1NC+KLF4-wt
2NC+KLF4-mut
3miR-2909mimic+KLF4-mut
4miR-2909mimic+KLF4-wt
1pLVX-IRES-Puro+PGL3-Basic+Ptk-RL
2pLVX-STAT3-IRES-Puro+PGL3-Basic+Ptk-RL
3pLVX- IRES-Puro+PGL3-TLR4-P +Ptk-RL
4pLVX- STAT3-IRES-Puro+PGL3-TLR4-P +Ptk-RL
1pLVX-IRES-Puro+pGL3-Basic+Ptk-RL
2pLVX-STAT3-IRES-Puro+PGL3-Basic+Ptk-RL
3pLVX- IRES-Puro+PGL3-TLR2-P +Ptk-RL
4pLVX- STAT3-IRES-Puro+PGL3-TLR2-P +Ptk-RL

Statistical analysis

Each experiment was repeated three times. The data were analyzed using Graph-Pad Prism version 7 (Graph-Pad Prism, Software, CA, USA). The data are expressed as the mean ± standard deviation (SD). The data from multiple groups were analyzed by one-way ANOVA. The t-test was used to compare the data between two groups. The value of p < 0.05 was considered to indicate statistical significance.

Results

Adipose stem cells stimulated with 1 μg/mL LPS for 6 h are the optimal acute inflammation model

For this model, human adipose stem cells were incubated with different concentration of LPS for different periods of time. At the same LPS concentration, cell viability decreased with prolonged stimulation time. For 2–6-h incubation, cell viability declined in the order of 1 μg/mL > 10 μg/mL > 100 μg/mL; for 6–12-h incubation, cell viability declined in the order of 1 μg/mL > 100 μg/mL > 10 μg/mL (Fig 1A). Upon stimulation by 1 μg/mL LPS for 6 h, the IL-6 and TNF-α levels in the model group were the highest and statistically significantly different from those in the untreated control group (Fig 1B and 1C). However, the IL-1β levels were the highest upon stimulation by 100 μg/mL LPS for 6 h (Fig 1D). The TNF-α levels were slightly lower than IL-6 levels. On the other hand, the IL-1β levels were significantly lower than IL-6 and TNF-α levels
Fig 1

CCK8, QPCR, ELISA, and western blot detection in an acute inflammatory model of adipose stem cells.

(A) Results of CCK8 detection of cellular activity in an acute adipose stem cell inflammation model. (B-D) ELISA results of IL-6, IL-1β, TNF-α. (E-G) QPCR results of IL-6, IL-1β, and TNF-α. (H-I) QPCR results of TLR4 and TLR2. (J) Western blotting results of TLR4 and TLR2. Data are mean ± SD of three independent experiments (n = 3). *** p <0.001; ** p <0.01; * p <0.05.

CCK8, QPCR, ELISA, and western blot detection in an acute inflammatory model of adipose stem cells.

(A) Results of CCK8 detection of cellular activity in an acute adipose stem cell inflammation model. (B-D) ELISA results of IL-6, IL-1β, TNF-α. (E-G) QPCR results of IL-6, IL-1β, and TNF-α. (H-I) QPCR results of TLR4 and TLR2. (J) Western blotting results of TLR4 and TLR2. Data are mean ± SD of three independent experiments (n = 3). *** p <0.001; ** p <0.01; * p <0.05. IL-6 expression (mRNA levels or protein levels) at any LPS stimulation time-point increased with the increasing LPS concentration. The expression increased with the stimulation time but reached a maximum at 6 h (Fig 1E). In the case of TNF-α, for the same LPS stimulation time, the expression did not differ for each LPS concentration used after 2 h; it was highest after 6 h, and then decreased. The highest expression of TNF-α was induced by stimulation with 1 μg/mL LPS, and decreased with increasing LPS concentration (Fig 1F). For IL-1β, for the same LPS stimulation time, the expression increased with an increasing LPS concentration after 2 h; it was highest after 6 h, and then decreased. IL-β1 expression was highest after induction with 1 μg/mL LPS, and decreased with increasing LPS concentration (Fig 1G). For IL-1β, the time at which the highest mRNA levels were observed was different from the time at which the highest protein levels were observed, which may be associated with transcriptional delay. The change in IL-1β expression was smaller than that of IL-6 and TNF-α. For TLR2 and TLR4, the overall trend of expression change was consistent. After the same LPS stimulation time, the expression level correlated with different LPS concentrations did not change much after 2 h, was highest after 6 h, and remained constant or decreased. The expression was highest after stimulation with 1 μg/mL LPS, and as the concentration increased, the expression decreased overall (Fig 1H and 1I). However, the overall change in TLR2 expression was lower than that of TLR4 expression. Western blotting and qPCR data for TLR4 were consistent (Fig 1J). Therefore, 6-h stimulation of adipose stem cells with 1 μg/mL LPS was considered to be the optimal acute inflammation model.

Establishment of a chronic inflammation model by intermittent stimulation of adipose stem cells with 1 μg/mL LPS for 4 weeks

In the chronic inflammation model, four groups of cells were treated intermittently with 1 μg/mL LPS, and every week, one of the four groups was selected, the supernatant was collected for ELISA analysis, and the pellet was collected for qPCR analysis and protein determination. This approach revealed that the growth in the model groups was lower than that in the control group (Fig 2A). The activity gap was the smallest in the fourth week of intermittent stimulation. The levels of IL-6, TNF-α, and IL-1β in LPS-treated cells were higher than those in untreated cells. With increasing time, the IL-6, TNF-α, and IL-1β levels in culture supernatant gradually increased (Fig 2B–2D). The difference with the untreated control group was statistically significant for all cytokines and all times. Four control groups were compared with each other. The levels of inflammatory factors produced by the four control groups continued to rise, but the rise was relatively flat. The cumulative inflammatory factors were not significantly different. Again, four treatment groups were compared with each other. The levels of inflammatory factors produced by the four LPS-stimulated groups increased significantly in the first week; then, the rise was flat, and the gap between the third group and fourth groups began to shrink in the fourth week. The TNF-α levels were slightly lower than IL-6 levels. The IL-1β levels were significantly lower overall than IL-6 and TNF-α levels, which may be related to the lower overall concentration and IL-1β factor itself.
Fig 2

CCK8, QPCR, ELISA and Western-Blot detection in a chronic inflammatory model of adipose stem cells.

(A) Results of CCK8 detection of cellular activity in a model of chronic adipose stem cell inflammation. (B-D) ELISA results of IL-6, IL-1β, TNF-α. (E-G) QPCR results of IL-6, IL-1β, and TNF-α. (H-I) QPCR results of TLR4 and TLR2. (J) Western blotting results of TLR4 and TLR2. Data are mean ± SD of three independent experiments (n = 3). *** p <0.001; ** p <0.01; * p <0.05.

CCK8, QPCR, ELISA and Western-Blot detection in a chronic inflammatory model of adipose stem cells.

(A) Results of CCK8 detection of cellular activity in a model of chronic adipose stem cell inflammation. (B-D) ELISA results of IL-6, IL-1β, TNF-α. (E-G) QPCR results of IL-6, IL-1β, and TNF-α. (H-I) QPCR results of TLR4 and TLR2. (J) Western blotting results of TLR4 and TLR2. Data are mean ± SD of three independent experiments (n = 3). *** p <0.001; ** p <0.01; * p <0.05. The levels of inflammatory factors in the chronic inflammation model were slightly higher than those in the acute inflammation model. Gene expression of IL6, TNFA, and IL1B was consistent with the ELISA results (Fig 2E–2G). The mRNA and protein levels of TLR2 and TLR4, LPS receptors (Fig 2H and 2I), were consistent (Fig 2J). They were significantly different from those in the control group, although the difference was less pronounced in the fourth week. Therefore, 4-week stimulation of adipose stem cells with 1 μg/mL LPS was considered to be the optimal chronic inflammation model.

A set of the same miRNAs are differentially expressed in the acute and chronic inflammation models

Total RNA was extracted from cells of the treatment and control groups in both models, and miRNA microarray analysis was performed. Consequently, we identified 676 differentially expressed miRNAs in the acute inflammation model and 678 differentially expressed miRNAs in the chronic inflammation model, compared with the untreated control groups. When the screening parameters were set as at least 2 FC and p ≤ 0.05, 36 miRNAs were differentially expressed in the acute inflammation model, including 26 up-regulated miRNAs and 10 down-regulated miRNAs (Table 4). For these same parameters, 26 miRNAs were differentially expressed in the chronic inflammation model, including 24 up-regulated miRNAs and two down-regulated miRNAs(Table 5). We selected 11 overlapping differentially expressed miRNAs from among the 36 differentially expressed miRNAs in the acute inflammation model and 26 differentially expressed miRNAs in the chronic inflammation model for further analysis. These were miR-223-3P, miR-2909, miRNA-126-3P, miRNA-126-5P, miR-96-5p, miR-133a-3p, miR-141-3p, miR-150-3p, miR-200c-3p, miR-3591-3p, and miR-4483.
Table 4

Significantly differentially expressed miRNAs in the acute model group and the normal control group.

miRNAAcuteNormalFCFDRStyle
hsa-miR-96-5p67.517826.9072169.7749680up
hsa-miR-2909287.83911099.7820.2617240down
hsa-miR-2277-3p62.779730.266366235.68940up
hsa-miR-141-3p62.779731.86456533.669910up
hsa-miR-205-5p45.011882.13093121.123110up
hsa-miR-133a-3p16.583324.400753.7682950up
hsa-miR-124-3p28.428561.59819817.787880up
hsa-miR-200c-3p18.952370.53273335.575760up
hsa-miR-200a-3p52.119025.860068.8939390up
hsa-miR-27a-5p131.482119.711116.6704550.000126up
hsa-miR-4781-3p16.583320.53273331.128790.000127up
hsa-miR-135b-5p11.8452331.128790.3805230.000136up
hsa-miR-1306-5p17.767850.79909922.234850.000209up
hsa-miR-126-5p49.749976.9255267.1835660.000626up
hsa-miR-150-3p11.845230.26636644.46970.000928up
hsa-miR-448315.39880.79909919.27020.000951up
hsa-miR-411-5p030.3657700.001288down
hsa-miR-32-3p11.845230.53273322.234850.003605up
hsa-miR-30e-3p117.267823.972974.8916670.005298up
hsa-miR-615-5p1.18452332.230330.0367520.005775down
hsa-miR-129-2-3p26.059513.7291296.9880950.007259up
hsa-miR-532-3p48.565459.3228235.2093070.010476up
hsa-miR-491-5p4.73809351.941440.091220.011193down
hsa-miR-769-3p24.87499183.52640.1355390.01352down
hsa-miR-223-3p46.1964285.2460.1619530.013673down
hsa-miR-7-1-3p28.428564.7945955.9292930.015268up
hsa-miR-60892.36904631.431230.0753720.023288down
hsa-miR-222-5p30.79765.860065.255510.026635up
hsa-miR-671-5p914.45196998.510.1306640.031566down
hsa-miR-99b-5p427.6129106.54654.013390.034319up
hsa-miR-210-3p210.845153.539643.9381120.038731up
hsa-miR-124827.244035.3273275.1140150.041693up
hsa-miR-30c-1-3p014.9165200.041783down
hsa-miR-1185-1-3p1.18452321.309310.0555870.043775down
hsa-miR-3591-3p18.952373.1963965.9292930.048514up
hsa-miR-126-3p133.851134.627633.8654430.049675up

FC = mean (acute model group / normal control group)

FDR (false discovery rate),FDR<0.05 means that the difference variable makes sense

Table 5

Significantly differentially expressed miRNAs in the chronic model group and the normal control group.

miRNAChronicNormalFCFDRStyle
hsa-miR-451a881.09325.593694157.51540up
hsa-miR-29098.2573581099.7820.0075080down
hsa-miR-146a-5p12227.54111.8739109.29760up
hsa-miR-483-3p237.7052.130931111.54980up
hsa-miR-483-5p361.31164.52822879.790940up
hsa-miR-146a-3p79.23579.790940.9930330up
hsa-miR-192-3p69.72686.80154510.251610up
hsa-miR-223-3p9.056457285.2460.031750down
hsa-miR-3591-3p136.28423.19639642.636820up
hsa-miR-126-3p868.415634.6276325.078690up
hsa-miR-126-5p215.51926.92552631.119540up
hsa-miR-133a-3p38.03284.400758.6423450up
hsa-miR-96-5p38.03286.9072165.5062410up
hsa-miR-448357.04920.79909971.391890up
hsa-miR-150-3p44.37160.266366166.58110up
hsa-miR-141-3p72.89621.86456539.095560up
hsa-miR-122-5p117.26784.79459524.458330up
hsa-miR-144-3p31.69424.458331.2958360up
hsa-miR-653-5p47.5411.06546544.619930.000172up
hsa-miR-200c-3p34.86340.53273365.442570.000434up
hsa-miR-319831.6940.79909939.662160.002797up
hsa-miR-653-3p34.86341.06546532.721280.002969up
hsa-miR-146950.71042.66366419.037840.005057up
hsa-miR-7108-3p34.86341.59819821.814190.011708up
hsa-miR-1-3p117.267810.6546511.006250.018626up
hsa-miR-135a-5p47.5413.46276313.729210.028326up

FC = mean (chronic model group / normal control group)

FDR (false discovery rate),FDR<0.05 means that the difference variable makes sense

FC = mean (acute model group / normal control group) FDR (false discovery rate),FDR<0.05 means that the difference variable makes sense FC = mean (chronic model group / normal control group) FDR (false discovery rate),FDR<0.05 means that the difference variable makes sense

RNA sequencing revealed unique signaling pathways in the acute and chronic inflammation models

Among the 11 selected miRNAs, eight miRNAs with statistically significant differences in expression levels compared with the control group were selected for verification by qPCR. As shown, miR-126-3p, miR-126-5p, miR-96-5p, miR-141-3p, miR-133a-3p, and miR-150-3p were significantly up-regulated in the acute and chronic inflammatory models, whereas miR-223-3p and miR-2909 were mainly down-regulated in the two models. The qPCR data essentially confirmed the reliability of the microarray data (Fig 3).
Fig 3

qPCR verification of miRNA microarray analysis results.

The relative expression of miR-96-5p (A), miR-126-3p (B), miR-126-5p (C), miR-133a-3p (D), miR-141-3p (E), miR-150-3p (F), miR-223-3p (G) and miR-2909 (H) in the acute inflammation model and the slow inflammation model group. All experiments were repeated in triplicate and analyzed by the 2-ΔΔCt method. *** p < 0.001; ** p < 0.01; * p < 0.05.

qPCR verification of miRNA microarray analysis results.

The relative expression of miR-96-5p (A), miR-126-3p (B), miR-126-5p (C), miR-133a-3p (D), miR-141-3p (E), miR-150-3p (F), miR-223-3p (G) and miR-2909 (H) in the acute inflammation model and the slow inflammation model group. All experiments were repeated in triplicate and analyzed by the 2-ΔΔCt method. *** p < 0.001; ** p < 0.01; * p < 0.05. Each miRNA could target thousands of genes. Hence, we used the four most commonly used target gene prediction programs (Target Scan, CLIP-Seq, miRDB, and miRanda) for Venn diagram aggregation analysis. As an example, all four programs predicted the same target genes (two target genes) for miR-126-3p, which indicated that miR-126-3p most probably bound these two target genes. Similarly, the four programs predicted 62 common target genes for miR-223-3p; Other as shown in (Fig 4).
Fig 4

The 11 miRNAs that were significantly differentially expressed in both acute and chronic inflammatory models were analyzed using four target gene prediction softwares for Venn diagram aggregation analysis.

miR-96-5p (A), miRNA-126-3P (B), miRNA-126-5P (C), miR-141-3p (D), miR-133a-3p (E), miR-150-3p (F), miR-223-3P (G), miR-2909 (H), miR-200c-3p (I), miR-3591-3p (J), miR-4483 (K).

The 11 miRNAs that were significantly differentially expressed in both acute and chronic inflammatory models were analyzed using four target gene prediction softwares for Venn diagram aggregation analysis.

miR-96-5p (A), miRNA-126-3P (B), miRNA-126-5P (C), miR-141-3p (D), miR-133a-3p (E), miR-150-3p (F), miR-223-3P (G), miR-2909 (H), miR-200c-3p (I), miR-3591-3p (J), miR-4483 (K). Further, the total RNA from the acute inflammation model cells and the chronic inflammation model cells, and untreated controls was analyzed by microarray analysis. Hierarchical clustering analysis revealed that the microarray data for the treatment and untreated groups were uniform and reliable (Fig 5A).
Fig 5

Heat map of differentially expressed miRNAs, and analysis of functions and pathways corresponding to possible target genes.

(A) Heat map analysis of differentially expressed miRNAs in three groups (normal group N: Normal, acute inflammation model group A: Acute, chronic inflammation model group C: Chronic). Columns and rows represent samples and specific miRNAs. The miRNA cluster tree is shown on the left. The code on the legend is the value after log2 conversion. The color scale indicates the relative expression level of the miRNA. Red indicates that the expression of miRNA in the treated group is higher than that in the control group, while green indicates that the expression of the miRNA in the treated group is lower than that in the control group. Black indicates that there is no difference in miRNA between the two groups. (B) GO analysis of target genes predicted by differentially expressed miRNAs in the normal group and the acute inflammation model group. (C) GO analysis of target genes predicted by differentially expressed miRNAs in the normal group and the chronic inflammation model group. The GO category is shown on the x-axis and the number of genes is shown on the y-axis. Biological processes (BP) are a major class of GO analysis, including various processes associated with inflammation. Molecular function (MF) is rich in protein binding, zinc ion binding, transcription factor activity, and so on. The cellular component (CC) is enriched in the nucleus and is indispensable for membrane, cytoplasm and so on. (D) Analysis of target gene pathways predicted by differentially expressed miRNAs in the normal group and the acute inflammation model group. (E) Analysis of target gene pathways predicted by differentially expressed miRNAs in the normal group and the acute inflammation model group. The 15 most abundant signal transduction pathways were selected based on the P value (P < 0.01). The x-axis shows the signal path term and the y-axis shows the degree of enrichment.

Heat map of differentially expressed miRNAs, and analysis of functions and pathways corresponding to possible target genes.

(A) Heat map analysis of differentially expressed miRNAs in three groups (normal group N: Normal, acute inflammation model group A: Acute, chronic inflammation model group C: Chronic). Columns and rows represent samples and specific miRNAs. The miRNA cluster tree is shown on the left. The code on the legend is the value after log2 conversion. The color scale indicates the relative expression level of the miRNA. Red indicates that the expression of miRNA in the treated group is higher than that in the control group, while green indicates that the expression of the miRNA in the treated group is lower than that in the control group. Black indicates that there is no difference in miRNA between the two groups. (B) GO analysis of target genes predicted by differentially expressed miRNAs in the normal group and the acute inflammation model group. (C) GO analysis of target genes predicted by differentially expressed miRNAs in the normal group and the chronic inflammation model group. The GO category is shown on the x-axis and the number of genes is shown on the y-axis. Biological processes (BP) are a major class of GO analysis, including various processes associated with inflammation. Molecular function (MF) is rich in protein binding, zinc ion binding, transcription factor activity, and so on. The cellular component (CC) is enriched in the nucleus and is indispensable for membrane, cytoplasm and so on. (D) Analysis of target gene pathways predicted by differentially expressed miRNAs in the normal group and the acute inflammation model group. (E) Analysis of target gene pathways predicted by differentially expressed miRNAs in the normal group and the acute inflammation model group. The 15 most abundant signal transduction pathways were selected based on the P value (P < 0.01). The x-axis shows the signal path term and the y-axis shows the degree of enrichment. The biological functions and signaling pathways of the predicted target genes of differentially expressed miRNAs (676 differentially expressed miRNAs in the acute inflammation model and 678 differentially expressed miRNAs in the chronic inflammation model) were further identified by enrichment analysis. Many of the detected differentially expressed miRNAs were involved in a variety of biological processes, including cellular immunity, inflammatory responses, cytokine production, and apoptosis. GO analysis of the predicted target genes of differentially expressed miRNAs indicated that the affected biological processes in acute and chronic inflammation models were mainly involved in positive transcriptional regulation and protein binding as the main molecular function and that the target genes mainly encode cytoplasmic cellular components (Fig 5B and 5C). The top 15 distinct enrichment signaling pathways ranked by the -log10(p) value and identified by pathway analysis are shown in the two models. A large number of overlapping signaling pathways was identified in the acute and chronic model cells. They included long-term potentiation, proteoglycans in cancer, the cGMP-PKG signaling pathway, the ErbB signaling pathway, pathways in cancer, circadian entrainment, and the Hippo signaling pathway. However, the top signaling pathways in the two models were different: long-term potentiation was the top pathway in the acute inflammation model, and transcriptional misregulation was the top pathway in the chronic inflammation model. Further, PI3K/AKT was the unique and inflammatory-related signaling pathway in the acute inflammation model, while MAPK/TGF-β was the unique and inflammatory-related signaling pathway in the chronic inflammation model (Fig 5D and 5E).

Dual luciferase reporter assay

The predicted binding site of miR-223-3P to STAT3 is shown in Fig 6A. The luciferase signal with the NC mimic and the pMIR-TM luciferase vector containing STAT3 3′ UTR was compared with that of miR-223-3p mimic and pMIR-TM luciferase vector containing STAT3 3′ UTR. Changes in the luciferase activity were apparent (Fig 6B). Similarly, miR-223-3p mimic and miR-223-3p inhibitor, and the corresponding NC molecule were introduced into adipose stem cells, following which the expression of STAT3 gene was evaluated by qPCR. STAT3 protein levels were analyzed by western blotting. The differences in STAT3 mRNA and protein levels in the presence of miR-223-3p mimic and in control cells were statistically significant (Fig 6C and 6D). The same approach demonstrated that miR-223-3p targeted IL6 (Fig 6E–6H) and miR-2909 targeted KLF4 (Fig 6I–6L).
Fig 6

Dual-luciferase assay for miR-223-3P targeting STAT3 and for IL-6;miR-2909 targeting KLF4.

(A) predicted binding sites for miR-223-3P and STAT3, (B) changes in luciferase activity of added STAT3 3'-UTR pMIR-TM luciferase vector and miR-223-3p mimic, (C) STAT3 molecular level of added miR-223-3p mimic, (D) STAT3 protein level of added miR-223-3p mimic, (E) miR-223-3P and IL-6 predicted binding site, (F) changes in luciferase activity of added IL- 6 3'-UTR psi-CHECK2 luciferase vector and miR-223-3p mimic, (G) IL-6 molecular level of added miR-223-3p mimic, (H) IL-6 protein level of added miR-223 -3p mimic, (I) miR-2909 and KLF4 predicted binding sites, (J) changes in luciferase activity of added KLF4 3'-UTR pMIR GFP luciferase vector and miR-2909 mimic, (K) the molecular level of added KLF4 and miR-2909, (L) the protein level of added KLF4 and miR-2909. *** p <0.001; ** p <0.01; * p <0.05.

Dual-luciferase assay for miR-223-3P targeting STAT3 and for IL-6;miR-2909 targeting KLF4.

(A) predicted binding sites for miR-223-3P and STAT3, (B) changes in luciferase activity of added STAT3 3'-UTR pMIR-TM luciferase vector and miR-223-3p mimic, (C) STAT3 molecular level of added miR-223-3p mimic, (D) STAT3 protein level of added miR-223-3p mimic, (E) miR-223-3P and IL-6 predicted binding site, (F) changes in luciferase activity of added IL- 6 3'-UTR psi-CHECK2 luciferase vector and miR-223-3p mimic, (G) IL-6 molecular level of added miR-223-3p mimic, (H) IL-6 protein level of added miR-223 -3p mimic, (I) miR-2909 and KLF4 predicted binding sites, (J) changes in luciferase activity of added KLF4 3'-UTR pMIR GFP luciferase vector and miR-2909 mimic, (K) the molecular level of added KLF4 and miR-2909, (L) the protein level of added KLF4 and miR-2909. *** p <0.001; ** p <0.01; * p <0.05. The predicted binding site of STAT3 to TLR4 gene promoter is shown in S1A Fig Compared with the combination of pLVX-STAT3-IRES-Puro and the empty plasmid pGL3-Basic without TLR4, and the combination of PGL3-TLR4-P and the empty plasmid pLVX-IRES-Puro without STAT3, fluorescence was observed for the combination of the dual luciferase vector pLVX- STAT3-IRES-Puro with STAT3 and the dual luciferase vector PGL3-TLR4-P with TLR4 (S1B Fig). STAT3 and empty plasmids without STAT3 were also used to transfect adipose stem cells. We found that TLR4 mRNA and protein levels were elevated in cells overexpressing STAT3, and the difference in expression was statistically significant compared with the control (S1C and S1D Fig). The same method was used to validate the STAT3 targeting of the TLR2 gene promoter (S1E–S1H Fig).

LPS induces STAT3 mRNA and protein levels in adipose stem cells, and promotes STAT3 protein phosphorylation, while miR-223-3p regulates STAT3 mRNA

Transfecting adipose stem cells with miR-223-3p mimics and controls, and miR-223-3p inhibitors and inhibitor controls revealed that LPS significantly enhanced the protein levels of IL-6, TNF-α, and IL-1β in culture supernatants of the acute inflammation model (Fig 7A–7C). LPS also significantly up-regulated IL6, TNFA, IL1B, TLR4, TLR2, and STAT3 mRNA levels (Fig 7D–7F and 7H–7J), while significantly down-regulating miR-223-3p levels (Fig 7G). Further, LPS significantly up-regulated TLR4 and TLR2 protein levels (Fig 7K). On the other hand, miR-223-3p mimics significantly up-regulated the miR-223-3p levels, and significantly down-regulated IL6, TNFA, IL1B, TLR4, and TLR2 mRNA levels (Fig 7D–7F, 7I and 7J). The levels of IL-6, TNF-α, and IL-1β in the culture supernatant were significantly reduced (Fig 7A–7C). The reduction of IL-1β levels was not as pronounced as that of IL-6 and TNF-α, indicating that miR-223-3p mimics inhibited the secretion of IL-6, TNF-α, and IL-1β. However, the miR-223-3p inhibitor did not significantly affect the mRNA levels of IL6, TNFA, and IL1B, and cytokine secretion (Fig 7A–7F), indicating that miR-223-3p expression was blocked at the transcriptional level. In addition, miR-223-3p mimics significantly down-regulated STAT3 mRNA and protein levels (Fig 7H and 7K), consistent with the results of the dual luciferase assay for miR-223-3p targeting the STAT3 gene. Further, miR-223-3p mimics also down-regulated the levels of phosphorylated STAT3. Of note, miR-223-3p inhibitor up-regulated the levels of phosphorylated STAT3, suggesting that miR-223-3p inhibited STAT3 phosphorylation regardless of the presence of LPS. LPS promoted phosphorylation of STAT3 (Fig 7K).
Fig 7

miR-223-3p mimic and control, miR-223-3p inhibitor and inhibitor control were transfected into adipose stem cells.

The molecular expression level and protein expression levels of IL-6, TNF-α, IL-1β, TLR4, TLR2, miR-223-3p and STAT3. (A-C) protein levels of IL-6, TNF-α, IL-1β, (D-J) molecular levels of IL-6, TNF-α, IL-1β, miR-223-3p, STAT3, TLR4, TLR2, (K) protein levels of TLR4, TLR2, STAT3, p-STAT3. *** p <0.001; ** p <0.01; * p <0.05.

miR-223-3p mimic and control, miR-223-3p inhibitor and inhibitor control were transfected into adipose stem cells.

The molecular expression level and protein expression levels of IL-6, TNF-α, IL-1β, TLR4, TLR2, miR-223-3p and STAT3. (A-C) protein levels of IL-6, TNF-α, IL-1β, (D-J) molecular levels of IL-6, TNF-α, IL-1β, miR-223-3p, STAT3, TLR4, TLR2, (K) protein levels of TLR4, TLR2, STAT3, p-STAT3. *** p <0.001; ** p <0.01; * p <0.05.

miR-223-3p directly regulates TLR2 and TLR4, and the secretion of inflammatory cytokines IL-6, TNF-α, and IL-1β

To confirm whether STAT3 directly regulated TLR2, TLR4, and the inflammatory cytokine genes IL6, TNFA, and IL1B, adipose stem cells were transfected with STAT3-specific siRNA. The experiment revealed that siRNA resulted in a significant reduction of STAT3 protein levels in the cells (Fig 8A) and inhibited mRNA and protein levels of TLR2, TLR4, IL-6, TNF-α, and IL-1β (Fig 8B–8J). The degree of inhibition was lower than that of miR-223-3p mimic, which inhibited cytokine production (Fig 8B–8J). When STAT3 siRNA and miR-223-3p were used simultaneously, they synergistically inhibited the expression of TLR2, TLR4, IL-6, TNF-α, and IL-1β at the mRNA and protein levels to a greater extent than either of the two molecules alone (Fig 8B–8J).
Fig 8

miR-223-3p directly regulates TLR2, TLR4, and secretion of inflammatory cytokines IL-6, TNF-α and IL-1β.

(A) STAT3 protein level after STAT3 siRNA transfection, (B-D) protein expression of IL-6, TNF-α, IL-1β after transfection of miR-223-3p and STAT3 siRNA, (E-I) molecular expression level of TLR2, TLR4, IL- 6. TNF-α and IL-1β, (J) protein expression of TLR2 and TLR4. *** p <0.001; ** p <0.01; * p <0.05.

miR-223-3p directly regulates TLR2, TLR4, and secretion of inflammatory cytokines IL-6, TNF-α and IL-1β.

(A) STAT3 protein level after STAT3 siRNA transfection, (B-D) protein expression of IL-6, TNF-α, IL-1β after transfection of miR-223-3p and STAT3 siRNA, (E-I) molecular expression level of TLR2, TLR4, IL- 6. TNF-α and IL-1β, (J) protein expression of TLR2 and TLR4. *** p <0.001; ** p <0.01; * p <0.05.

STAT3 promotes phosphorylation of STAT3 protein, and regulates TLR4 and TLR2 expression

STAT3 and p- STAT3 inhibitor were used to transfect adipose stem cells. The experiment revealed that LPS and STAT3 significantly up-regulated the mRNA and protein levels of STAT3, TLR4, TLR2, IL-6, TNF-α, and IL-1β (Fig 9A–9J) and that LPS and STAT3 acted synergistically. The additional presence of p- STAT3 inhibitor up-regulated STAT3 expression (Fig 9G), probably because p- STAT3 inhibitor reduced the STAT3 phosphorylation pathway. However, no significant effect on the mRNA and protein levels of TLR4, TLR2, IL-6, TNF-α, and IL-1β was apparent. Even in the presence of LPS and STAT3 overexpression, the mRNA and protein levels of IL-6, TNF-α, IL-1β, TLR4, and TLR2 were not significantly different from those of the blank control group in the presence of p-STAT3 inhibitor (Fig 9A–9F, 9H and 9J). This indicated that p-STAT3 inhibitor blocked the regulation of STAT3 via the TLR2 and TLR4 signaling pathway. Perhaps, phosphorylation of STAT3 resulted in the activation of TLR2 and TLR4 promoters, and then initiated the signaling pathways, leading to the production of inflammatory factors. Similarly, analysis of protein levels revealed that STAT3 promotes STAT3 phosphorylation (Fig 9J). Regardless of the presence or absence of LPS, STAT3 significantly up-regulated the mRNA and protein levels of TLR4 and TLR2, which was consistent with the results of the luciferase assay for STAT3 targeting the TLR4 and TLR2 promoters.
Fig 9

STAT3 and p-STAT3 inhibitor were transfected into adipose stem cells,respectively, and the molecular expression levels and protein expression levels of STAT3, TLR4, TLR2, IL-6, TNF-α, IL-1β were detected.

(A-C) IL-6, TNF-α, IL-1β protein levels, (D-I) IL-6, TNF-α, IL-1β, STAT3, TLR4, TLR2 molecular expression levels, (J) TLR4, TLR2, STAT3, p-STAT3 protein expression levels. *** p <0.001; ** p <0.01; * p <0.05.

STAT3 and p-STAT3 inhibitor were transfected into adipose stem cells,respectively, and the molecular expression levels and protein expression levels of STAT3, TLR4, TLR2, IL-6, TNF-α, IL-1β were detected.

(A-C) IL-6, TNF-α, IL-1β protein levels, (D-I) IL-6, TNF-α, IL-1β, STAT3, TLR4, TLR2 molecular expression levels, (J) TLR4, TLR2, STAT3, p-STAT3 protein expression levels. *** p <0.001; ** p <0.01; * p <0.05.

Treatment of adipose stem cells with IL-6, TNF-α, siIL-6, and siTNF-α affects the miR-223-3p, STAT3, and pSTAT3 levels

IL-6 and siIL-6 were next used to transfect adipose stem cells. IL-6 alone significantly reduced the expression of miR-223-3p (Fig 10A), compared with the decrease of miR-223-3p after cell stimulation with both LPS and IL-6. The degree of reduction was apparent: LPS-stimulated miR-223-3p reduction was observed, and IL-6 after LPS stimulation resulted in further (synergistic) reduction of miR-223-3p levels.
Fig 10

IL-6, siIL-6, TNF-α, and siTNF-α were transfected into adipose stem cells, respectively, to detect the expression of miR-223-3p, STAT3, and pSTAT3.

(A-B) mir-223-3p and STAT3 molecular expression after transfection of IL-6, siIL-6, (C) STAT3 protein expression after transfection of siIL-6, (D) STAT3 and pSTAT3 protein expression after transfection of IL-6, siIL-6, (E-F) mir-223-3p and STAT3 molecular expression after transfection of TNF-α, siTNF-α, (G) STAT3 protein expression after transfection of siTNF-α, (H) STAT3 and pSTAT3 protein expression after transfection of TNF-α and siTNF-α. *** p <0.001; ** p <0.01; * p <0.05.

IL-6, siIL-6, TNF-α, and siTNF-α were transfected into adipose stem cells, respectively, to detect the expression of miR-223-3p, STAT3, and pSTAT3.

(A-B) mir-223-3p and STAT3 molecular expression after transfection of IL-6, siIL-6, (C) STAT3 protein expression after transfection of siIL-6, (D) STAT3 and pSTAT3 protein expression after transfection of IL-6, siIL-6, (E-F) mir-223-3p and STAT3 molecular expression after transfection of TNF-α, siTNF-α, (G) STAT3 protein expression after transfection of siTNF-α, (H) STAT3 and pSTAT3 protein expression after transfection of TNF-α and siTNF-α. *** p <0.001; ** p <0.01; * p <0.05. Further, miR-223-3p levels were enhanced by siIL-6 after LPS stimulation. It is possible that siIL-6 attenuated the LPS-induced significant reduction of miR-223-3p levels. After LPS stimulation, STAT3 levels were enhanced in the presence of IL-6 and siIL-6 (Fig 10B). Some of these effects could be indirectly promoted by reducing the expression of mir-223-3p, and by TLR2 and TLR4, which targeted STAT3 after LPS stimulation. IL-6 significantly reduced the expression of miR-223-3p, which further increased the expression of STAT3. In addition, siIL-6 reduced the STAT3 levels by interfering with this process, but the interference was masked by LPS stimulation (Fig 10C). Analysis of the STAT3 protein levels suggested that IL-6 promoted STAT3 phosphorylation (Fig 10D). It has been previously shown that activated STAT3 binds directly to the IL6 promoter, and increases IL6 mRNA levels and protein secretion [30]. If that is the case, this could constitute a positive feedback loop, with IL-6 significantly reducing the expression of miR-223-3p, miR-223-3p inhibiting STAT3 inhibition, and STAT3 targeting TLR4 and TLR2 to promote IL-6 production. TNF-α and siTNF-α were also used to transfect adipose stem cells. Indeed, TNF-α alone promoted the expression of miR-223-3p (Fig 10E), and this ability counteracted the effect of LPS stimulation, leading to a reduction of miR-223-3p levels. In the case of stimulation by LPS and siTNF-α, the two molecules synergistically reduced miR-223-3p levels. In the case of LPS and TNF-α stimulation, LPS offset some of the effect of TNF-α on miR-223-3p levels. When TNF-α was added alone, the expression of STAT3 was significantly reduced (Fig 10F). The STAT3 levels were increased in the presence of TNF-α and siTNF-α (Fig 10B). Some of these effects may be indirectly promoted by the reduced expression of mir-223-3p, and some by TLR2 and TLR4, which target STAT3 upon stimulation by LPS. TNF-α significantly increased miR-223-3p levels, which further induced the expression of STAT3. Further, siTNF-α increased the STAT3 protein levels by interfering with this process, but this interference was masked by cell stimulation with LPS. This could create a negative feedback loop, with TNF-α significantly increasing the expression of miR-223-3p, miR-223-3p enhancing STAT3 inhibition, and decreasing the secretion of TNF-α via the TLR4/TLR2/NF-κB/STAT3 signaling pathway. TNF-α itself acts as a negative feedback factor. This is not the only example of TNF-α itself acting as a negative feedback factor. In the inflammatory microenvironment, TNF-α and other pro-inflammatory factors produced by macrophages can stimulate MSCs to secrete multifunctional anti-inflammatory TNF-α–induced protein gene-6 protein (TSG-6); TSG-6 down-regulates the activity of the NF-κB signaling pathway by interacting with CD44 receptor on the macrophage membrane, further down-regulating TNF-α, and forming a negative feedback loop [1].

miR-2909 depends on NF-κB to target KLF4 to regulate IL-6, IL-1β, and TNF-α levels

The miR-2909 mimic and control, miR-2909 inhibitor and inhibitor control, and NF-κB inhibitor were next used to transfect adipose stem cells. We observed that LPS up-regulated the mRNA and protein levels of IL-6, TNF-α, and IL-1β (Fig 11A–11F); down-regulated the expression of miR-2909 (Fig 11G); and up-regulated the expression of NF-κB and KLF4 (Fig 11H and 11I). Regardless of the presence of LPS, miR-2909 mimics significantly up-regulated the expression of miR-2909, and down-regulated the mRNA and protein levels of IL-6, TNF-α, and IL-1β. Further, miR-2909 inhibitor down-regulated the expression of miR-2909 and up-regulated the mRNA and protein levels of IL-6, TNF-α, and IL-1β (Fig 11A–11F). In addition, miR-2909 mimics significantly down-regulated the expression of KLF4, which was consistent with the results of the dual luciferase assays, verifying that miR-2909 mimics target KLF4. We also observed that miR-2909 mimics, miR-2909 inhibitor, and NF-κB inhibitor had little effect on the expression of NF-κB; however, in the presence of LPS, miR-2909 mimics and NF-κB inhibitors down-regulated NF-κB levels (Fig 11I). NF-κB inhibitor had little effect on the expression of miR-2909 and KLF4, but it significantly down-regulated the expression of IL-6, TNF-α, and IL-1β, indicating that a signaling pathway downstream of LPS/TLR4/NF-κB could have been blocked by the NF-κB inhibitor (Fig 11A–11H).
Fig 11

miR-2909 is dependent on NF-kB to target KLF4 to regulate IL-6, IL-1β, TNF-α.

The miR-2909 mimic and the control, miR-2909 inhibitor and inhibitor control, and NF-kB inhibitor were transfected into adipose stem cells, respectively, (A-C) protein expression levels of IL-6, IL-1β, and TNF-α, (D-I) molecular expression level of IL-6, IL-1β, TNF-α, miR-2909, KLF4, NF-kB, (J) protein expression level of KLF4, NF-kB, pNF-kB. *** p <0.001; ** p <0.01; * p <0.05.

miR-2909 is dependent on NF-kB to target KLF4 to regulate IL-6, IL-1β, TNF-α.

The miR-2909 mimic and the control, miR-2909 inhibitor and inhibitor control, and NF-kB inhibitor were transfected into adipose stem cells, respectively, (A-C) protein expression levels of IL-6, IL-1β, and TNF-α, (D-I) molecular expression level of IL-6, IL-1β, TNF-α, miR-2909, KLF4, NF-kB, (J) protein expression level of KLF4, NF-kB, pNF-kB. *** p <0.001; ** p <0.01; * p <0.05. There are many states of NF-κB activation. We hypothesized that NF-κB activation is a phosphorylation state. Based on pNF-κB protein level, LPS promoted NF-κB phosphorylation (Fig 11J). Hence, LPS significantly down-regulated the expression of miR-2909, and miR-2909 targeted KLF4, significantly up-regulating IL-6, TNF-α, and IL-1β expression, with the miR-2909 mimics and miR-2909 inhibitor having little effect on the expression of NF-κB and with LPS significantly inducing up-regulation of NF-κB, which together formed a positive feedback loop of inflammatory factor accumulation.

Discussion

In the current study, we successfully established an acute inflammation model and a chronic inflammation model of adipose stem cells. Using high-throughput miRNA microarray analysis and verifying the results by random qPCR, we identified miRNAs differentially expressed in both acute and chronic inflammation models. Of these, miR-223-3P and miR-2909 were selected for detailed analyses based on comprehensive high-throughput miRNA microarray analysis, GO enrichment analysis, pathway analysis prediction, Venn diagram analysis, and the available literature. We found that in the adipose stem cells, miR-223-3p directly affects the expression of inflammatory cytokines IL-6, IL-1β, and TNF-α by targeting STAT3 via the TLR4/TLR2/NF-κB/STAT3 signaling pathway. In particular, direct targeting of IL-6 affected the expression of IL-6, and miR-223-3p also directly down-regulated TLR2 and TLR4. The increase of STAT3 protein levels was accompanied by an increase in p-STAT3 protein levels. A comparison of the effect of p-STAT3 inhibitor and STAT3 siRNA demonstrated that STAT3 in a phosphorylated state contributes to the TLR4/TLR2/NF-κB/STAT3 signaling pathway, which induces the production of inflammatory factors. LPS and IL-6 promoted STAT3 phosphorylation, while miR-223-3p and TNF-α inhibited STAT3 phosphorylation. On the one hand, LPS promoted the TLR4/TLR2/NF-κB/STAT3 signaling to produce the inflammatory cytokines IL-6, IL-1β, and TNF-α, while the STAT3 gene targeted the TLR4 and TLR2 gene promoters, which enhanced positive feedback regulation of the signaling pathway. On the other hand, both LPS and IL-6 significantly down-regulated the expression of miR-223-3p, consequently weakening the miR-223-3p inhibition of IL6 and STAT3. Increased levels of STAT3 further promoted the production of IL-6, creating a positive feedback loop. TNF-α significantly increased the expression of miR-223-3p, thereby enhancing the inhibitory activity of miR-223-3p on STAT3, which led to a negative feedback loop regulation of TNF-α secretion via the LPS/TLR2/TLR4/STAT3 signaling pathway. If KLF4 is required for miR-2909 regulation of IL-6 and TNF-α levels [5], and increased expression of miR-2909 is always accompanied by an increased expression of IL6 and TNFA genes [27] (also in the adipose stem cells), then a balance is formed between miR-2909 targets KLF4 to reduce the expression of inflammatory factors, and miR-2909 directly targets inflammatory factor genes to increase the expression of inflammatory factors. LPS could significantly down-regulate the expression of miR-2909, and KLF4, IL-6, TNF-α, and IL-1β expression (negatively targeted by miR-2909) would be significantly up-regulated. At the same time, reduction of the expression of miR-2909 is accompanied by reduced expression of genes encoding pro-inflammatory cytokines. Hence, miR-2909 participates in two pathways leading to the expression of inflammatory factors. Some inflammatory pathways can be self-regulated via a negative feedback loop, and some sustain enhanced inflammation via a positive feedback loop. Unlike other cells, the adipose stem cells do not proliferate upon LPS stimulation. This may be associated with the specificity of adipose stem cells themselves, or the fact that the stimulatory concentration of LPS is harmful to these cells. The chronic inflammatory model involving adipose stem cells mimics the rat chronic inflammation model. The latter has been established based on the histological manifestation of chronic inflammation in rats. The adipose stem cells in the models developed in the current study were cultured in vitro; however, they would be affected by various factors within the body in vivo. Further, the lifespan of human cells is different from that of rat cells. Hence, the chronic inflammation model involving adipose stem cells (in vitro) is preliminary. In the adipose stem cell inflammation model, the TNF-α concentration was slightly lower than that of IL-6. The concentration of IL-1β was significantly lower than that of IL-6 and TNF-α, which may be related to IL-1β factor itself, which is different from the conclusions of a study of macrophages, in which down-regulation of miR-223 was shown to promote the production of IL-6 and IL-1β but not that of TNF-α [20]. This effect may be cell-specific. LPS stimulation induces TLR4/TLR2 since TLR4/TLR2 are LPS receptors. The TLR4/TLR2/NF-κB/STAT3 signaling cascade has been studied, and it has been shown that activated STAT3 binds directly to the IL6 promoter and increases IL-6 mRNA levels and protein secretion [30]. No specific mechanisms for how STAT3 enhances the production of inflammatory factors TNF-α and IL-1β have been proposed as majority of the current research focus on gene regulation at the transcriptional level. IL-6 exerts its role via the signal transducer glycoprotein 130, leading to the activation of the Janus kinase/STAT and MAPK cascades [20]. It is tempting to speculate whether another mechanism exists whereby TNF-α reduces the mRNA and protein levels of STAT3, i.e., one that does not involve miR-223-3p. No such specific mechanisms have been proposed to date. Of course, in addition to affecting the TLR4/TLR2/NF-κB/STAT3 signaling pathway and directly affecting the levels of inflammatory factors, miR-223-3p may also impact the expression of inflammatory factors via other pathways, such as miR-223, which is highly expressed in the bone marrow cells and reportedly inhibits IL-6 by targeting the inflammatory body sensor NLRP3 [31]. Further, miR-223-3p may up-regulate the expression of IL-6 in synoviocytes by down-regulating the expression of IL-17 receptor D [32]. In addition, miR-223 affects IL-6 secretion in mast cells via the insulin-like growth factor 1 receptor/PI3K signaling pathway [22]. Moreover, a crosstalk or counter-regulatory mechanism exists between the signaling pathways TLR4-MAPK/NF-κB and PI3K/AKT, probably because administration of a TLR2 ligand increases phosphorylation of TLR2 and, subsequently, recruits the p85 subunit of PI3K, which results in PI3K/AKT activation. However, the mechanism of how TLR regulates the activation of the PI3K/AKT pathway has not been elucidated [33]. Under certain conditions, autologous adipose stem cells have the potential to regenerate various tissues and organs and have changed the approach to treating human diseases. In the medical community, these cells are known as “universal cells”. MSCs represent a promising cell-based therapy in regenerative medicine, and in the treatment of inflammatory and autoimmune diseases. Compared with the control group, intravenous infusion in healthy subjects who received intravenous LPS injection with human adipose MSCs led to increased fever when the cell dose was high [34]. It was also shown that these cells exert a mixed pro-inflammatory (enhanced IL-8 and nucleosome release) and anti-inflammatory effect (increased IL-10 and TGF-β release), enhance coagulation activation, and reduce fibrinolytic response [34]. MSC transplantation has also been explored as a method for the prevention and treatment of atherosclerotic plaque rupture in animal models [35]. Autologous MSCs can be safely injected intrathecally, transiently enhancing growth factor and anti-inflammatory cytokine levels in the cerebrospinal fluid. It has also been shown that stem cell transplantation is safe and well tolerated in amyotrophic lateral sclerosis [36]. Extracellular vesicles derived from the lung MSCs reduce the inflammatory characteristics of epithelial cells in the lung during cystic fibrosis [37]. MSC-derived exosomes exert immunomodulatory effects on type 1 (autoimmune) diabetes [38]. Furthermore, TNF signaling plays a key role in the role of MSCs in the treatment of autoimmune diseases and inflammatory diseases. Of course, these effects depend, to a large extent, on the time and concentration of the administered MSCs [39]. Upon transplantation, MSCs can inhibit the intestinal endotoxemia and liver inflammation via the LPS/TLR4 pathway, and improve chronic colitis-related hepatobiliary complications [40]. Regardless of the above, successful employment of MSCs for clinical use requires greater understanding of MSC proliferation, differentiation, and migration, and the regulation of inflammatory factors in vitro and in vivo. How transplanted MSCs respond to the host, whether genetic variation between different individuals affects MSC function, and whether inflammatory factors can modify epigenetics and alter the expression of MSC signaling-related genes require further research. Continued progress in this area is likely to lead to the identification of new targets for more precise and effective treatment of autoimmune and inflammatory diseases.

Dual luciferase assay for STAT3 gene targeting TLR4 and TLR2 gene promoters.

STAT3 gene and TLR4 gene promoter binding site, (B) Changes in luciferase activity of double luciferase vector pLVX- STAT3-IRES-Puro with STAT3 and double luciferase vector PGL3-TLR4-P with TLR4, (C) TLR4 molecular level of overexpression STAT3,(D) TLR4 protein level of overexpression of STAT3, (E) STAT3 gene and TLR2 gene promoter binding site, (F) Changes in luciferase activity of double luciferase vector pLVX- STAT3-IRES-Puro with STAT3 and double luciferase vector PGL3-TLR2-P with TLR2, (G) TLR2 molecular level of overexpression STAT3,(H) TLR2 protein level of overexpression of STAT3. *** p <0.001; ** p <0.01; * p <0.05. (ZIP) Click here for additional data file.

Data analysis process record.

This contains all the data of the experiment and the data analysis process. (ZIP) Click here for additional data file.
  38 in total

1.  Argon mediates protection by interleukin-8 suppression via a TLR2/TLR4/STAT3/NF-κB pathway in a model of apoptosis in neuroblastoma cells in vitro and following ischemia-reperfusion injury in rat retina in vivo.

Authors:  Felix Ulbrich; Teresa Lerach; Julia Biermann; Kai B Kaufmann; Wolf A Lagreze; Hartmut Buerkle; Torsten Loop; Ulrich Goebel
Journal:  J Neurochem       Date:  2016-05-30       Impact factor: 5.372

2.  TLR2 ligands induce cardioprotection against ischaemia/reperfusion injury through a PI3K/Akt-dependent mechanism.

Authors:  Tuanzhu Ha; Yulong Hu; Li Liu; Chen Lu; Julie R McMullen; Jim Kelley; Race L Kao; David L Williams; Xiang Gao; Chuanfu Li
Journal:  Cardiovasc Res       Date:  2010-04-26       Impact factor: 10.787

3.  TLR2 activation induced by H. pylori LPS promotes the differential expression of claudin-4, -6, -7 and -9 via either STAT3 and ERK1/2 in AGS cells.

Authors:  Christian O Chavarría-Velázquez; Ana C Torres-Martínez; Luis F Montaño; Erika P Rendón-Huerta
Journal:  Immunobiology       Date:  2017-10-06       Impact factor: 3.144

4.  Computational modeling with forward and reverse engineering links signaling network and genomic regulatory responses: NF-kappaB signaling-induced gene expression responses in inflammation.

Authors:  Shih Chi Peng; David Shan Hill Wong; Kai Che Tung; Yan Yu Chen; Chun Cheih Chao; Chien Hua Peng; Yung Jen Chuang; Chuan Yi Tang
Journal:  BMC Bioinformatics       Date:  2010-06-08       Impact factor: 3.169

5.  Multipotent stromal cells induce human regulatory T cells through a novel pathway involving skewing of monocytes toward anti-inflammatory macrophages.

Authors:  Sara M Melief; Ellen Schrama; Martijn H Brugman; Machteld M Tiemessen; Martin J Hoogduijn; Willem E Fibbe; Helene Roelofs
Journal:  Stem Cells       Date:  2013-09       Impact factor: 6.277

6.  Quercetin ameliorates LPS-induced inflammation in human peripheral blood mononuclear cells by inhibition of the TLR2-NF-κB pathway.

Authors:  M Zhang; J M Lin; X S Li; J Li
Journal:  Genet Mol Res       Date:  2016-07-14

7.  Regulation of cellular Cyclin D1 gene by arsenic is mediated through miR-2909.

Authors:  M Sharma; S Sharma; M Arora; Deepak Kaul
Journal:  Gene       Date:  2013-04-04       Impact factor: 3.688

8.  MicroRNA-223 controls susceptibility to tuberculosis by regulating lung neutrophil recruitment.

Authors:  Anca Dorhoi; Marco Iannaccone; Maura Farinacci; Kellen C Faé; Jörg Schreiber; Pedro Moura-Alves; Geraldine Nouailles; Hans-Joachim Mollenkopf; Dagmar Oberbeck-Müller; Sabine Jörg; Ellen Heinemann; Karin Hahnke; Delia Löwe; Franca Del Nonno; Delia Goletti; Rosanna Capparelli; Stefan H E Kaufmann
Journal:  J Clin Invest       Date:  2013-11       Impact factor: 14.808

9.  Inflammation modifies the pattern and the function of Toll-like receptors expressed by human mesenchymal stromal cells.

Authors:  Gordana Raicevic; Redouane Rouas; Mehdi Najar; Patrick Stordeur; Hicham Id Boufker; Dominique Bron; Philippe Martiat; Michel Goldman; Michel T Nevessignsky; Laurence Lagneaux
Journal:  Hum Immunol       Date:  2010-01-06       Impact factor: 2.850

10.  Inducible microRNA-223 down-regulation promotes TLR-triggered IL-6 and IL-1β production in macrophages by targeting STAT3.

Authors:  Qingyun Chen; Hui Wang; Yang Liu; Yinjing Song; Lihua Lai; Quan Han; Xuetao Cao; Qingqing Wang
Journal:  PLoS One       Date:  2012-08-24       Impact factor: 3.240

View more
  26 in total

Review 1.  Mechanism and therapeutic strategies of depression after myocardial infarction.

Authors:  Ying Yang; Xuping Li; Sixuan Chen; Mingzhu Xiao; Zhongqiu Liu; Jingyan Li; Yuanyuan Cheng
Journal:  Psychopharmacology (Berl)       Date:  2021-02-16       Impact factor: 4.530

Review 2.  Transplantation of Exercise-Induced Extracellular Vesicles as a Promising Therapeutic Approach in Ischemic Stroke.

Authors:  Parsa Alehossein; Maryam Taheri; Pargol Tayefeh Ghahremani; Duaa Dakhlallah; Candice M Brown; Tauheed Ishrat; Sanaz Nasoohi
Journal:  Transl Stroke Res       Date:  2022-05-21       Impact factor: 6.829

Review 3.  Can food matrices be considered as a potential carrier for COVID-19?

Authors:  Amin Abbasi; Hossein Samadi Kafil; Mahdi Asghari Ozma; Narges Sangtarash; Sahar Sabahi
Journal:  Infez Med       Date:  2022-03-01

4.  Dual roles of ANGPTL4 in multiple inflammatory responses in stomatitis mice.

Authors:  Miao-Miao Tian; Yi-Shan Wang; Hong-Bo Xiao
Journal:  Mol Biol Rep       Date:  2022-07-11       Impact factor: 2.742

5.  MiR-223-3p-loaded exosomes from bronchoalveolar lavage fluid promote alveolar macrophage autophagy and reduce acute lung injury by inhibiting the expression of STK39.

Authors:  Nan He; Haoyu Tan; Xueyu Deng; Lu Shu; Bei Qing; Hengxing Liang
Journal:  Hum Cell       Date:  2022-08-06       Impact factor: 4.374

6.  Transcription Profiling of a Revealed the Potential Molecular Mechanism of Governor Vessel Electroacupuncture for Spinal Cord Injury in Rats.

Authors:  Xingru Xiao; Qingwen Deng; Xiang Zeng; Bi-Qin Lai; Yuan-Huan Ma; Ge Li; Yuan-Shan Zeng; Ying Ding
Journal:  Neurospine       Date:  2022-09-30

7.  Ginsenoside Rb1 Reduces D-GalN/LPS-induced Acute Liver Injury by Regulating TLR4/NF-κB Signaling and NLRP3 Inflammasome.

Authors:  Yimei Liu; Ninghua Liu; Yujing Liu; Hongyu He; Zhe Luo; Wenjun Liu; Nan Song; Minjie Ju
Journal:  J Clin Transl Hepatol       Date:  2021-08-19

8.  Endothelial cells response to neutrophil-derived extracellular vesicles miRNAs in anti-PR3 positive vasculitis.

Authors:  M Surmiak; J Kosałka-Węgiel; S Polański; M Sanak
Journal:  Clin Exp Immunol       Date:  2021-02-28       Impact factor: 4.330

9.  Emerging roles of microRNAs in the regulation of Toll-like receptor (TLR)-signaling.

Authors:  Saswati Banerjee; Winston E Thompson; Indrajit Chowdhury
Journal:  Front Biosci (Landmark Ed)       Date:  2021-01-01

Review 10.  Circular RNAs in Sepsis: Biogenesis, Function, and Clinical Significance.

Authors:  Jesús Beltrán-García; Rebeca Osca-Verdegal; Elena Nacher-Sendra; Federico V Pallardó; José Luis García-Giménez
Journal:  Cells       Date:  2020-06-25       Impact factor: 6.600

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.