Literature DB >> 30791958

Long non-coding RNA LINC00968 attenuates drug resistance of breast cancer cells through inhibiting the Wnt2/β-catenin signaling pathway by regulating WNT2.

Dian-Hui Xiu1, Gui-Feng Liu1, Shao-Nan Yu1, Long-Yun Li2, Guo-Qing Zhao2, Lin Liu1, Xue-Feng Li3.   

Abstract

BACKGROUND: Breast cancer is one the most common cancers, making it the second leading cause of cancer-related death among women. Long non-coding RNAs (lncRNAs), with tightly regulated expression patterns, also serve as tumor suppressor during tumorigenesis. The present study aimed to elucidate the role of LINC00968 in breast cancer via WNT2-mediated Wnt2/β-catenin signaling pathway.
METHODS: Breast cancer chip GSE26910 was utilized to identify differential expression in LINC00968 and WNT2. The possible relationship among LINC00968, transcriptional repressor HEY and WNT2 was analyzed and then verified. Effects of LINC00968 on activation of the Wnt2/β-catenin signaling pathway was also tested. Drug resistance, colony formation, cell migration, invasion ability and cell apoptosis after transfection were also determined. Furthermore, tumor xenograft in nude mice was performed to test tumor growth and weight in vivo.
RESULTS: WNT2 expression exhibited at a high level, whereas LINC00968 at a low expression in breast cancer which was also associated with poor prognosis in patients. LINC00968 targeted and negatively regulated WNT2 potentially via HEY1. Either overexpressed LINC00968 or silenced inhibited activation of the Wnt2/β-catenin signaling pathway, thereby reducing drug resistance, decreasing colony formation ability, as well as suppressing migration and invasion abilities of breast cancer cells in addition to inducing apoptosis. Lastly, in vivo experiment suggested that LINC00968 overexpression also suppressed transplanted tumor growth in nude mice.
CONCLUSION: Collectively, overexpressed LINC00968 contributes to reduced drug resistance in breast cancer cells by inhibiting the activation of the Wnt2/β-catenin signaling pathway through silencing WNT2. This study offers a new target for the development of breast cancer treatment.

Entities:  

Keywords:  Breast cancer; Drug resistance; HEY1; LINC00968; WNT2; Wnt2/β-catenin signaling pathway

Mesh:

Substances:

Year:  2019        PMID: 30791958      PMCID: PMC6385430          DOI: 10.1186/s13046-019-1100-8

Source DB:  PubMed          Journal:  J Exp Clin Cancer Res        ISSN: 0392-9078


Background

Breast cancer was regarded as the second leading cause of death caused by cancer among women after lung cancer [1]. Every year, breast cancer deprived over 400,000 patients of their lives, with about one million annually diagnosed new cases worldwide [2]. Currently, chemotherapy is the treatment of choice for breast cancer which initiates tumor cell apoptosis while other therapeutic modalities highlights works on hormone receptor resistance and targeted therapy [3]. After receiving treatment, patients with breast cancer may have long-term survival with almost 90% of them showing a 5-year survival rate [4]. However, despite improvement on early detection and better treatment options in the past few years, disease recurrence and distant metastasis can still happen leading to poor prognosis [5]. Apart from metastasis, drug resistance also brought great difficulties to the advancement of breast cancer clinical outcomes [6]. Therefore, it is necessary to explore the molecular mechanisms that mediate breast cancer formation and progression that is useful in treating the disease. Long noncoding RNAs (lncRNAs) are always expressed in a developmental stage-, tissue-, or disease-specific manner and also serve as tumor inhibitors during tumorigenesis [7]. LncRNAs have important regulatory functions on cell apoptosis, DNA methylation, and cell cycle regulation [8, 9]. Recently, a series of lncRNAs have been demonstrated to be considered as tumor markers in breast cancer [10, 11]. Highly expressed lncRNA p10247 was reported to be closely correlated with reinforced growth and metastatic potential of breast cancer cells [12]. Triple-negative breast cancer cells in which the expression of mitotically-associated lncRNA was depleted showed suppressed proliferation and viability [13]. A recent study has found that LINC00968, a lncRNA, has a potential in the treatment of non-small cell lung cancer [14]. In line with this, our work using microarray also demonstrated that low levels of LINC00968 was found in breast cancer. The wingless-type MMTV integration site family (Wnt) proteins, about 40 kDa in size, activates a variety of signaling pathways inside their target cells via paracrine manner [15]. WNT2, a main Wnt ligand, has been demonstrated to participate in placental development [16]. It facilitates vascularization and has a positive impact on differentiation between vascular endothelial cells and stem cells [17]. The level of WNT2 is particularly elevated in vascular smooth muscle cells (VSMCs) and recombinant WNT2 plays a role to promote VSMC migration in vitro [18]. Furthermore, Wnt/β-catenin signaling pathway contributes to activation of self-renewal of embryonic stem cells and acts as inhibitor of differentiation [19]. Lastly, a recent study revealed that cancerous stromal cells-induced cell invasion and growth is associated with Wnt2/β-catenin signaling pathway in carcinoma cells of inter-esophageal squamous cell [20]. In our present undertaking, MEM website confirmed that LINC00968 was co-expressed with WNT2 and that the latter participated in the Wnt/β-catenin pathway. As such, our study sought to investigate the underlying molecular mechanisms of LINC00968, WNT2 and Wnt2/β-catenin signaling pathway in breast cancer, thus providing new therapeutic strategies for breast cancer patients.

Methods and materials

Ethics statement

The protocols of the present study were approved by the Institutional Review Board of China-Japan Union Hospital of Jilin University. Written informed consents were signed by all participating patients. All animal experiments were performed in line with the approved Guide for the Care and Use of Laboratory Animal by International Committees.

Bioinformatics prediction

Breast cancer chip data (GSE26910) and annotation probe file were downloaded from Gene Expression Omnibus database (GEO, https://www.ncbi.nlm.nih.gov/geo/) and obtained from [HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array detection. The datasets were processed with background correction and normalization using an Affy package in R software [21]. Lineal model-empirical Bayes statistics in Limma package combined with t-test was used to non-specifically filter expression data and screen out differentially expressed lncRNAs and mRNA. Multiple-testing correction was performed using the Benjamini-Hochberg false discovery rate (FDR), lncRNA and mRNAs with FDR < 0.05 and absolute fold-change ≥1.5 were considered as significant [22]. Then, differentially expressed lncRNAs were predicted using Multi Experiment Matrix (MEM, http://biit.cs.ut.ee/mem/). MEM is an online tool for conducting co-expression queries among large collections of gene expression experiments. It provides access to hundreds of publicly available gene expression datasets of different tissues, diseases and conditions, set by the species and microarray platform types [23]. The Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was performed to confirm biochemical metabolic pathways and signaling pathways in which the target genes were involved based on WebGestalt database (http://www.webgestalt.org) [24].

Study subjects

From January 2014 to March 2016, 42 patients who were diagnosed with breast cancer and underwent surgical resection in China-Japan Union Hospital of Jilin University were enrolled. A total of 42 pairs of breast cancer tissues and adjacent normal tissues were collected. According to pathological diagnosis made by Union for International Cancer Control (UICC), collected tissues were confirmed as breast cancer tissues. After collection, all samples were immediately frozen in liquid nitrogen at − 80 °C for further analysis. All patients, ages 19 to 81 with mean age 59.45, have not undergone any chemoradiotherapy and endocrinotherapy prior sample collection. Confirmed pathology diagnosis was made according to the diagnostic criterion recommended by National coordinating group for breast cancer pathology. According to the classification of pathological tissues, 42 breast cancer patients were graded as follows: 8 cases of stage I, 19 cases of stage II and 15 cases of stage III. According to the Tumor Node Metastasis (TNM) classification criteria [25], patients were graded as follows: 9 cases of stage I, 15 cases of stage II, 18 cases of stage III; 24 cases with lymph node metastasis and 18 cases without lymph node metastasis.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

The total RNA of breast cancer tissues and adjacent normal tissues were extracted according to Trizol reagent kit instructions (15596–026, Invitrogen Inc., Gaithersburg, MD, UK) and primers of LINC00968, WNT2, β-catenin, Vimentin, E-cadherin and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed and then synthesized by Takara (Takara Holdings Inc., Kyoto, Japan, Table 1). Then, RNA was reverse transcribed into cDNA in accordance with the protocol of PrimeScript RT reagent kit with the reverse transcription system of 10 μL. The reaction conditions used were as follows: reverse transcription reaction at 37 °C for 3 times (15 min per time), and reverse transcriptase inactivation reaction at 85 °C for 5 s. Reaction liquid was extracted to proceed fluorescent quantitative PCR according to instructions of SYBR® Premix Ex TaqTM II reagent kit. The 50 μL reaction system consisted of: 2 × SYBR® Premix Ex Taq™ II (25 μL), PCR forward primers (2 μL), PCR reverse primers (2 μL), 50 × ROX Reference Dye (l μL), DNA module (4 μL), and ddH2O (16 μL). Fluorescent quantitative PCR was carried out in ABI PRISM® 7300 system and the reaction conditions were as follows: pre-denaturation at 95 °C for 30 s, 40 cycles of denaturation at 95 °C for 5 s, anneal and extension at 60 °C for 30 s. GAPDH was used as the internal reference for the relative expression of LINC00968, WNT2, β-catenin, Vimentin and E-cadherin. mRNA relative transcriptional level of target genes (LINC00968, WNT2, β-catenin, Vimentin and E-cadherin) were calculated using relative quantitative method: ΔCt = Ct target gene - Ct internal gene [26]. Then total RNA of human breast cancer cell line MCF-7 and multidrug resistant breast cancer cell line MCF-7/ADM was extracted after 48 h incubation. mRNA expression profile after transfection was detected by RT-qPCR using the same method.
Table 1

Primer sequences for RT-qPCR

GeneSequence (5′-3′)
LINC00968F: GGGTAACTTCAGGTGGAGCC
R: ACACGAAAGGCTGGAAGTGT
WNT2F: GATGCGTGCCATTAGCCAG
R: AGATTCCCGACTACTTCGGAG
β-cateninF: CGTGGACAATGGCTACTCAAGC
R: TCTGAGCTCGAGTCATTGCATAC
VimentinF: GACAATGCGTCTCTGGCACGTCTT
R: TCCTCCGCCTCCTGCAGGTTCTT
E-cadherinF: CCCACCACGTACAAGGGTC
R: CTGGGGTATTGGG GGCATC
GAPDHF: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG

Note: RT-qPCR reverse transcription quantitative polymerase chain reaction, F forward, R reverse, LINC00968 long non-coding RNA LINC00968, WNT2 Wingless-type MMTV integration site family member 2, GAPDH glyceraldehyde 3-phosphate dehydrogenase

Primer sequences for RT-qPCR Note: RT-qPCR reverse transcription quantitative polymerase chain reaction, F forward, R reverse, LINC00968 long non-coding RNA LINC00968, WNT2 Wingless-type MMTV integration site family member 2, GAPDH glyceraldehyde 3-phosphate dehydrogenase

Western blot analysis

Extracted breast cancer tissues and adjacent normal tissues were added with liquid nitrogen then ground until tissues became uniformly fine powder. After 48 h transfection, human breast cancer cell line MCF-7 and multidrug resistant breast cancer cell line MCF-7/ADM were collected and added with protein lysate (R0010, Beijing Solarbio Sciences Co., Ltd., Beijing, China), centrifuged at 4 °C for 20 min (25,764 g) and then supernatant was collected for further use. Next, protein concentration of each sample was determined and adjusted by deionized water so that sample load was consistent. Next, 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, P1200, Beijing Solarbio Sciences Co., Ltd., Beijing, China) was prepared. Subsequently, sample was mixed with loading buffer solution, boiled at 100 °C for 5 min, ice-bathed and centrifuged. Samples were standardized and loaded in gel for electrophoretic separation using micropipette and protein was then transferred to polyvinylidene fluoride (PVDF) membrane (HVLP04700, Millipore corporation, Bedford, MA, UK) and sealed by 5% skim milk powder at 4 °C overnight. After that, the membrane were incubated with the following antibodies: rabbit-anti-β-catenin (1:5000, ab32572), rabbit-anti-glycogen synthase kinase 3β (GSK3β; 1:5000, ab32391), rabbit-anti-Vimentin (1:1000, ab92547), rabbit-anti-breast cancer resistant protein (BCRP; 1:50, ab24115), rabbit-anti-P-glycoprotein(P-g; 1:100, ab103477), rabbit-anti-B-cell lymphoma-2 (Bcl-2; 1:1000, ab32124), rabbit-anti-Bcl-2 Associated X (Bax; 1:1000, ab32503), rabbit-anti-cleaved-caspase3 (1:100, ab2302), rabbit-anti cleaved-Poly(ADP-ribose)polymerase (PARP; 1:1000, ab32064), rabbit-anti-GAPDH (1:10000, ab181602), rabbit-anti p-β-catenin (1:1000, BS4303, Shanghai Chao Yan Biotech Co., Ltd., Shanghai, China) and rabbit-anti-p-GSK3β (1:500, PL0303230, Shenzhen Otwo Biological Technology Co., Ltd., Shenzhen, Guangdong, China), and mouse-anti-E-cadherin (1:50, ab1416), mouse-anti-multidrug resistance associated protein 1 (MRP1; 1:50, ab24102) overnight at 4 °C. Afterwards, the membrane was incubated with secondary antibodies goat-anti-rabbit immunoglobulin G (IgG) marked with horseradish peroxidase (HRP, 1:2000, ab6721) and goat-anti-mouse IgG antibody (1:2000, ab6789) for 2 h at room temperature. Except the antibodies p-β-catenin and p-GSK3β, the above-mentioned antibodies were all purchased from Abcam (Cambridge, MA, UK). Lastly, the membrane was washed with Tris-buffered saline tween (TBST) thrice, each for 10 min. Electrochemiluminescence (ECL) solution (1 ml) was prepared according to the instructions of SuperSignal®West Dura Extended Duration Substrate and transferred to the membranes for incubation at room temperature for 1 min. After the removal of redundant ECL solution, the membranes were sealed via preservative film, followed by exposure for 5–10 min and development. Gel imager was applied for photograph (Gel Doc XR, Bio-Rad, Hercules, CA, USA). GAPDH served as the internal control. The gray value ratio of target protein band to internal reference band was considered to be relative expression of protein. The steps were also applicable to the protein level detection of cells.

Northern blot analysis

Total RNA of breast cancer tissues and adjacent normal tissues in each group were extracted using Trizol one-step method following the instructions of Trizol Kit (15596–026, Invitrogen Inc., Gaithersburg, MD, USA). Then 10% SDS-PAGE (P1200, Beijing Solarbio Sciences Co., Ltd., Beijing, China) was prepared. After pre-electrophoresis with 50 V for 30 min, the samples were mixed with loading buffer solution, heated to 70 °C for 5 min for denaturation and then placed into an ice bath. After centrifugation, samples were standardized and loaded to each lane by micropipette to carry out electrophoretic separation. Electrophoresis was terminated when bromine blue (500 bp) was close to the edge of the gel and electrophoresis result was checked under the ultraviolet lamp. Then, protein on the gel was blotted to a nylon membrane soaked with diethylpyrocarbonate (DEPC) using capillary method (RPN303B, General Electric Company, Amersham, USA) and then the membrane was placed into ultraviolet (UV) crosslinker. Next, after cross linked with gel ultraviolet, the transfer efficiency of membrane was detected under the ultraviolet lamp. Pre-hybridization solution was preheated in the hybridization oven at 68 °C and then thoroughly mixed by vortex. The RNA upper side of membrane was put inside the hybridization tube and pre-hybridized for 4 h at 42 °C with 10 mL pre-hybridization solution. Domain Information Groper (DIG) labeling probe was diluted to 10 μL using DNA dilution buffer, namely, 2 μL target probe + 0.5 μL control probe (GAPDH) + 7.5 μL DNA dilution buffer, and placed on ice for 5 min. After transient centrifugation, solution the pellet was collected, mixed with 5 mL hybridization solution overnight at 37 °C and detected by DIG Luminescent Detection Kit (Roche, Mannheim Germany). Finally, the membrane was rinsed, sealed and exposed in darkness according to instructions of DIG Luminescent Detection Kit.

RNA-fluorescence in situ hybridization (FISH)

The subcellular location of LINC00968 in breast cancer cells were detected according to the instructions of Ribo™ lncRNA FISH Probe Mix (Red) (C10920, RiboBio Technology Co., Ltd., Guangzhou, China). The coverslips were placed into the 24-well plate, and each well was inoculated with 6 × 104 cell. When the cell confluence reached approximately 60–70%, cells were fixed in 1 mL 4% polyformaldehyde at room temperature for 10 min. Following, 1 mL PBS containing 0.5% Triton X-100 was added into each well and placed for 5 min at 4 °C. Afterwards, the cells were blocked with 200 μL prehybridization solution at 37 °C for 30 min, after that, an appropriate amount of hybridization solution containing anti-LINC00968 probe (GeneCreate Biotech Co., Ltd., Wuhan, Hubei, China) was added for further incubation at 42 °C overnight. All the next procedures were performed under dark conditions till the end: the cells were rinsed thrice with washing solution I (4× SSC, 0.1% Tween-20) at 42 °C, solution II (2× SSC), solution III (1× SCC) and 1× PBS, respectively (5 min per wash). Finally, the cells were stained with 4′-6-diamidino-2-phenylindole (DAPI) for 5 min and sealed with anti-fluorescence quenching agent. The 5 different view fields were selected under the fluorescence microscope (Olympus, Tokyo, Japan), observed and photographed.

RNA immunoprecipitation (RIP)

The binding between LINC00968 and transcriptional repressor HEY1 was detected using a RIP kit (Millipore, Bedford, MA, USA). The cells were uniformly lysed with an equal volume of radio-immunoprecipitation assay cell lysis buffer on ice for 5 min, and centrifuged at 14000×g at 4 °C for 10 min with supernatant obtained. Then, the cell extract was co-precipitated by incubation with the antibody as follows. A total of 50 μL magnetic beads used for each coprecipitation reaction system was washed, subsequently resuspended with 100 μL RIP Wash Buffer and incubated with 1 μg antibody according to grouping for binding. The magnetic bead-antibody complex was washed, resuspended in 900 μL RIP Wash Buffer and incubated with 100 μL cell extract overnight at 4 °C. The samples were placed on the magnetic-stand to collect the magnetic bead-protein complex, which was lately treated with proteinase K to extract the RNA for subsequent RT-qPCR determination. The antibodies used in the RIP assay were HEY1 (sc-134,362, 1:100, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) and IgG (ab109489, 1:100, Abcam, Cambridge, MA, USA) serving as the NC.

Chromatin immunoprecipitation (ChIP)

The cells were fixed with formaldehyde at room temperature for 10 min to cross-link DNA and protein. After cross-linking, the cross-linked DNA and protein was randomly fractured by ultrasonic treatment with the sonicator set to 10 s per ultrasound, 10 s interval and 15 cycles, followed by centrifugation at 12000×g at 4 °C for 10 min. The supernatant was collected into two tubes, which were respectively added with NC rabbit anti-IgG (ab109489, 1:100, Abcam, Cambridge, MA, USA) and HEY1 (sc-134,362, 1:100, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) for incubation overnight at 4 °C. The next day, the DNA-protein complex was precipitated using Protein Agarose/Sepharose, briefly centrifuged at 12000×g at 4 °C for 5 min with the supernatant discarded. The non-specific complex was washed, de-crosslinked at 65 °C overnight, and purified by phenol/chloroform to extract the DNA fragment. Finally, the binding of HEY1 to the WNT2 was detected by performing RT-qPCR.

Enzyme-linked immunosorbent assay (ELISA)

The detection of WNT2 in cell culture medium was performed according to the manufacture’s protocols provided by Human Protein WNT2 ELISA kit (CSB-EL026133HU, Sino-American Biotechnology Co., Ltd., Hunan, Hubei, China). The level of WNT2 was measured at a wavelength of 450 nm.

Cell grouping and transfection

Doxorubicin drug-resistant cell lines MCF-7/ADM and KPL-4/ADM were purchased from China-Japan Union Hospital of Jilin University and induced by progressively increasing doxorubicin dosage through breast cancer cells MCF-7 and KPL-4. Doxorubicin drug-resistant cell lines MCF-7/ADM and KPL-4/ADM were cultured by FBS RPMI-1640 medium. Firstly, cell was incubated at 37 °C with 5% CO2. After changing the solution for the first time, cells were further incubated. After that, the solution was changed every 3 d. When cell confluency reached 80–90%, cells were subcultured. After discarding culture solution, cells were washed with phosphate buffered saline (PBS) twice and treated with 2 mL 0.25% trypsin (25200–056, Gibco, Carlsbad, California, USA) at 37 °C for 3–5 min, which was terminated with Dulbecco’s modified eagle’s medium (DMEM)/F12 medium containing 10% serum. After repeated trituration, cell suspension was collected, centrifuged at 179 g for 5 min at 4 °C, inoculated into complete medium (INV-00002, Innui Rui Bio Medicine Co., Ltd., Wuxi, China) and passaged at the ratio of 1:3. The cultured cells were assigned into 7 groups as follows: control (breast cancer MCF-7 cell), blank (MCF-7/ADM cell, without any transfection), negative control (NC, MCF-7/ADM cell transfected with LINC00968 nonsense sequence), LINC00968 vector (MCF-7/ADM cell transfected with LINC00968 overexpression sequence), WNT2 vector (MCF-7/ADM cell transfected with WNT2 overexpression sequence), si-LINC00968 (MCF-7/ADM cell transfected with LINC00968 silencing sequence), si-WNT2 (MCF-7/ADM cell transfected with WNT2 gene silencing sequence), and LINC00968 vector + WNT2 vector (MCF-7/ADM cell transfected with LINC00968 overexpression and then transfected with WNT2 overexpression sequence). The KPL-4/ADM cells were also allocated into above-mentioned groups and underwent similar treatments to that of MCF-7/ADM cells. Breast cancer cells in logarithmic growth phase were inoculated in a 6-well plate and transfected according to the instructions of lipofectamine 2000 (Invitrogen Inc., Carlsbad, CA, USA) when cell density reached 30–50%. Then 100 pmol LINC00968 vector, si-LINC00968, si-WNT2, LINC00968 vector + si-WNT2 and NC were diluted with 250 μL Opti-MEM (Gibco Company, Grand Island, N.Y., USA) without serum medium (final concentration 50 nM), uniformly mixed and incubated at room temperature for 5 min. Next, 5 μL lipofectamine 2000 was diluted with 250 μL Opti-MEM without serum medium, uniformly mixed and incubated at room temperature for 5 min. Then, these two media were evenly mixed, incubated at room temperature for 20 min and then added into cell culture plate. After that, cells were incubated at 37 °C with 5% CO2 for 6–8 h and then the former medium was replaced by complete medium. Finally, follow-up experiment was subsequently done after 12–48 h culture.

Dual luciferase reporter gene assay

HEK-293 T cell (AT-1592, ATCC, Manassas, VA, USA) was inoculated into a 24-well plate and cultured for 24 h. Next, WNT2 dual-luciferase reporter genetic vectors [pmiRRB-wildtype (Wt)-WNT2–3’UTR and pmiRRB-mutant (Mut)-WNT2–3’UTR] were constructed and transfected into HEK-293 T cell together with LINC00968 vector and NC. After 48 h transfection, the medium was removed. Cells were washed twice with PBS, collected and lysed. Then Dual-Luciferase® Reporter Assay System (E1910, Promega Corp., Madison, Wisconsin, USA) was used to determine luciferase activity. Every 10 μL cell samples were added with 50 μL firefly luciferase working solution to detect firefly luciferase activity and then added with 50 μL renilla luciferase working solution to determine renilla luciferase activity. The ratio of firefly luciferase activity to renilla luciferase activity was regarded as relative luciferase activity. The experiment was conducted three times.

Cell counting Kit-8 (CCK-8) assay

Cell proliferation and sensitivity to antitumor drugs in each group were detected according to the instructions of CCK-8 kit. Cells in logarithmic growth phase were collected and detached with trypsin. Then cell was re-suspended (1 × 104 cells/mL concentration), inoculated into a 96-well plate at a density of 100 μL/well and incubated at 37 °C with 5% CO2. After 48 h, cell drug-resistance was detected. After that, adriamycin (ADR), Taxel and vincristine (VCR) were diluted and added into corresponding wells at a density of 10 μL/well. When final drug concentration gradient was formed, cells were further incubated for 48 h. Next, the set up was added with 10 μL CCK8 in each well, and then incubated again for another 4 h. After that, optical density (OD) value at the wavelength of 450 nm was measured using an enzyme labeling instrument (NYW-96 M, Peking Nuoya wei Instrument Co., Ltd., Beijing, China). Each well was done in triplicate and the experiment was conducted at least three times. Besides, each plate has a set of control plate without cells.

Clonogenic assay

Luria-Bertani (LB) culture plate (D0110, Beijing Nobleryder Science and Technology Co., Ltd., Beijing, China) was prepared, detached, centrifuged, counted and resuspended with 1640 culture medium (Gibco, Gaithersburg, MD, USA). Then each cell culture medium (10 cm) was inoculated with 500 cells, uniformly mixed and incubated at 37 °C with 5% CO2 for two weeks. After that, culture medium was discarded, cells were washed thrice with PBS, fixed with 4% paraformaldehyde at room temperature for 20 min and stained with crystal violet for 60 min. After crystal violet was slowly removed, the plates were air dried and placed under a microscope for counting clones with more than 50 cells. The experiment was conducted three times.

Scratch test

After 48 h transfection, cells in the logarithmic growth phase were collected, inoculated into a 6 well-plate at the density of 1 × 106 cells/well and then cultured at 37 °C with 5% CO2. When cell confluence reached about 95%, 20 μL micropipette was utilized to vertically scratch the 6 well-plate and D-hanks solution was used to wash removed cells. Then cells were further cultured with serum-free medium. After scratching for 0 h and 24 h, samples were collected. Three 100 × views were selected to take photos under the phase contrast microscope and scratch healing differences were compared among groups. Healing rate represents cell migration healing ability.

Transwell assay

Matrigel (354,230, Shanghai Qian Chen BioScience & Technology Co., Ltd., Shanghai, China) was dissolved at 4 °C overnight, diluted with serum-free 1640 medium at 1:3 and then added into the apical chamber of each Transwell, which was divided 3 times (15 μL, 7.5 μL, 7.5 μL, altogether 30 μL) with the interval of 10 min. Then Matrigel was uniformly paved and covered all the microwells on the bottom of apical chamber. After 48 h of transfection, HepG2 cells were collected to prepare cell suspension and inoculated into the apical chamber of Transwell (Corning Glass Works, Corning, N.Y., USA) with 1640 medium (0.5 mL) containing 10% FBS, which was added into the lower chamber of a 24 well-plate. Then cells were incubated at 37 °C with 5% CO2 for 48 h. After slightly removing impenetrable cells in the apical chamber of Transwell, the membrane was fixed at 95% ethanol for 15–20 min, stained with crystal violet for 10 min and rinsed with running water. Afterwards, cells were placed under a high-power inverted microscope to count the number and then photographed. Five visual fields were randomly selected in each sample for counting the average value of cells. Cells penetrating Matrigel in each group was regarded as the indicator of cell invasion ability. Experiment was repeated three times.

Flow cytometry

After transfection for 48 h, the cells were collected, detached with trypsin without ethylenediamine tetraacetic acid (EDTA) and centrifuged at 179 g for 5 min. The supernatant was then removed. The cells were washed with pre-cooling PBS, followed by centrifugation at 179 g for 5 min and supernatant removal. Next, cell apoptosis was detected using Annexin-V- fluorescein isothiocyanate/Propidium iodide (FITC/PI) reagent kit (CA1020, Beijing Solarbio Sciences Co., Ltd., Beijing, China). Then, the cells were washed with binding buffer and Annexin-V-FITC was mixed with binding buffer at the ratio of 1:40. The cells were re-suspended, uniformly mixed by oscillation and incubated at room temperature for 30 min. After that, the cells were uniformly mixed with PI and binding buffer (1:40) and incubated at room temperature for 15 min. Flow cytometry was used to detect cell cycle arrest. Experiment was repeated three times.

Tumor xenograft in nude mice

A total of 21 BALB/c nude mice (age 5–6 weeks, weight 18–20 g, Zhongshan University Animal Center) were allocated into the control group, the blank group, the NC group, the LINC00968 vector group, the si-LINC00968 group, the si-WNT2 group and the LINC00968 vector + si-WNT2 group (3 mice/group). Raising condition was under strict control with constant temperature and pathogen-free. Before inoculating the tumor, the mice were fed and observed for about one week. After transfected cells were detached, the cells in each group were centrifuged at 179 g for 5 min, washed with PBS twice, collected and uniformly mixed with diluted high-concentration Matrigel (PBS: Matrigel = 2:1). Next, the mice were inoculated with the cells with subcutaneous injection (5 × 106 cells/mouse). After that, the mice were weighed, the long and short diameter of the tumors were recorded using a Vernier caliper every 5 days. Then 35 days after inoculation, the mice were sacrificed by cervical dislocation and the tumors were excised and weighed. Tumor weight in each group was compared. Tumor volume (mm3) = 1/2 × (L × W2), L = the long diameter, W = the short diameter.

Statistical analysis

All data analysis was conducted using SPSS 21.0 software (IBM Corp. Armonk, NY, USA). The measurement data were presented as the mean ± standard deviation. Comparisons between two groups were analyzed by t-test, while comparison of all indicators between breast cancer tissues and adjacent normal tissues were performed using paired t-test. Comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA) and pairwise comparisons were conducted using least significant difference (LSD) test. When p < 0.05, result was considered to be statistically significant.

Results

LINC00968 regulates WNT2-mediated Wnt2/β-catenin signaling pathway via transcriptional repressor HEY1 in breast cancer

Initially, breast cancer chip GSE26910 was used to detect the differential expression of LINC00968 and WNT2. The results showed that LINC00968 expression was low while expression of WNT2 was high in breast cancer (Fig. 1A). TCGA database showed that LINC00968 was poorly expressed in various cancers (Fig. 1B), including breast cancer (Fig. 1C). The survival analysis of LINC00968 expression and breast cancer revealed that low expression of LINC00968 shared association with poor prognosis of breast cancer patients (p = 0.03) (Fig. 1D). MEM website confirmed that LINC00968 and WNT2 exhibits co-expression with the latter playing a role in the Wnt2/β-catenin signaling pathway (Table 2). Subsequently, detection on the subcellular location of LINC00968 in breast cancer cells by FISH showed that LINC00968 was localized in nucleus (Fig. 1E). According to the previous literature [27], we hypothesized that LINC00968 was of great potential to affect the transcription of the upstream promoter region of the encoded protein gene, thereby interfering with the expression of downstream genes. Furthermore, in order to validate this hypothesis, we searched for LncMAP website to figure out whether LINC00968 could bind with transcriptional factors. Consequently, HEY1, USF1, POLR3A, TAF1, TCF12, JUND, BCL11A, STAT1, NFKB1, EP300, and CREBBP were found to potentially bind to LINC00968. And RIP assay suggested that HEY1 could bind to LINC00968 (Fig. 1F), which also found to bind WNT2 promoter as firstly suggested by online Jaspar website (http://jaspar.genereg.net/) (Fig. 1G) and then confirmed by ChIP assay (Fig. 1H).
Fig. 1

The potential involvement of the LINC00968/HEY1/WNT2 axis mediated Wnt2/β-catenin signaling pathway in breast cancer. a selection thermogram of GEO dataset GSE26910. The horizontal coordinate represents the samples, and the vertical coordinate represents the genes. The upper right histogram is the color gradation. Each rectangle corresponds to one gene expression in one sample. Each column signifies gene expression of each sample; dendrogram on the left side represents cluster analysis of different genes from different samples; uppermost crossband represents sample type and upper right pane signifies color reference, while blue is the normal control sample and red is tumor sample. b the expression pattern of LINC00968 in cancer tissues and normal tissues of various cancers according to TCGA database. c the expression of LINC00968 in breast cancer tissues and adjacent normal tissues. d the survival analysis of LINC00968 expression and survival rate of patients. e the subcellular localization of LINC00968 in breast cancer cells as detected by FISH assay. f the binding status of LINC00968 to HEY1 as confirmed by RIP assay. g the binding sites of HEY1 to the WNT2 promoter as predicted by online Jaspar website (http://jaspar.genereg.net/). h the binding status of HEY1 to the WNT2 promoter as verified by ChIP assay. i the interaction between LINC00968 and WNT2 as verified by Dual luciferase reporter gene assay. *p < 0.05 vs. the NC group. j the mRNA expression of INC00968 and WNT2 as determined by RT-qPCR. k the protein levels of INC00968 and WNT2 as evaluated by Western blot analysis. l the expression of WNT2 in cell culture medium as assayed by ELISA. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector group. m the mRNA expression of LINC00968, WNT2, and β-catenin in breast cancer tissues and normal adjacent tissues as measured by RT-qPCR. n the protein level of WNT2 and the phosphorylation levels of β-catenin and GSK3β. o the level of LINC00968 determined by Northern blot analysis. *p < 0.05 vs. the adjacent normal tissues

Table 2

KEGG pathway enrichment analysis of the target genes of LINC00968

Pathwayp valueGene
Proteoglycans in cancer0.005872TWIST2, DCN, RRAS, THBS1, WNT2
Wnt signaling pathway0.00678WNT2
Tyrosine metabolism0.016454ALDH3B1, AOX1
Drug metabolism0.030724ALDH3B1, AOX1
Viral myocarditis0.038491LAMA2, SGCD
Arachidonic acid metabolism0.041231CYP2U1, PTGS1
ARVC0.067227LAMA2, SGCD
ECM-receptor interaction0.077424LAMA2, THBS1

Note: ARVC Arrhythmogenic right ventricular cardiomyopathy, ECM extracellular matrix, LINC00968 long non-coding RNA LINC00968

The potential involvement of the LINC00968/HEY1/WNT2 axis mediated Wnt2/β-catenin signaling pathway in breast cancer. a selection thermogram of GEO dataset GSE26910. The horizontal coordinate represents the samples, and the vertical coordinate represents the genes. The upper right histogram is the color gradation. Each rectangle corresponds to one gene expression in one sample. Each column signifies gene expression of each sample; dendrogram on the left side represents cluster analysis of different genes from different samples; uppermost crossband represents sample type and upper right pane signifies color reference, while blue is the normal control sample and red is tumor sample. b the expression pattern of LINC00968 in cancer tissues and normal tissues of various cancers according to TCGA database. c the expression of LINC00968 in breast cancer tissues and adjacent normal tissues. d the survival analysis of LINC00968 expression and survival rate of patients. e the subcellular localization of LINC00968 in breast cancer cells as detected by FISH assay. f the binding status of LINC00968 to HEY1 as confirmed by RIP assay. g the binding sites of HEY1 to the WNT2 promoter as predicted by online Jaspar website (http://jaspar.genereg.net/). h the binding status of HEY1 to the WNT2 promoter as verified by ChIP assay. i the interaction between LINC00968 and WNT2 as verified by Dual luciferase reporter gene assay. *p < 0.05 vs. the NC group. j the mRNA expression of INC00968 and WNT2 as determined by RT-qPCR. k the protein levels of INC00968 and WNT2 as evaluated by Western blot analysis. l the expression of WNT2 in cell culture medium as assayed by ELISA. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector group. m the mRNA expression of LINC00968, WNT2, and β-catenin in breast cancer tissues and normal adjacent tissues as measured by RT-qPCR. n the protein level of WNT2 and the phosphorylation levels of β-catenin and GSK3β. o the level of LINC00968 determined by Northern blot analysis. *p < 0.05 vs. the adjacent normal tissues KEGG pathway enrichment analysis of the target genes of LINC00968 Note: ARVC Arrhythmogenic right ventricular cardiomyopathy, ECM extracellular matrix, LINC00968 long non-coding RNA LINC00968 Dual luciferase reporter gene assay was employed to verify the possible interactions between WNT2 and LINC00968. Findings revealed that Wt-LINC00968/WNT2 in the LINC00968 vector group exhibited elevated luciferase signal compared with the NC group (p < 0.05), while luciferase activity with Mut-3’UTR showed no significant differences (p > 0.05) (Fig. 1I). After which, RT-qPCR was performed to detect changes in the expression of LINC00968 and WNT2. Compared with the blank and NC groups, there was no significant difference between the si-WNT2 and WNT2 vector groups regarding to the levels of LINC00968 (p > 0.05). The LINC00968 vector and LINC00968 vector + WNT2 vector groups exhibited significantly increased expression of LINC00968 (all p < 0.05). While the si-WNT2, WNT2 vector and LINC00968 vector + WNT2 vector groups had prominently elevated expression of WNT2 (all p < 0.05). The si-LINC00968 group had markedly reduced LINC00968 level (p < 0.05), while the LINC00968 vector and si-WNT2 groups displayed a decline in WNT2 expression (all p < 0.05) (Fig. 1J-K). The expression of WNT2 in cell culture medium was also evaluated by means of ELISA, and the results displayed in Fig. 1L turned out to have a similar trend to that presented in Fig. 1K. All these results demonstrated that LINC00968 could suppress the expression of WNT2. According to the results of RT-qPCR and Western blot analysis (Fig. 1M-N), breast cancer tissues had obviously reduced level of LINC00968 compared with adjacent normal tissues, while WNT2 and β-catenin levels were markedly increased levels with significantly increased phosphorylation levels of β-catenin and GSK3β. Additionally, Northern blot analysis was performed to detect level of LINC00968 in breast cancer tissues and adjacent normal tissues. The results confirmed (Fig. 1O) that compared with paired adjacent normal tissues, breast cancer tissues had markedly decreased levels of LINC00968. The results signified that LINC00968 levels was significantly low in breast cancer tissues while levels of WNT2 and Wnt2/β-catenin signaling pathway-related factors were high.

LINC00968 overexpression inhibits the activation of Wnt2/β-catenin signaling pathway and epithelial-mesenchymal transition in breast cancer cells

In order to investigate the involvement of LINC00968 in epithelial-mesenchymal transition via the Wnt2/β-catenin signaling pathway, RT-qPCR and Western blot analysis were performed to detect the mRNA and protein levels of epithelial-mesenchymal transition markers (E-cadherin and Vimentin) in MCF-7/ADM cells after plasmid delivery. The results (Fig. 2A-E) showed that other groups apart from the control group all had elevated levels of β-catenin, GSK3β and Vimentin, together with increased phosphorylation levels of β-catenin and GSK3β but reduced E-cadherin levels (all p < 0.05). Additionally, compared with the blank and the NC groups, the LINC00968 vector and si-WNT2 groups had decreased levels of β-catenin, GSK3β and Vimentin, downregulated phosphorylation levels of β-catenin and GSK3β, and elevated level of E-cadherin (all p < 0.05). Meanwhile, the si-LINC00968, WNT2-vector and LINC00968 vector + WNT2 vector groups displayed the opposite effects on all aforementioned parameters (p < 0.05). Furthermore, compared with the LINC00968 vector group, the LINC00968 vector+WNT2 vector showed an elevation in the levels of β-catenin, GSK3β and Vimentin, an upregulation in the phosphorylation levels of β-catenin and GSK3β, and a decline in the level of E-cadherin (all p < 0.05). These results demonstrated that overexpressed LINC00968 or silenced WNT2 inhibited the activation of Wnt2/β-catenin signaling pathway as well as epithelial-mesenchymal transition in MCF-7/ADM cells. Similarly, the results (Fig. 2F-J) that demonstrated in KPL-4/ADM cells were the same as the those in MCF-7/ADM cells, which further validate the reliability of the obtained results.
Fig. 2

LINC00968 contributes to inhibition of the Wnt2/β-catenin signaling pathway, elevated E-cadherin level and downregulated Vimentin level. a the mRNA expression of β-catenin, GSK3β and Vimentin in MCF-7/ADM cells after plasmid delivery in each group as measured by RT-qPCR. b protein bands of β-catenin/p-β-catenin, GSK3β/p-GSK3β and Vimentin/p-Vimentin in MCF-7/ADM cells after plasmid delivery of each group as determined by Western blot analysis. c histogram of levels of β-catenin/p-β-catenin, GSK3β/p-GSK3β and Vimentin/p-Vimentin in each group. d protein bands of LINC00968 in MCF-7/ADM cells after plasmid delivery of each group. e LINC00968 protein level in each group detected by Northern blot analysis. f the mRNA expression of β-catenin, GSK3β and Vimentin in KPL-4/ADM cells after plasmid delivery in each group as measured by RT-qPCR. g protein bands of β-catenin/p-β-catenin, GSK3β/p-GSK3β and Vimentin/p-Vimentin in KPL-4/ADM cells after plasmid delivery of each group as determined by Western blot analysis. h histogram of levels of β-catenin/p-β-catenin, GSK3β/p-GSK3β and Vimentin/p-Vimentin in each group. i protein bands of LINC00968 in KPL-4/ADM cells after plasmid delivery of each group as evaluated by Northern blot analysis. j histogram of LINC00968 protein level in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

LINC00968 contributes to inhibition of the Wnt2/β-catenin signaling pathway, elevated E-cadherin level and downregulated Vimentin level. a the mRNA expression of β-catenin, GSK3β and Vimentin in MCF-7/ADM cells after plasmid delivery in each group as measured by RT-qPCR. b protein bands of β-catenin/p-β-catenin, GSK3β/p-GSK3β and Vimentin/p-Vimentin in MCF-7/ADM cells after plasmid delivery of each group as determined by Western blot analysis. c histogram of levels of β-catenin/p-β-catenin, GSK3β/p-GSK3β and Vimentin/p-Vimentin in each group. d protein bands of LINC00968 in MCF-7/ADM cells after plasmid delivery of each group. e LINC00968 protein level in each group detected by Northern blot analysis. f the mRNA expression of β-catenin, GSK3β and Vimentin in KPL-4/ADM cells after plasmid delivery in each group as measured by RT-qPCR. g protein bands of β-catenin/p-β-catenin, GSK3β/p-GSK3β and Vimentin/p-Vimentin in KPL-4/ADM cells after plasmid delivery of each group as determined by Western blot analysis. h histogram of levels of β-catenin/p-β-catenin, GSK3β/p-GSK3β and Vimentin/p-Vimentin in each group. i protein bands of LINC00968 in KPL-4/ADM cells after plasmid delivery of each group as evaluated by Northern blot analysis. j histogram of LINC00968 protein level in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

LINC00968 overexpression and WNT2 silencing reduce drug resistance of breast cancer cells

Drug resistance of MCF-7/ADM and KPL-4/ADM cells to ADR, Taxel and VCR was detected by CCK-8 assay, the results are displayed in Table 3. Compared with the control group, the other groups revealed elevated IC50, promoted drug resistance to ADR, Taxel and VCR as well as the increased levels of MRP1, BCRP and P-gp (all p < 0.05). Furthermore, compared with the blank and NC groups, these parameters were notably reduced in the LINC00968 vector and si-WNT2 groups (all p < 0.05), whereas markedly increased in the si-LINC00968, WNT2 vector and LINC00968 vector + WNT2 vector groups (all p < 0.05). Lastly, compared with the LINC00968 vector group, the LINC00968 vector + WNT2 vector group had increased IC50, enhanced drug resistance to ADR, Taxel and VCR, and upregulated levels of MRP1, BCRP and P-gp levels (all p < 0.05) (Fig. 3). Therefore, results demonstrated that overexpression of LINC00968 and silencing WNT2 could reduce the drug resistance of MCF-7/ADM and KPL-4/ADM cells, whereas WNT2 reversed the effects of LINC00968 overexpression had on decreased drug resistance.
Table 3

IC50 levels of ADR, Taxel and VCR is reduced in MCF-7/ADM and KPL-4/ADM cells after plasmid delivery

GroupADRTaxelVCR
MCF-7
 Control8.68 ± 0.941.26 ± 0.090.89 ± 0.07
 Blank125.57 ± 10.56* 8.89 ± 0.57* 14.02 ± 1.14*
 NC121.62 ± 11.04* 8.54 ± 0.62* 13.14 ± 1.03*
 LINC00968 vector70.59 ± 6.34*#& 5.66 ± 0.43*#& 7.21 ± 0.52*#&
 si-LINC00968189.45 ± 15.24*# 22.46 ± 1.54*# 38.65 ± 2.78*#
 WNT2 vector201.32 ± 16.04*#& 24.16 ± 1.61*#& 40.51 ± 2.94*#&
 si-WNT267.89 ± 4.57*# 5.28 ± 0.41*# 7.63 ± 0.53*#
 LINC00936 vector + WNT2 vector158.32 ± 13.56*# 15.16 ± 1.38*# 26.31 ± 2.59*#
KPL-4
 Control9.34 ± 1.081.57 ± 0.110.97 ± 0.09
 Blank132.41 ± 11.57* 9.94 ± 0.68* 17.05 ± 1.24*
 NC139.57 ± 12.01* 10.05 ± 0.71* 16.27 ± 1.15*
 LINC00968 vector80.27 ± 8.45*#& 5.79 ± 0.53*#& 8.38 ± 0.73*#&
 si-LINC00968209.72 ± 15.37*# 23.67 ± 1.63*# 41.59 ± 3.01*#
 WNT2 vector213.47 ± 16.68*#& 26.41 ± 1.74*# 43.92 ± 3.26*#&
 si-WNT276.42 ± 7.83*# 6.04 ± 0.55*# 9.07 ± 0.81*#
 LINC00936 vector + WNT2 vector174.83 ± 14.27*# 16.72 ± 1.48*# 31.24 ± 2.91*#

Note: *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector group. ADR adracalin, VCR Vincristine, NC negative control, WNT2 Wingless-type MMTV integration site family member 2, LINC00968 LINC00968 long non-coding RNA LINC00968

Fig. 3

Overexpressed LINC00968 or silenced WNT2 contributes to reduced drug resistance of breast cancer cells. a drug resistance of transfected MCF-7/ADM cells to ADR as evaluated by CCK-8 assay. b drug resistance of transfected MCF-7/ADM cells to Taxel as determined by CCK-8 assay. c drug resistance of transfected MCF-7/ADM cells to VCR as assessed by CCK-8 assay. d protein bands of MRP1, BCRP, and P-gp in transfected MCF-7/ADM cells ad determined by Western blot analysis. e histogram of MRP1, BCRP, and P-gp protein levels in each group. f drug resistance of transfected KPL-4/ADM cells to ADR as evaluated by CCK-8 assay. g drug resistance of transfected KPL-4/ADM cells to Taxel as determined by CCK-8 assay. h drug resistance of transfected KPL-4/ADM cells to VCR as assessed by CCK-8 assay. i protein bands of MRP1, BCRP, and P-gp in transfected KPL-4/ADM cells ad determined by Western blot analysis. j histogram of MRP1, BCRP, and P-gp protein levels in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

IC50 levels of ADR, Taxel and VCR is reduced in MCF-7/ADM and KPL-4/ADM cells after plasmid delivery Note: *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector group. ADR adracalin, VCR Vincristine, NC negative control, WNT2 Wingless-type MMTV integration site family member 2, LINC00968 LINC00968 long non-coding RNA LINC00968 Overexpressed LINC00968 or silenced WNT2 contributes to reduced drug resistance of breast cancer cells. a drug resistance of transfected MCF-7/ADM cells to ADR as evaluated by CCK-8 assay. b drug resistance of transfected MCF-7/ADM cells to Taxel as determined by CCK-8 assay. c drug resistance of transfected MCF-7/ADM cells to VCR as assessed by CCK-8 assay. d protein bands of MRP1, BCRP, and P-gp in transfected MCF-7/ADM cells ad determined by Western blot analysis. e histogram of MRP1, BCRP, and P-gp protein levels in each group. f drug resistance of transfected KPL-4/ADM cells to ADR as evaluated by CCK-8 assay. g drug resistance of transfected KPL-4/ADM cells to Taxel as determined by CCK-8 assay. h drug resistance of transfected KPL-4/ADM cells to VCR as assessed by CCK-8 assay. i protein bands of MRP1, BCRP, and P-gp in transfected KPL-4/ADM cells ad determined by Western blot analysis. j histogram of MRP1, BCRP, and P-gp protein levels in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

LINC00968 overexpression and WNT2 silencing reduce colony formation ability of breast cancer cells

Clonogenic assay was performed to determine colony formation of MCF-7/ADM and KPL-4/ADM cells, and the results are displayed in Fig. 4. All groups except the control group had an increased number of forming colony units (all p < 0.05). Compared with the blank and NC groups, a reduction in the cell colony formation was revealed in the LINC00968 vector and si-WNT2 groups (all p < 0.05), while an increment was observed in the si-LINC00968, WNT2 vector and LINC00968 vector + WNT2 vector groups (all p < 0.05). Compared with the LINC00968 vector group, the number of forming colony units was markedly increased in the LINC00968 vector + WNT2 vector group (all p < 0.05). As such, these results showed that colony formation ability of breast cancer cells was significantly reduced either by overexpressing LINC00968 and or silencing WNT2. Moreover, WNT2 reversed the effects of LINC00968 overexpression had on inhibited cell colony formation ability.
Fig. 4

Overexpressed LINC00968 or silenced WNT2 decrease colony formation ability of breast cancer cells. a the colony formation ability of transfected MCF-7 cells in each group as assessed by clonogenic assay. b histogram of the number of forming colony units in each group. c the colony formation ability of transfected KPL-4 cells in each group as evaluated by clonogenic assay. d histogram of the number of forming colony units in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

Overexpressed LINC00968 or silenced WNT2 decrease colony formation ability of breast cancer cells. a the colony formation ability of transfected MCF-7 cells in each group as assessed by clonogenic assay. b histogram of the number of forming colony units in each group. c the colony formation ability of transfected KPL-4 cells in each group as evaluated by clonogenic assay. d histogram of the number of forming colony units in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

LINC00968 overexpression and WNT2 silencing suppress migration and invasion of breast cancer cells

In order to evaluate the influence of LINC00968 and WNT2 on migration and invasion abilities of breast cancer cells, the scratch test and Transwell assay were performed to assess the changes in migration and invasion of parent MCF-7 cells and drug-resistant MCF-7/ADM cells after transduction. Results showed that cell migration and invasion abilities of all groups except the control group were significantly enhanced (all p < 0.05). Additionally, compared with the blank and NC groups, the LINC00968 vector and si-WNT2 groups all had suppressed migration and invasion abilities of breast cancer cells (all p < 0.05), while the si-LINC00968, WNT2 vector and LINC00968 vector + WNT2 vector groups presented markedly promoted cell migration and invasion abilities (all p < 0.05). The LINC00968 vector + WNT2 vector group exhibited a notable enhancement in invasion and migration abilities of breast cancer cells compared with the LINC00968 vector group (Fig. 5). Taken together, these findings provided evidence that the migration and invasion abilities of breast cancer cells were reduced either by overexpressing LINC00968 and or silencing WNT2. WNT2 reversed the inhibited cell migration and invasion that resulted by LINC00968 overexpression.
Fig. 5

Overexpressed LINC00968 or silenced WNT2 decreases migration and invasion abilities of breast cancer cells. a the migration ability of MCF-7 cells after plasmid delivery in each group as evaluated by the scratch test. b the invasion ability of MCF-7 and MCF-7/ADM cells after plasmid delivery in each group as determined by the Transwell assay. c the cell migration rate in each group. d the number of invasive cells in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

Overexpressed LINC00968 or silenced WNT2 decreases migration and invasion abilities of breast cancer cells. a the migration ability of MCF-7 cells after plasmid delivery in each group as evaluated by the scratch test. b the invasion ability of MCF-7 and MCF-7/ADM cells after plasmid delivery in each group as determined by the Transwell assay. c the cell migration rate in each group. d the number of invasive cells in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

LINC00968 overexpression and WNT2 silencing promote cell apoptosis

With the aim of exploring the effect of LINC00968 and WNT2 on breast cancer cell apoptosis, flow cytometry was employed to analyze the apoptosis rate, and RT-qPCR and Western blot analysis were conducted to measure the expression of apoptosis-related proteins (Bax, cleaved-PARP, cleaved-caspase3 and Bcl-2) in parent MCF-7 cells and drug-resistant MCF-7/ADM cells after plasmid delivery in each group. All the other groups apart from the control group, exhibited significantly enhanced cell apoptosis rate, decreased expression of Bax, cleaved-PARP, cleaved-caspase3 but increased Bcl-2 (all p < 0.05). The cell apoptosis rate as well as the expression of apoptosis-related proteins between the blank and NC groups did not differ significantly (all p > 0.05). In comparison with the blank and NC groups, the LINC00968 vector and si-WNT2 groups all presented prominently high cell apoptosis rate, elevated expression of Bax, cleaved-PARP, cleaved-caspase3 but significantly decreased Bcl-2 (all p < 0.05); the tendency of which was opposite in the si-LINC00968, WNT2 vector, LINC00968 vector + WNT2 vector groups (all p < 0.05). The LINC00968 vector + WNT2 vector displayed a higher cell apoptosis rate than that of the LINC00968 vector group, as well as a notable decline in the expression of Bax, cleaved-PARP, cleaved-caspase3 and an distinctive elevation in Bcl-2 (all p < 0.05) (Fig. 6). Altogether, these results came to a demonstration that LINC00968 overexpression and WNT2 silencing promoted cell apoptosis, while WNT2 reversed the induced cell apoptosis that caused by LINC00968 overexpression.
Fig. 6

Overexpressed LINC00968 or silenced WNT2 contributes to promoted apoptosis of breast cancer cells. a the apoptosis of MCF-7 cells after transduction in each group as analyzed by flow cytometry. b the cell apoptosis rate in each group. c protein bands of Bax, cleaved-PARP, cleaved-caspase3 and Bcl-2 in MCF-7/ADM cells after transduction in each group as measured by Western blot analysis. d the protein levels of Bax, cleaved-PARP, cleaved-caspase3 and Bcl-2 in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

Overexpressed LINC00968 or silenced WNT2 contributes to promoted apoptosis of breast cancer cells. a the apoptosis of MCF-7 cells after transduction in each group as analyzed by flow cytometry. b the cell apoptosis rate in each group. c protein bands of Bax, cleaved-PARP, cleaved-caspase3 and Bcl-2 in MCF-7/ADM cells after transduction in each group as measured by Western blot analysis. d the protein levels of Bax, cleaved-PARP, cleaved-caspase3 and Bcl-2 in each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

LINC00968 overexpression and WNT2 silencing inhibit growth of transplanted tumor in nude mice

In order to further verify the effect of LINC00968 and WNT2 on the growth of breast cancer in vivo, tumor xenograft from nude mice was applied into BALB/c male mice. Results of tumor volume showed that all the other groups except the control, had obviously increased tumor weight and volume (p < 0.05), and either the blank group or the NC group did not show any significant difference (p > 0.05). In comparison with the blank and NC groups, tumor volume was reduced 14 d after inoculation in the LINC00968 vector and si-WNT2 groups (all p < 0.05), while increased in the si-LINC00968, WNT2 vector and LINC00968 vector + WNT2 vector groups (p < 0.05). Lastly, the LINC00968 vector + WNT2 vector group had an elevated tumor volume since the 14 d after inoculation as well as increased tumor weight (all p < 0.05) (Fig. 7). These findings suggested that growth of transplanted tumor in nude mice was suppressed either by overexpressing LINC00968 and silencing WNT2, while WNT2 reversed the inhibited tumor growth in nude mice that triggered by LINC00968 overexpression.
Fig. 7

Overexpressed LINC00968 or silenced WNT2 restrains transplantation tumor growth in nude mice. a the tumor volume in nude mice of each group b the tumor weight in nude mice of each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

Overexpressed LINC00968 or silenced WNT2 restrains transplantation tumor growth in nude mice. a the tumor volume in nude mice of each group b the tumor weight in nude mice of each group. *p < 0.05 vs. the control group; # p < 0.05 vs. the blank and NC groups; & p < 0.05 vs. the LINC00968 vector + WNT2 vector group

Discussion

Despite the continuous sophistication for breast cancer diagnosis and treatment in the past few decades, breast cancer is still considered to be one the most prevalent type of cancer among females across the world [28]. Unfortunately, this is accompanied by adverse changes in psychosocial functioning, physical functioning, quality of life and body composition occurring after breast cancer chemotherapy [29]. At present, lncRNAs gives new hope to the diagnosis, pathogenesis and therapy of breast cancer through its potential in distinguishing the different stages of breast cancer and differentiating normal from tumorigenic tissue [30]. As such, our study investigated the role of LINC00968 in the resistance of breast cancer cells to chemotherapy. Collectively, the data revealed that LINC00968 contributed to the decrease in drug resistance of breast cancer cells by silencing WNT2 and thus, inhibiting the activation of the Wnt2/β-catenin signaling pathway. Initially, we found that LINC00968 was poorly expressed during breast cancer while WNT2 and β-catenin expression as well as β-catenin and GSK3β phosphorylation were markedly increased. A recent study demonstrated that LINC00968, one of the top 10 aberrantly expressed lncRNAs, was low in lung squamous cell carcinoma expression profile than the adjacent normal lung tissues [31]. Additionally, another similar work has shown that a lncRNA, i.e. lncRNA-GAS5, was also under-expressed in breast cancer cells [32]. LncRNA anti-differentiation noncoding RNA was also down-regulated in breast cancer, and enhances transforming growth factor-β-induced epithelial to mesenchymal transition and metastasis [33]. On the other hand, relative expression profiles of WNT2 were also documented to be elevated in cervical cancer and its abundance have a significant impact on positive parametrium, lymphovascular space involvement, tumor size and pelvic lymph node metastasis [34]. Another previous study in line with our current work also demonstrated relatively higher WNT2 expression in breast cancer, which may play an important role for breast cancer development and in turn, its treatment [35]. Lastly, axin1, phospho-β-catenin and GSK3β complex has been demonstrated to be associated with heat shock protein 90 α/β in the human MCF-7 epithelial breast cancer model [36]. In the present study, LINC00968 was confirmed to influence the transcription of the upstream promoter region of the encoded protein gene, thereby interfering with the expression of downstream genes. Mechanistically, LINC00968 regulated WNT2 expression via recruitment of transcriptional repressor HEY1 into WNT2 promoter. Moreover, lncRNA is reported to functionally regulate the transcription of gene by recruiting epigenetic silencing complexes into homology-containing loci in the genome [37]. It has been previously reported that another lncRNATCF7 was capable of recruiting the SWI/SNF complex to the TCF7 promoter to modulate its expression, resulting in Wnt signaling activation [27]. HEY1 was illustrated to act as a negative regulator of osteoblast maturation by interacting with Runx2, in which HEY1 abrogated the transcriptional activity of Runx2 in a competitive manner [38]. LINC00968 overexpression was also found to contribute to the reduced cell colony formation, migration and invasion abilities of breast cancer cells, while promoting cell apoptosis and suppressing growth of transplanted tumor of nude mice possibly via WNT2 silencing and restraining activation of the Wnt2/β-catenin signaling pathway. Concurrent with our findings, another study has demonstrated that cell apoptosis of MCF-7 human breast cancer is induced by silencing WNT1 [39]. Similarly, lncRNA colon cancer-associated transcript-1 was also found to be up-regulated in breast cancer and was highly associated with progression-free survival and overall survival of patients, which can also be used as prognostic biomarker for breast cancer treatment [40]. Breast cancer cell metastasis and proliferation were found to be inhibited by up-regulating lncRNA cancer susceptibility candidate 2 which thus suppressed the activation of transforming growth factor-β signaling pathway [41]. Additionally, MDA-MB-231 breast cancer cells growth was inhibited by epigallocatechin gallate by inhibiting the activation of the β-catenin signaling pathway [42]. More importantly, our findings suggest that either the overexpression of LINC00968 and or silencing of WNT2 could alleviate drug resistance of human breast cancer MCF-7 cells. Drug resistance happens when a heterogeneous tumor with different molecular profiles were treated with the same anti-cancer treatment regimen and not all respond positively to the drug [43]. Interestingly, lncRNA regulator of reprogramming (linc-ROR) has been associated with multidrug resistance in breast cancer such that up-regulated linc-ROR contributed to chemotherapy tolerance and invasion of breast cancer cells [2]. Additionally, overexpressed linc-ROR acts as a competitive endogenous RNA sponge in triple-negative breast cancer [6]. LncRNAH19 was also highly expressed in Dox-resistant and anthracycline-treated MCF-7 cells of breast cancer, which facilitates cancer cell resistance to paclitaxel and anthracyclines [44]. Lastly, previous evidence noted that the activation of Wnt pathway was related to acquired cell adhesion-mediated resistance of multiple myeloma cells to some conventional drugs including doxorubicin and lenalidomide [45].

Conclusions

Taken together, LINC00968 was found to be poorly expressed in breast cancer while WNT2 were relatively expressed at higher level. After a series of in vivo and in vitro experiments, it can be said that overexpressed LINC00968 contributes in reducing drug resistance in breast cancer by silencing WNT2 via recruitment of HEY1 and in turn, the inhibition of the Wnt2/β-catenin signaling pathway (Fig. 8). However, due to the limitations in instruments and techniques for fluorescence observation in nude mice as well as a lack of additional funds, we did not investigate the effects of LINC00968 and WNT2 in vivo. But we will further validate the obtained results through performing in vivo experiment if subsequent funds and conditions permit. On the whole, these finding may open novel chapters for the future of breast cancer treatments.
Fig. 8

LINC00968 was lowly expressed, whereas WNT2 was highly expressed in breast cancer tissues and cells. LINC00968 targeted and negatively regulated WNT2 via the transcriptional repressor HEY1. Overexpressed LINC00968 reduced drug resistance, migration, invasion and epithelial-mesenchymal transition of breast cancer cells through inhibiting the activation of the Wnt2/β-catenin signaling pathway via suppression of WNT2

LINC00968 was lowly expressed, whereas WNT2 was highly expressed in breast cancer tissues and cells. LINC00968 targeted and negatively regulated WNT2 via the transcriptional repressor HEY1. Overexpressed LINC00968 reduced drug resistance, migration, invasion and epithelial-mesenchymal transition of breast cancer cells through inhibiting the activation of the Wnt2/β-catenin signaling pathway via suppression of WNT2
  42 in total

1.  Breast cancer statistics, 2015: Convergence of incidence rates between black and white women.

Authors:  Carol E DeSantis; Stacey A Fedewa; Ann Goding Sauer; Joan L Kramer; Robert A Smith; Ahmedin Jemal
Journal:  CA Cancer J Clin       Date:  2015-10-29       Impact factor: 508.702

2.  lincRNA-RoR and miR-145 regulate invasion in triple-negative breast cancer via targeting ARF6.

Authors:  Gabriel Eades; Benjamin Wolfson; Yongshu Zhang; Qinglin Li; Yuan Yao; Qun Zhou
Journal:  Mol Cancer Res       Date:  2014-09-24       Impact factor: 5.852

3.  Long non-coding RNA LINC00968 acts as oncogene in NSCLC by activating the Wnt signaling pathway.

Authors:  Yíng Wang; Jun Zhou; Yu-Jun Xu; Hai-Bo Hu
Journal:  J Cell Physiol       Date:  2017-10-27       Impact factor: 6.384

Review 4.  American Cancer Society/American Society of Clinical Oncology Breast Cancer Survivorship Care Guideline.

Authors:  Carolyn D Runowicz; Corinne R Leach; N Lynn Henry; Karen S Henry; Heather T Mackey; Rebecca L Cowens-Alvarado; Rachel S Cannady; Mandi L Pratt-Chapman; Stephen B Edge; Linda A Jacobs; Arti Hurria; Lawrence B Marks; Samuel J LaMonte; Ellen Warner; Gary H Lyman; Patricia A Ganz
Journal:  CA Cancer J Clin       Date:  2015-12-07       Impact factor: 508.702

5.  Linc-ROR induces epithelial-mesenchymal transition and contributes to drug resistance and invasion of breast cancer cells.

Authors:  Yao-Min Chen; Yu Liu; Hai-Yan Wei; Ke-Zhen Lv; Peifen Fu
Journal:  Tumour Biol       Date:  2016-02-16

6.  Long noncoding RNA H19 indicates a poor prognosis of colorectal cancer and promotes tumor growth by recruiting and binding to eIF4A3.

Authors:  Dong Han; Xu Gao; Meng Wang; Yu Qiao; Ya Xu; Jing Yang; Nazhen Dong; Jun He; Qian Sun; Guixiang Lv; Changqing Xu; Ji Tao; Ning Ma
Journal:  Oncotarget       Date:  2016-04-19

7.  Enrichment of CD44 in basal-type breast cancer correlates with EMT, cancer stem cell gene profile, and prognosis.

Authors:  Hanxiao Xu; Yijun Tian; Xun Yuan; Yu Liu; Hua Wu; Qian Liu; Gen Sheng Wu; Kongming Wu
Journal:  Onco Targets Ther       Date:  2016-01-21       Impact factor: 4.147

8.  Oncogenic long noncoding RNA landscape in breast cancer.

Authors:  Shouping Xu; Dejia Kong; Qianlin Chen; Yanyan Ping; Da Pang
Journal:  Mol Cancer       Date:  2017-07-24       Impact factor: 27.401

Review 9.  Prognostic significance of tumor-associated macrophages in breast cancer: a meta-analysis of the literature.

Authors:  Xixi Zhao; Jingkun Qu; Yuchen Sun; Jizhao Wang; Xu Liu; Feidi Wang; Hong Zhang; Wen Wang; Xingcong Ma; Xiaoyan Gao; Shuqun Zhang
Journal:  Oncotarget       Date:  2017-05-02

10.  A potential prognostic long non-coding RNA signature to predict metastasis-free survival of breast cancer patients.

Authors:  Jie Sun; Xihai Chen; Zhenzhen Wang; Maoni Guo; Hongbo Shi; Xiaojun Wang; Liang Cheng; Meng Zhou
Journal:  Sci Rep       Date:  2015-11-09       Impact factor: 4.379

View more
  25 in total

1.  Long non-coding RNA LINC00968 reduces cell proliferation and migration and angiogenesis in breast cancer through up-regulation of PROX1 by reducing hsa-miR-423-5p.

Authors:  Xianfu Sun; Tao Huang; Chengjuan Zhang; Shengze Zhang; Yingjie Wang; Qiang Zhang; Zhenzhen Liu
Journal:  Cell Cycle       Date:  2019-06-29       Impact factor: 5.173

Review 2.  Long Non-Coding RNAs in the Cell Fate Determination of Neoplastic Thymic Epithelial Cells.

Authors:  Alessia Iaiza; Claudia Tito; Federica Ganci; Andrea Sacconi; Enzo Gallo; Silvia Masciarelli; Giulia Fontemaggi; Alessandro Fatica; Enrico Melis; Vincenzo Petrozza; Federico Venuta; Mirella Marino; Giovanni Blandino; Francesco Fazi
Journal:  Front Immunol       Date:  2022-04-22       Impact factor: 8.786

3.  Long Non-coding RNA LINC02195 as a Regulator of MHC I Molecules and Favorable Prognostic Marker for Head and Neck Squamous Cell Carcinoma.

Authors:  Hao Li; Hong-Gang Xiong; Yao Xiao; Qi-Chao Yang; Shao-Chen Yang; Hong-Chao Tang; Wen-Feng Zhang; Zhi-Jun Sun
Journal:  Front Oncol       Date:  2020-05-06       Impact factor: 6.244

4.  Identification and Validation of an Immune-Related RNA Signature to Predict Survival of Patients With Head and Neck Squamous Cell Carcinoma.

Authors:  Shuo Wu; Xinyi Dai; Dielai Xie
Journal:  Front Genet       Date:  2019-12-04       Impact factor: 4.599

Review 5.  Long Non-Coding RNA: Dual Effects on Breast Cancer Metastasis and Clinical Applications.

Authors:  Qi-Yuan Huang; Guo-Feng Liu; Xian-Ling Qian; Li-Bo Tang; Qing-Yun Huang; Li-Xia Xiong
Journal:  Cancers (Basel)       Date:  2019-11-16       Impact factor: 6.639

6.  Identification of a Ferroptosis-Related LncRNA Signature as a Novel Prognosis Model for Lung Adenocarcinoma.

Authors:  Lu Lu; Le-Ping Liu; Qiang-Qiang Zhao; Rong Gui; Qin-Yu Zhao
Journal:  Front Oncol       Date:  2021-06-23       Impact factor: 6.244

7.  Correction to: Long non-coding RNA LINC00968 attenuates drug resistance of breast cancer cells through inhibiting the Wnt2/β-catenin signaling pathway by regulating WNT2.

Authors:  Dian-Hui Xiu; Gui-Feng Liu; Shao-Nan Yu; Long-Yun Li; Guo-Qing Zhao; Lin Liu; Xue-Feng Li
Journal:  J Exp Clin Cancer Res       Date:  2021-06-22

Review 8.  The network of non-coding RNAs and their molecular targets in breast cancer.

Authors:  Francesca Crudele; Nicoletta Bianchi; Eva Reali; Marco Galasso; Chiara Agnoletto; Stefano Volinia
Journal:  Mol Cancer       Date:  2020-03-18       Impact factor: 27.401

9.  Analysis of lncRNA-mRNA networks after MEK1/2 inhibition based on WGCNA in pancreatic ductal adenocarcinoma.

Authors:  Jing Qian; Jianxin Yang; Xianchen Liu; Zhiming Chen; Xiaodi Yan; Hongmei Gu; Qiang Xue; Xingqin Zhou; Ling Gai; Pengpeng Lu; Yu Shi; Ninghua Yao
Journal:  J Cell Physiol       Date:  2019-10-03       Impact factor: 6.384

10.  Identification and Characterization of Non-Coding RNAs in Thymoma.

Authors:  Guanglei Ji; Rongrong Ren; Xichao Fang
Journal:  Med Sci Monit       Date:  2021-07-05
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.