| Literature DB >> 30787918 |
Liang Hong1, Whee-Soo Kim1, Sang-Mok Lee1, Sang-Kee Kang2, Yun-Jaie Choi1,3, Chong-Su Cho1,3.
Abstract
Synbiotics, which are the combination of probiotics and prebiotics, have recently attracted attention because of their synergistic net health benefits. Probiotics have been used as alternatives to antibiotics. Among the probiotics, Lactobacillus plantarum (LP) has shown strong antimicrobial activity againstEntities:
Keywords: internalization; plantaricin; prebiotics; probiotics; pullulan nanoparticles
Year: 2019 PMID: 30787918 PMCID: PMC6372531 DOI: 10.3389/fmicb.2019.00142
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primers used in this study.
| Gene | Primer sequence (5′-3′) | Size (bp) |
|---|---|---|
| planS | F:GCCTTACCAGCGTAATGCCC | 450 |
| R:CTGGTGATGCAATCGTTAGTTT | ||
| dnaK | F:ATTAACGGACATTCCAGCGG | 600 |
| R:TTGGCCTTTTTGTTCTGCCG | ||
| dnaJ | F:GGAACGAATGGTGGCCCTTA | 474 |
| R:CTAGACGCACCCACCACAAA | ||
FIGURE 1Chemical reaction scheme for the synthesis of PPNs (PPNs: phthalyl pullulan nanoparticles).
FIGURE 2Characteristics of PPNs. Calculation of mol.-% phthalic acid in PPNs by 1H-NMR spectroscopy (A). Measurement of the zeta potential of PPNs by ELS (B) and size by DLS (C). Morphologies of PPNs observed by SEM (D). Magnification: 100,00K, scale bar = 100 nm. (PPNs: phthalyl pullulan nanoparticles, H-NMR: nuclear magnetic resonance, ELS: electrophoretic light scattering, DLS: dynamic light scattering, SEM: scanning electron microscope).
FIGURE 3Analysis of the internalization of PPNs by LP. FITC-PPNs are shown in green, and LP was stained blue with DAPI. The internalization of PPNs after 2 h of treatment was quantified by FACS and statistically analyzed. Z-section images show the internalization of corresponding PPNs into LP (A). Analysis of the internalization of PPNs by LP depending on transporters (B). LP, pre-incubated with 10% (w/v) glucose, fructose, galactose or PPN3 was treated with 0.5% (w/v) FITC-PPN3 for 2 h at 37°C, and internalization was observed by CLSM and FACS. Confocal and FACS data are representative of three independent experiments, and the average values are presented as the mean ± SEM of three independent FACS experiments in a bar chart. Statistical significance was analyzed between each group by one-way ANOVA and Tukey’s t-test (∗∗∗p < 0.001). Scale bar = 10 μm. (LP: Lactobacillus plantarum, PPN: phthalyl pullulan nanoparticle, CLSM: confocal laser scanning microscopy, FACS: fluorescence-activated cell sorting, FITC: fluorescein isothiocyanate, DAPI: 4′,6-diamidino-2-phenylindole).
FIGURE 4Antimicrobial efficacy of LP/PPNs against E. coli and LM (A-D). LP treated with PPNs or pullulan were cultured with Gram-negative E. coli or Gram-positive LM, and the growth inhibition was calculated by CFU for E. coli (A) and LM (C). Similarly, the diameters of the growth inhibition of E. coli (B) and LM (D) on LB and BHI agar plates, respectively, were measured. Data are presented as the mean ± SEM of three independent experiments. Statistical significance was analyzed between LP treated with P and LP treated with PPNs by one-way ANOVA and Tukey’s t-test (∗∗p < 0.01 and ∗∗∗p < 0.001). (LP: Lactobacillus plantarum, PPN: phthalyl pullulan nanoparticle, P: pullulan, CFU: colony forming unit, LM: Listeria monocytogenes, LB: lysogeny broth, BHI: brain heart infusion).
FIGURE 5Analysis the mechanism of enhanced antimicrobial ability. Measurement of the growth of LP (A) and pH of the culture medium (B) among LP groups with internalized PPNs or pullulan. Antimicrobial efficacy of LP/PPNs against E. coli (C) and LM (D) was measured after proteinase K treatment. Relative mRNA expression levels of planS compared with 16S rRNA expression levels (E). The isolated plantaricin was determined by SDS–PAGE (F). The full length gel is presented in Supplementary Figure S4. Data are presented as the mean ± SEM of three independent experiments. Statistical significance was analyzed between each group by one-way ANOVA and Tukey’s t-test (∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001). (LP: Lactobacillus plantarum, PPN: phthalyl pullulan nanoparticle, P: pullulan, PK: proteinase K, LM: Listeria monocytogenes, SDS–PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis).
FIGURE 6Analysis of genes related to the stress response in LP treated with PPNs. The expression levels of dnaK (A) and dnaJ (B) relative to 16s rRNA was quantified by qRT-PCR. Data are presented as the mean ± SEM of three independent experiments. Statistical significance was analyzed between LP and other groups by one-way ANOVA and Tukey’s t-test (∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001). (LP: Lactobacillus plantarum, PPN: phthalyl pullulan nanoparticle, P: pullulan, dnaK, dnaJ: heat shock proteins, qRT-PCR: quantitative real-time polymerase chain reaction).