| Literature DB >> 30769426 |
O Kúdela1, M Kúdelová1, S Nováková1, M Glasa1.
Abstract
The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5' GAGAGCAATACTGCGTGTACG 3' and WS-8909R 5' GCATAATGGCTCGAAGTGATG 3') designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.Entities:
Year: 2008 PMID: 30769426 DOI: 10.1094/PDIS-92-9-1365C
Source DB: PubMed Journal: Plant Dis ISSN: 0191-2917 Impact factor: 4.438