Literature DB >> 30754437

First Report of Squash leaf curl virus in Squash (Cucurbita pepo), Melon (Cucumis melo), and Cucumber (Cucumis sativa) in the Northern West Bank of the Palestinian Authority.

M S Ali-Shtayeh1, R M Jamous1, E Y Husein1, M Y Alkhader1.   

Abstract

In the summers and falls of 2008 and 2009, cucurbit plants (squash, Cucurbita pepo L.; cucumber, Cucumis sativus L.; and melon, Cucumis melo L.) from 23 of 33 cucurbit fields surveyed at three districts (Jenin, Nablus, and Tulkarm) in the West Bank of the Palestinian Authority exhibited curled, blistered, yellowed, and mottled leaves and small deformed fruits. Disease incidence ranged from 24 to 100% and was associated with whitefly (Bemesia tabaci) infestation. In symptomatic leaves of 94 plants (89 squash, 3 cucumber, and 2 melon) of 208 plants examined, geminiviral DNA was detected by PCR and rolling circle amplification (1). Geminivirus DNA-A and DNA-B component fragments were amplified by PCR using degenerate primers PAL1v1978/pPAR1c496, for DNA-A component and PBL1v2040l/PCRc1 for DNA- B component (4). A fragment from DNA-A was amplified using specific primers for DNA-A: SLCVSTCF1F (ATAATCTAGACCATGGGGTGTCCTCTCAACTTTCTCA) and SLCVSTCF3R (ATATGGATCCATTTAAATTCTTCACAAAGCGTTCCTG) and the generated PCR product was sequenced. A DNA-A fragment (922 bp) from a conserved region of the coat protein (AV1) gene showed 98, 98, 97, and 96% nucleotide identity with sequences of Squash leaf curl virus (SLCV) isolates from Jordan (GenBank Accession No. EF532620), Egypt (DQ285019), California (DQ285016), and Arizona (AF256203), respectively. Nonviruliferous whiteflies were allowed to feed on symptomatic cucurbit plants for 48 h. The whiteflies were then transferred to 30 healthy squash seedlings at the first-leaf stage and given a 48-h inoculation access period. Typical SLCV symptoms developed in these plants 9 to 10 days postinoculation (1). Until recently, SLCV was restricted to North America; however, in 2003, the first record on its occurrence in the Middle East was in Israel where it caused severe epidemics and disease incidence reached 100% (2). In 2006, the virus was reported to cause the severe symptoms observed in squash fields in Egypt (3). More recently, in 2008, it was detected in all surveyed areas in Jordan and disease incidence reached 95% in squash samples collected from the Dir Alla area (1). The new emergent disease in the Palestinian Authority was detected in all surveyed squash fields located in the Jenin District, in an area (Al-Fara') about 25 km to the west of Dir Alla in Jordan. Only a few sporadic cases were found in cucumber fields (three isolates) in Tulkarm and in melon fields (two isolates) in Nablus. This indicates that the virus might have spread from Jordan via viruliferous whiteflies or seedlings. The virus endangers the production of squash in the affected areas to the point of becoming the limiting factor of growing squash in open fields. To our knowledge, this is the first report of a whitefly-transmitted geminivirus infecting cucurbits in the Palestinian Authority. References: (1) A. Al-Musa et al. J. Phytopathol. 156:311, 2008. (2) Y. Antignus et al. Phytoparasitica 31:415, 2003. (3) A. M. Idris et al. Plant Dis. 90:1262, 2006. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Entities:  

Year:  2010        PMID: 30754437     DOI: 10.1094/PDIS-94-5-0640B

Source DB:  PubMed          Journal:  Plant Dis        ISSN: 0191-2917            Impact factor:   4.438


  1 in total

1.  Identification of the Begomoviruses Squash Leaf Curl Virus and Watermelon Chlorotic Stunt Virus in Various Plant Samples in North America.

Authors:  Rafaela S Fontenele; Amulya Bhaskara; Ilaria N Cobb; Lucas C Majure; Andrew M Salywon; Jesús A Avalos-Calleros; Gerardo R Argüello-Astorga; Kara Schmidlin; Philippe Roumagnac; Simone G Ribeiro; Simona Kraberger; Darren P Martin; Pierre Lefeuvre; Arvind Varsani
Journal:  Viruses       Date:  2021-04-30       Impact factor: 5.048

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.