Literature DB >> 30746518

First Complete Genome Sequence of Cucurbit Aphid-Borne Yellows Virus from Pumpkin in the United States.

Vivek Khanal1, Akhtar Ali1.   

Abstract

Cucurbit aphid-borne yellows virus (CABYV) was first described in France in 1992 and since then has been reported in various parts of the world, including the United States. Here, we present the first complete genome sequence of a CABYV isolate (BL4) that was collected from pumpkin during the 2017 growing season in Oklahoma.

Entities:  

Year:  2019        PMID: 30746518      PMCID: PMC6368653          DOI: 10.1128/MRA.01448-18

Source DB:  PubMed          Journal:  Microbiol Resour Announc        ISSN: 2576-098X


ANNOUNCEMENT

Cucurbits are economically important cash crops in the United States and are mostly grown in the southern states, including Texas and Florida, which are the two major watermelon-producing states (1). CABYV belongs to the genus Polerovirus in the family Luteoviridae (2) and was first reported in France in 1992 (3). The virus causes yellowing and thickening of the older leaves in cucurbit plants and is often mistakenly attributed as a nutrient deficiency. Although the major veins of younger leaves would remain green after the infection, plant yield may be reduced (3). The virus is transmitted primarily by Aphis gossypii Glover and Myzus persicae Sulzer, and the transmission could be circulative, persistent, and nonpropagative (4, 5). CABYV has been reported from cucurbit crops across different climatic regions of the world such as temperate, Mediterranean, and subtropical (6), and no mechanical transmission has been reported (7). The main constraint for the management of diseases caused by members of Luteoviridae is that no effective strategy exists to cure plants after virus infection (8). It has been nearly two and half decades since the first report of CABYV in the United States (9); however, to our knowledge, no complete genome sequence of any CABYV isolate from the United States has been reported so far. In this work, we report the first complete genome sequence of a CABYV isolate collected from a grower’s field in Oklahoma. Previously, we reported CABYV for the first time from commercial cucurbit fields in Blaine County in Oklahoma (10). One of the dot-immunobinding assay (DIBA)-positive samples (10) against the CABYV antibody (designated as CABYV isolate BL4) was used in this work. Total RNA was extracted from the CABYV-infected leaf tissues of pumpkin (11). Seven pairs of overlapping primers were designed (Table 1) and synthesized commercially (IDT Technologies, USA) from the previous CABYV isolates available from GenBank. All seven genome fragments were amplified by reverse transcription-PCR (RT-PCR) with the respective primer pairs using total RNA as the template, as described previously (11). Both 5′ end and 3′ end rapid amplification of cDNA ends (RACE) was performed using a commercial kit (TaKaRa Bio, Inc., Japan). Expected PCR products were analyzed and confirmed on 1% agarose gels and cleaned with Exosap-IT (Affymetrix). Purified PCR products were directly sequenced in both directions using an Applied Biosystems 3130 instrument.
TABLE 1

Primers used in RT-PCR to amplify the complete genome of Cucurbit aphid-borne yellow virus

Primer namePrimer sequenceProduct size (nucleotides)
CABYVF1ACAAAAGATACGAGCGGGTGA665
CABYVR1GCAAGTCGCCAAAAATCCAA
CABYV F2AGAGAGTCTGCTCCACGTGA1,099
CABYV R2GAGACTGTGCGTCTCCACTT
CABYV F3CGACCGCCGAAACAACCG1,168
CABYVR3TGCTCATCCGTAGACAAGCC
CABYVF4AACAAGCGCGAGATAGCGTT998
CABYVR4CGCCTCCCTGCATTTTGATT
CABYVCP5ATGAATACGGCCGCGGCTAGAAATC600
CABYVCP5CTATTTCGGGTTCTGGACCTGGCA
CABYVF6AACGGATCTTCCTCGGTTGC1,320
CABYVR6CACTTTCTCGTCTCTTCGTC
CABYV F7CACAGCCCACCCGGACTATA544
CABYVR7ACACCGAAACGCCAGGGG
Primers used in RT-PCR to amplify the complete genome of Cucurbit aphid-borne yellow virus Nucleotide sequences of each genome fragment were confirmed and assembled using DNASTAR Lasergene 13 (Madison, WI) software. Sequences of all fragments were aligned using both Clustal W v2.1 (12) and Muscle v3.8.31 (13) alignment tools by joining overlapping sequences to generate the complete genome sequence of CABYV. After the alignment, the complete genome sequence of the CABYV BL4 isolate is 5,679 nucleotides long (G+C content, 49.8%). Nucleotide BLAST searches showed that the CABYV BL4 isolate shares 85% to 97% nucleotide and 81% to 96% amino acid sequence identities with the available CABYV complete genomes in the GenBank database. The highest nucleotide (97%) and amino acid (96%) sequence similarities were observed with a Chinese isolate (GenBank accession no. EU000535) (14).

Data availability.

The complete genome sequence of the CABYV BL4 isolate was deposited in GenBank under accession no. MK055337.
  1 in total

1.  High Prevalence of Three Potyviruses Infecting Cucurbits in Oklahoma and Phylogenetic Analysis of Cucurbit Aphid-Borne Yellows Virus Isolated from Pumpkins.

Authors:  Vivek Khanal; Harrington Wells; Akhtar Ali
Journal:  Pathogens       Date:  2021-01-08
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.