| Literature DB >> 30735014 |
Sargol Abdolahi1, Borhan Shokrollahi1, Nazila Saadati2, Salim Morammazi3.
Abstract
Melatonin is the main hormone of seasonal breeding in sheep and goat which has an effect on reproductive organs via its receptors. Studies have shown that mutations in melatonin receptor 1A (MTNR1A) gene are related to litter size as well as the ovulation rate in sheep and goats. In this study, polymorphism of two loci in MTNR1A melatonin receptor gene was studied in order to survey their relationship with litter size in Markhoz goats. PCR primers were employed to mask polymorphisms of MTNR1A in 150 does by PCR-RFLP method. After DNA extraction, the PCR-RFLP was performed using Ecol31I and HpaI restriction enzymes. Results showed that these loci were not polymorphic. These results show that the fecundity of Markhoz goats is not linked to MTNR1A. No polymorphism in MTNR1A was found in Markhoz goats, therefore, it is essential to test polymorphism of other genes or loci to facilitate marker-assisted selection techniques to improve reproduction traits in Markhoz goats.Entities:
Keywords: MTNR1A receptor; Markhoz goat; melatonin; polymorphism
Mesh:
Substances:
Year: 2019 PMID: 30735014 PMCID: PMC6498522 DOI: 10.1002/vms3.146
Source DB: PubMed Journal: Vet Med Sci ISSN: 2053-1095
Primer sequence, annealing temperature and restriction enzyme
| Mutation | Primer sequence (5′–3′) | Annealing temperature | Region of the gene | Restriction enzyme |
|---|---|---|---|---|
| MTNR1A1 | Forward: GCCTGGCAGTTGCAGACCTG | 175–1030 | ||
| Reverse: CATTTTTAAACGGAGTCCACC | 57 | Acc. No: AB716764.1 |
| |
| MTNR1A2 | Forward: AGCTCAGCCTACACGATCGC | 522–725 | ||
| Reverse: CCAGCAAATGGCAAAGAGGAC | 52 | Acc. No: AB716764.1 |
|
Figure 1An agarose gel electrophoretogram for MTNR1A1 locus product digested with Eco31I showing genotypes in Markhoz goats. All individuals show wild type allele (uncut) with 856 bp in length.
Figure 2An agarose gel electrophoretogram for MTNR1A2 locus product digested with HpaI showing genotypes in Markhoz goats. All individuals show wild type allele (uncut) with 268 bp in length.