| Literature DB >> 30722248 |
S Khankhum1, P Bollich1, R A Valverde1.
Abstract
Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3'), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.Entities:
Year: 2013 PMID: 30722248 DOI: 10.1094/PDIS-10-12-0933-PDN
Source DB: PubMed Journal: Plant Dis ISSN: 0191-2917 Impact factor: 4.438