Mahboube Ahmadi1, Masoud Golalipour2,3, Nader M Samaei3. 1. Department of Biology, School of Basic Sciences, Golestan University, Gorgan, Iran. 2. Cellular and Molecular Research Center, Golestan University of Medical Sciences, Gorgan, Iran. 3. Department of Medical Genetics, Faculty of Advanced Medical Technologies, Golestan University of Medical Sciences, Gorgan, Iran.
Mitochondria are the hub of cellular metabolism in which fatty acid, NADH and FADH are converted into ATP via Oxidative Phosphorylation (OXPHOS). Respiratory function of mitochondria in human tissues such as muscle fibers, brain cells, liver and skin, decrease with age [1, 2]. The age-related decrease in the respiratory enzymes activities was also reported in fly, rats, dogs and monkeys [3, 4]. Because of the crucial role of mtDNA in the OXPHOS, accumulation of mtDNA mutations may contribute to aging phenotype [5, 6]. Furthermore, the age-associated decrease in mitochondrial energy production can lead to higher Reactive Oxygen Species (ROS) formation and mtDNA mutations in aged tissues, creating a vicious cycle of mutagenesis that amplifies the production of free radicals [2, 7, 8]. Mutant mtDNA was reported to accumulate with time in cultured cell [9]. mtDNA mutations progressively accumulate with age [10] in a variety of human and mice cells [11], and show a tissue-specific variation [12]. In differentiated tissues with active oxidative metabolism, such as skeletal muscle, heart, and brain, a higher level of mutant mtDNA accumulate during the aging process [13-15]. In contrast, in rapidly dividing cells the mtDNA mutation level gradually decreases with time. For example, cancerous tissues present a lower frequency in mtDNA deletion than adjacent non-cancerous tissue [16] as well as in progenitor cells [17]. The mitochondrial common deletion (ΔmtDNA4977) is a large-scale 4997 base pair deletion spanning ATPase 8 to ND5 [18]. The ΔmtDNA4977 causes loss of nearly one-third of mtDNA genome [19]. The clinical features associated with ΔmtDNA4977 has been reported in several sporadic diseases including Alzheimer’s disease, Pearson’s syndrome, skin photo-aging, Kearns-Sayre syndrome and chronic progressive external ophthalmoplegia [16]. Alterations in mitochondrial function due to ΔmtDNA4977 accumulate in tissues during aging and have been used as an indicator of mtDNA oxidative damage and ROS production [20]. Furthermore, ROS production is considered a probable mechanism in the pathogenesis and development of many diseases, including obesity and metabolic syndrome [21]. Obesepeople display elevated levels of systemic oxidative stress and adipose tissue represents an important source of ROS [22]. In this study, we compared the ΔmtDNA4977 level in overweighed cases to normal controls, taking into account age, gender, LDL and HDL. We hypothesized that age and BMI level are two ROS producing factors, which have additive effects on mtDNA deletion level. Therefore, subjects with higher BMI and more chronological age would show a higher level of ΔmtDNA4977.
MATERIALS AND METHODS
Participants
In this case-control study, we selected 172 subjects from Golestan Province, Iran. Participants were between 10 and 80 years old. Samples younger or older than this age range were excluded. The participants had no apparent mitochondrial diseases. The Ethics Committee approved the study protocol and informed consent was obtained from participants before blood sample collection. We recorded personal information including age, sex and BMI for all participants.
Anthropometric Measurements
Using a digital scale, the participants’ weight was measured with a precision of 0.1 kg. Height was measured in centimeters with an accuracy of a decimal point. The subjects were divided into three categories according to Body Mass Index (BMI): Normal (18.5 < BMI ≤ 24.9), overweight (25 < BMI ≤ 30) and obese (BMI > 30). LDL and HDL levels were measured and 2.5 ml of blood was stored in a refrigerator at 4°C for DNA extraction.
Genotyping
Genomic DNA was extracted from the whole blood using phenol-chloroform method. To detect low levels of the 4977 bp deletion, nested PCR analysis was performed. Two pairs of nested primers for detection of the 4977 bp deletion were; 1F: AACCACAGTTTCATGCCCATC; 1R: TGTTAGTAAGGGTGGGGAAGC for first and 2F: ACCCTATT GCACCCCCTCTAC; and 2R: CTTGTCAGG G AGGTAG CGATG for second PCR rounds. PCR carried out in 25 µl reaction volume containing each primer 1 μM, 2.5 μM enzyme buffer, 2 μM Mgcl2, 1 μM dNTP mix and, 0.2 μM Tag enzyme. Then, the extracted DNA was added to 1 μM in 25 μl total volume (all materials from TaKaRa, Seoul, Korea). The PCR condition for each round was set as initial denaturation at 94°C for 5 min; then 30 cycles at 94°C for 30 s, 55°C for 45 s and 72°C for 60 s; and a final extension at 72°C for 10 min. PCR products were electrophoresed on a 2% agarose gel and verified by sequencing.
Statistical Analysis
SAS JMP (JMP®, Version 11. SAS Institute Inc., Cary, NC, 1989-2007.) was used for data analysis. Logistic regression and contingency table were used to evaluate the relationship between ΔmtDNA4977 with Age, Gender, BMI, LDL and HDL. Matrix of interaction plots was generated to test possible interaction effects among age, gender, BMI and ΔmtDNA4977 in the proposed model. A p-value of 0.05 was considered as the threshold of significance level for each test.
RESULTS
One hundred and seventy-two samples were studied. The presence of deletion was indicated by the appearance of a 474 bp band after the first round of PCR and 358 bp band after the second round of PCR. Wild-type mtDNA did not yield any PCR product because of the large flanking region (>5-kb) Fig. ().Tables shows patient’s characteristics. Totally, 93 (54.06%) samples showed ΔmtDNA4977. The deletion was more abundant in female than male (p-value <0.0001). ΔmtDNA4977 was observed in 19 normal, 45 overweight and 29 obese individuals. Although the rate of deletion increases with BMI, there is no significant correlation between deletion level and BMI score (Table ). There was no significant correlation between ΔmtDNA4977 and serum lipoproteins. However, age showed a significant relationship with deletion (Table ).BMI score showed a significant association with age, LDL and HDL. Regression analysis Fig. () showed that BMI level decreases gradually with age in all cases (p value=0.0357). Furthermore, ΔmtDNA4977 and age have a significant correlation Fig. () so that, deletion level decreases with age (p value=0.0225). However, interaction profiles did not confirm any direct interactions among age, BMI, gender and ΔmtDNA4977 level in the participants.
DISCUSSION
The free radical theory which proposes that ROS produced by mitochondria produces mtDNA mutation and leads to aging is more than 60 years old [23]. The mtDNA deletion gives replication advantage to defected mitochondria. Therefore, the reduced size of mtDNA increases the rate of replication and the proportion of mutant mitochondria during time. Therefore, we assume that mutation and aging processes strengthen each other, and the rate of ΔmtDNA4977 increases with age.Contrary to expectations, our results indicated that the ΔmtDNA4977 level in blood significantly decreases with age. The accumulation of ΔmtDNA4977 with age is observed in non-dividing post-mitotic tissues such as brain, heart, muscle and eye [20, 24-26]. The findings with respect to blood as fast replicating tissue are controversial. Several studies have reported that ΔmtDNA4977 increases with age [27-29] whereas other studies have found that this deletion is not age-dependent [30-34]. The discrepancy might be due to experimental differences related to the other lifestyle and environmental parameters. Lifestyle factors including alcohol consumption, smoking and dietary components have been reported to have harmful or beneficial effects on mtDNA [28, 35, 36]. Lifestyle affects body composition, so BMI may represent the mutual effects of lifestyle factors [37].Our results showed that although the ΔmtDNA4977 has no significant relationship with BMI, both factors were concordantly decreased with age. It may suggest that chronological age and BMI have additive effects on mtDNA mutation level in post-mitotic tissues (Fig. ). According to the proposed model, the chronological age regulates the ΔmtDNA4977 level in two ways. Firstly, BMI decreases with age, therefore, the amount of ROS and consequently ΔmtDNA4977 will be reduced. Secondly, blood cells must be continuously replaced throughout life. Hence, cells with reduced levels of mutant mtDNA are selected as a result of purifying selection [38]. Purifying selection is a mitochondrial quality control mechanism which removes damaged mitochondria via mitophagy [36, 37, 39, 40]. Therefore, cells with ΔmtDNA4977 will be replaced by cells without deletion and trigger a decline in mtDNA deletion level during time.
CONCLUSION
Our data suggest that age affects purifying selection and BMI, which may influence the relative level of ΔmtDNA4977 in blood cells. Future studies are needed to evaluate to what extent the level of ΔmtDNA4977 is controlled by lifestyle parameters.
Table 1
The genotype of ΔmtDNAand patient characteristics.
Authors: Yevgenya Kraytsberg; Elena Kudryavtseva; Ann C McKee; Changiz Geula; Neil W Kowall; Konstantin Khrapko Journal: Nat Genet Date: 2006-04-09 Impact factor: 38.330
Authors: Kevin R Short; Maureen L Bigelow; Jane Kahl; Ravinder Singh; Jill Coenen-Schimke; Sreekumar Raghavakaimal; K Sreekumaran Nair Journal: Proc Natl Acad Sci U S A Date: 2005-03-30 Impact factor: 11.205
Authors: S A Mohamed; D Wesch; A Blumenthal; P Bruse; K Windler; M Ernst; D Kabelitz; M Oehmichen; C Meissner Journal: Exp Gerontol Date: 2004-02 Impact factor: 4.032
Authors: Lovro Štefan; Marko Čule; Ivan Milinović; Dora Juranko; Goran Sporiš Journal: Int J Environ Res Public Health Date: 2017-08-08 Impact factor: 3.390