Literature DB >> 30708923

First Report of Leaf Blotch Caused by Pestalotiopsis clavispora on Rosa chinensis in China.

Y R Feng1, B S Liu1, B B Sun1.   

Abstract

Rosa chinensis Jacq, a traditional Chinese ornamental flower, is an important landscaping plant in northern China. Since July 2013, leaf blotch symptoms were observed in the Tianjin flower nursery (117°09' E 39°17' N). The garden exhibited 40% disease incidence with observable symptoms on basal leaves that were yellowed from the edge to the inside area on infected leaves, in the shape of a V. Yellow lesions covered one third to one half of the leaf. Yellow halos were observed at the junction of the healthy and diseased tissues. Small tissue pieces from the edges of lesions were disinfected in 70% ethyl alcohol for 30 s and 1% hypochlorite for 1 min, rinsed thrice in sterile water, plated on potato dextrose agar (PDA), and incubated at 25°C in lighted incubator for 4 days. Fungal colonies that developed on PDA were white and cottony with concentric rings. Black and globular acervuli appeared after 10 days at 25°C. Conidia (n = 20), which were fusiform, were 9.20 to 31.31 (avg. 26.5) × 4.83 to 9.11 (avg. 6.9) μm. Conidia of all isolates were five celled. Apical and basal cells were colorless, while the three median cells were dark brown. The single basal appendage of conidia was 2.85 to 16.05 μm in length and the two to three apical appendages were 5.93 to 36.23 μm in length. According to colony and conidia morphology (number of cells, number of appendages), the isolates were initially identified as Pestalotiopsis spp (2). A 525-bp band was produced in a conventional PCR assay. Primers ITS1 (5'TCCGTAGGTGAACCTGCGC3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') were used to amplify and sequence the internal transcribed spacer region of rDNA. A BLAST search of the NCBI databases showed that isolate YJYK-1 had 99% homology with Pestalotiopsis clavispora isolate hz-067 (Accession No. FJ517545.1). Pathogenicity tests of the novel isolate YJYK-1 were conducted by placing agar plugs (5 mm in diameter) from an actively growing colony on PDA on surface-disinfected (70% ethyl alcohol, 30 s) leaves (1). Control leaves were inoculated with sterile PDA plugs. Plants with inoculated leaves (five per treatment) were placed in lighted growth chambers at 25°C for 10 days and watered as needed. Symptoms on inoculated leaves were similar to those previously described in the nursery. Black acervuli were easily found on the necrotic tissues. Control plants did not show any symptoms. Cultures isolated from the lesions were similar to those isolated previously from leaves in the nursery. Koch's postulates were confirmed after re-isolation. Although the diversity of endophytic Pestalotiopsis species and its distribution was investigated and the host plants were also listed in China (3), to our knowledge, this is the first report of P. clavispora causing leaf blotch on rose R. chinensis in China. References: (1) M. I. Ahmed et al. Eur. J. Plant Pathol. 135:619, 2013. (2) J. Y. Lu. Diagnosis of plant diseases. Page 194 in: Pestalotiopsis. J. Y. Lu et al., eds. China Agriculture Press, Beijing, 1995. (3) J. G. Wei et al. Mycosystema 24:481, 2005.

Entities:  

Year:  2014        PMID: 30708923     DOI: 10.1094/PDIS-01-14-0036-PDN

Source DB:  PubMed          Journal:  Plant Dis        ISSN: 0191-2917            Impact factor:   4.438


  1 in total

1.  Identification, pathogenicity and effects of plant extracts on Neopestalotiopsis and Pseudopestalotiopsis causing fruit diseases.

Authors:  Angwara Darapanit; Nattawut Boonyuen; Wiphawee Leesutthiphonchai; Salilaporn Nuankaew; Onuma Piasai
Journal:  Sci Rep       Date:  2021-11-19       Impact factor: 4.379

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.