Literature DB >> 30706682

The protective role of rs56103835 against breast cancer onset in the Iranian population.

Negin Naderi1, Maryam Peymani1, Kamran Ghaedi2.   

Abstract

BACKGROUND: Breast cancer is one of the most common types of cancer among women and the highest cause of death due to cancer among women aged 40-45. SNPs can be used to identify disease-related genes such as cancer as they can be genetic markers. Furthermore, SNPs in the molecular-level miRNA structure are also associated with a set of cancers. Studies have shown that miR-323b plays a tumor suppressor role by reducing the tissues and serum of the affected individuals. So far, no study regarding rs56103835 polymorphism in the precursor of miR-323b has been conducted in the breast cancer. In this study, the association of this SNP with the incidence of breast cancer in the Iranian population has been investigated.
METHOD: In order to correlate rs56103835 polymorphism with breast cancer, 161 patients and 162 healthy people as the control group were examined. They had been homogenized based on their age and gender. The genotype of individuals for the polymorphism was determined by the PCR-RFLP method. The association of this polymorphism with the risk of breast cancer, the age of the onset of disease, and pathological characteristics of the patients was then analyzed.
RESULTS: The findings showed that there is no significant correlation between the frequency of its genotypes among the healthy and patient populations while the TT genotype increased the age of the disease in patients, as compared to other genotypes (p = 0.035, OR = 0.487). DISCUSSION AND
CONCLUSION: The C allele is likely to inhibit the expression of BRCA2 by interfering with the processing of this pre-miRNA and increasing the expression of target genes such as BRCA2. Because one of the early onset genes in breast cancer is the BRCA2, the presence of any of C and T alleles can have a significant effect on the incidence of the disease. To further confirm this data, however, more molecular studies are needed.
© 2019 Islamic Azad University, Shahrekord Branch. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Entities:  

Keywords:  breast cancer; miR-323b; rs56103835 polymorphism

Mesh:

Substances:

Year:  2019        PMID: 30706682      PMCID: PMC6418365          DOI: 10.1002/mgg3.540

Source DB:  PubMed          Journal:  Mol Genet Genomic Med        ISSN: 2324-9269            Impact factor:   2.183


INTRODUCTION

Breast cancer is ranked as the most prevalent disease among women. It causes 16% of deaths among women, as well as being the first cause of cancer death in the women aged 45–40 (Sadjadi et al., 2003). Unlike many other diseases, such as infectious diseases, that have a particular cause, most cancers are often the consequences of several factors including genetic/epigenetic features and lifestyle factors (Ambrosone, Hong, & Goodwin, 2015). Recently, researchers have been interested in the role of microRNAs (miRNAs) and their polymorphism in breast cancer (Bachour & Bennett, 2011; Pipan, Zorc, & Kunej, 2015). It has been found that the abnormal expression of miRNAs may be related to the risk of cancer (Peng & Croce, 2016). Oncogenic miRNAs, commonly referred to as oncomirs, are usually deregulated in cancer cells whose targets are tumor suppressor genes such as miR‐21, miR‐96, and miR‐323 (Guttilla & White, 2009; Si et al., 2007). In contrast, tumor suppressor miRNAs (such as miR‐205, miR‐27b, and miR‐17–5p) are often expressed at lower levels in cancer cells, relative to the normal cells (Hossain, Kuo, & Saunders, 2006; Iorio, Ferracin, Liu, Veronese, & Spizzo, 2005; Tsuchiya, Nakajima, Takagi, Taniya, & Yokoi, 2006). Since these miRNAs act on genes that stimulate tumorigenicity (oncogenes), a decrease in their levels can increase the effects of oncogenes and the growth of cancer cells (Zhang, Pan, Cobb, & Anderson, 2007). Therefore, single nucleotide polymorphisms (SNPs) in the structure of these miRNA, called mirSNPs, may contribute to their deregulations, thereby contributing to the onset of cancer (Slaby, Bienertova‐Vasku, Svoboda, & Vyzula, 2012). mirSNPs may play an important role through their effect on the primary target gene transcription, the change of the pri‐miRNA/pre‐miRNA processing, or their interaction effects on miRNA‐mRNA (Ryan, Robles, & Harris, 2010). There are several data describing the association of rs1834306, rs2043556, rs3746444, rs4919510, rs2910164, rs11614913, rs895819, rs2292832, and rs6505162 with the risk of cancer (Hu et al., 2014). However, conclusions from the related studies have been inconsistent due to the heterogeneity of the type of cancer studied, the small size of the samples, and the different ethnicities of the patients. Therefore, there is the need to perform further research on the relation between cancer‐related mirSNPs and the risk of various types of cancer in each population. Although the identification of cancer‐related miRNAs has become increasingly popular on the basis of genetic link studies, research on the association of cancer‐related mirSNPs with the risk of various types of cancer has not yet been conducted (Hu et al., 2014). Previous studies have shown that the expression of miR‐323b in serum and tumor tissue in breast cancer patients is reduced and this miRNA can play a suppressor role in the tumor genes of breast cancer patients (Zhu, Zheng, Wang, Sun, & Wang, 2014). Based on database prediction for miRNA targets, via Targetscan database, it has been found that the BRCA2 gene is among the targets of miR‐323b. This gene is one of the early onset genes in breast cancer, with a remarkable expression effect on the early stages of breast cancer (Hedau et al., 2015; Narod, 2011). Regarding the importance of polymorphisms in miRNAs, this study examined the protective role of rs56103835 polymorphism in the miR‐323 encoding gene and its association with the incidence of breast cancer. This miRNA is located on chromosome 14 and at the position q32.31. The rs56103835 polymorphism is located on the immature segment of miR‐323, which is considered as a nucleotide substitution of adenine with cytosine. The aim of this study was, therefore, to determine the relationship between this polymorphism and the incidence and progression of breast cancer in the population of Isfahan, Iran.

MATERIALS AND METHODS

Ethical Issues and the consent form

All participants, who had been informed, agreed to take part in this study by signing a consent form. All protocols were carried out based on the relevant guide lines for human sampling, and ethical issues were confirmed by the ethical committee of Islamic Azad University of Shahrekord.

Patients and controls

This case–control study was performed on 161 samples of breast cancer patients against 162 healthy women matched for age. Control samples with any history of cancer were excluded. Information about the population studied is shown in Table 1. The clinical and pathological characteristics of the patients were collected from the hospital, as summarized in Table 1. Blood samples were collected in EDTA‐containing tubes. Genomic DNA extraction was carried out from the collected blood samples according to the Genetbio (Korea).
Table 1

Patients’ characteristics

VariablesNumbers
Age, years
≤4561
>4592
Grade
I19
II+III56
Stage
I+II30
III+IV41
Estrogen receptor
Positive72
Negative47
Her2, n
Positive63
Negative46
Progesterone receptor
Positive68
Negative49
Patients’ characteristics

SNP genotyping and sequencing

Genotyping was performed on rs56103835 by the PCR‐RFLP method. To summarize, forward and reverse primers were 5'‐TCATCCTCAGGGTCCCATCCAC‐3 'and 5'‐ TGTCCCCTAAATCGGCATCAGG‐3', respectively, as designed by Oligo7. PCR mixture consisted of 7.5 μL of Taq DNA Polymerase Master Mix RED (Ampliqon), 0.6 μL of each primer, and 1.5 μL of genomic DNA and 4.8 μL of ddH2O at a final 15 μL. PCR products (221 bp) were then subjected to NIaIII digestion at 37°C for 2 hr. In the presence of the C allele, there was no cut, whereas, in the presence of the T allele, the PCR product was cleaved to produce two fragments, 126 and 96 bp. To confirm the data obtained from genotyping, a number of samples from each of the homozygous and heterozygote genotypes were randomly assigned to sequencing through sending to Bioneer Co. (Korea). Sequencing results were analyzed by Chromas Lite software (version 2.0, Technelysium Pty. Ltd., Tewantin, Queensland, Australia).

Statistical analysis

Statistical analysis was performed using SPSS 26 software statistical package (IBM, Corp., Armonk, NY, USA). The categorical and continuous data were analyzed using chi‐square and t tests, respectively. The associations between genotypes and breast cancer were assessed by computing the odds ratio (OR) and 95% confidence intervals (CIs) from logistic regression analyses. p < 0.05 was considered as the significant difference between the samples.

Data source

miRNASNP database, version 2.0, was used to identify the polymorphisms related to miR‐323 and the selected rs56103835. We obtained the information about rs56103835, including its minor allele frequency and SNP 5'‐ and 3'‐flanking sequences, from the NCBI build 37.3 database, and got the SNP location from the 1,000 genome project. Using miRDB (http://www.mirdb.org/) and TargetScan (release 6.2, http://www.targetscan.org/) databases, we obtained the predictive targetome of rs56103835‐related miR‐323.

RESULTS

Optimization of PCR conditions with the designed primers and enzyme digestion to determine the genotype

In the study of subjects, they were amplified using the PCR technique and specific region primers containing polymorphism rs56103835. For the propagation and formation of a specific bond without the presence of a non‐specific bond, the 63°C binding temperature was selected. To identify the rs56103835 genotype in each individual, PCR products were treated with the NIaIII restriction enzyme. As shown in Figure 1, the fragments of 126 and 96 bp represented the genotype (TT), the fragments of 221, 126, and 96 bp stood for genotype (TC), and the fragments of 221 bp referred to the genotype (CC). The sequencing chromatogram results of the genotypes CC, TC, and TT for some of the samples confirmed the results of determining the genotype of the samples using the RFLP method (Figure 2).
Figure 1

Optimization of PCR conditions and enzyme digestion to determine the genotype. The PCR product with 221 bp was then subjected to NIaIII digestion at 37°C. In the presence of the C allele, products were 221 bp, and in the presence of the T allele, 126 bp and 96 bp were formed. Negative control (Con−) in this figure to show that lower bands are not primer dimer

Figure 2

Sequencing chromatograms of rs4541843. T > C, and the sequencing chromatogram results of the genotypes TT, CT, and CC, respectively. Samples were chosen randomly

Optimization of PCR conditions and enzyme digestion to determine the genotype. The PCR product with 221 bp was then subjected to NIaIII digestion at 37°C. In the presence of the C allele, products were 221 bp, and in the presence of the T allele, 126 bp and 96 bp were formed. Negative control (Con−) in this figure to show that lower bands are not primer dimer Sequencing chromatograms of rs4541843. T > C, and the sequencing chromatogram results of the genotypes TT, CT, and CC, respectively. Samples were chosen randomly

Frequency of rs56103835 variation

The frequency of genotype and the allelic frequency of rs56103835 polymorphism in the population of the patients with breast cancer and healthy people can be seen in Table 2. Investigating the relationship between different genotypes of rs56103835 polymorphism and the risk of breast cancer showed that there was no significant difference between the genotypes in the two healthy and patient populations, and none of the genotypes was observed in this polymorphism, as compared to the TT genotype, which was considered as the reference genotype; so, there was no significant relationship with breast cancer.
Table 2

Association of the rs56103835 T > C polymorphism and risk of breast cancer

rs4541843Case, n (%)Control, n (%)OR (95% CI) p‐value
Codominant
TT901011
TC61551.2450.353
CC1061.8700.243
Dominant
TT901011
TC+CC71611.3060.239
Recessive
TT+TC1401201
CC25411.7220.304
Allele
T2412571
C81670.7830.120

CI, confidence interval; OR, odds ratio.

Association of the rs56103835 T > C polymorphism and risk of breast cancer CI, confidence interval; OR, odds ratio. Given the dominance of allele C, the frequency of genotypes TC and CC in comparison to TT was calculated in the two healthy and patient populations, finding no significant correlation with the incidence of this disease at the level of <0.05. Given the dominance of the T allele, the frequency of total TC and TT genotypes in comparison to CC was calculated in the two healthy and patient populations and their association with breast cancer was studied. Interestingly, there was no significant correlation with the incidence of this disease at the level of <0.05. The findings, therefore, showed that this region could be a polymorphic region in the population and there was no significant correlation between the frequency of genotypes in the healthy and patient populations. Then, the association of the frequency of alleles with the risk of disease was investigated, showing no significant relationship with them (OR, 0.783; 95% CI, 0.576–1.066; p = 0.120). After that, the relation between different genotypes of polymorphism rs56103835 and the age of incidence of breast cancer was studied. According to Table 3, the results of this study showed that there was a significant correlation between the TC genotype of polymorphism rs56103835 and the age of the incidence of breast cancer in the patient population.This was in the sense that the genotypes TC significantly decreased the incidence of disease. On the other hand, the association of each of the alleles with the age of the disease was studied, showing that the presence of the C allele (OR, 0.635; p = 0.089) could decrease the incidence of the disease. These data, therefore, confirmed the effective association between allele C and the increased risk of breast cancer.
Table 3

Association of the rs56103835 T > C polymorphism and age of onset in breast cancer

Age of onset (years)≤45>45OR (95% CI) p‐value
Genotype
TT26551
TC29280.4560.028
CC460.7090.617
CC/TC33340.4870.035
Allele
T811381
C37400.6350.089
Association of the rs56103835 T > C polymorphism and age of onset in breast cancer

Correlation between rs56103835 T > C genotypes and the clinical characteristics of breast cancer patients

The relationship between different genotypes of rs56103835 polymorphism and histopathology features including ER +/−, PR +/−, and HER2 +/− was also studied in the patients with breast cancer; there was no significant correlation between the frequency of genotypes and the presence or absence of these factors in the infected people. These results have been summarized in Tables 3 and 4.
Table 4

Correlation between rs56103835 T > C genotypes and clinical characteristics of breast cancer patients

rs56103835 T > C genotype
VariablesTT TC CC p‐value
Age, years
≤45262940.085
>4555286
Grade, n
I10810.543
II+III37163
Stage, n
I+II131430.398
III+IV24152
Estrogen receptor, n
Positive422460.586
Negative24203
Her2, n
Positive362530.468
Negative26165
Progesterone receptor, n
Positive372740.730
Negative28164

HER2, human epidermal growth factor receptor 2.

Correlation between rs56103835 T > C genotypes and clinical characteristics of breast cancer patients HER2, human epidermal growth factor receptor 2.

Suggesting the possible roles of has‐miR‑323b in cancer signaling pathways with the Molecular signaling pathway enrichment analysis of has‐miR‑323b targetome

In order to understand how miR‐323b could be related to cancer, a molecular signaling pathway enrichment analysis was conducted. Moreover, the predicted targetome of miR‐323b with TargetScan database was found and used so as to conduct more molecular enrichment analysis. When official gene symbols of miR‐323b targetome were put into a functional annotation tool of DAVID database, ia statistically significant relation with KEGG signaling pathways was found; the most significant ones were in cancer pathways were such as TGF‐beta, ErbB, Cell cycle, p53, and Jak‐STAT signaling pathways (https://david-d.ncifcrf.gov/) (Table 5).
Table 5

The molecular pathway enrichment analysis of has‐miR‐323b

Kegg pathwayNumber of genes in the pathway p‐value
1Pathway in cancer686.3‐E4
2Melanoma211.3E−3
3Focal adhesion451.3E−3
4T‐cell receptor signaling pathway281.5E−3
5Insulin signaling pathway323.1E−3
6Adherens junction213.8E−3
7Type II diabetes mellitus153.9E−3
8Colorectal cancer224.9E−3
9Neurotrophin signaling pathway296.1E−3
10Chronic myeloid leukemia206.3E−3
11Renal cell carcinoma196.5E−3
12Ubiquitin mediated proteolysis317.3E−3
13TGF‐beta signaling pathway227.6E−3
14Adipocytokine signaling pathway189.3E−3
15ErbB signaling pathway211.5E−2
`16Endocytosis363.4E−2
17MAPK signaling pathway493.7E−2
18Pancreatic cancer173.8E−2
`19Cell cycle263.9E−2
20Small cell lung cancer194.0E−2
21RNA degradation144.8E−2
22Glioma155.0E−2
23Aldosterone‐regulated sodium reabsorption115.2E−2
24Acute myeloid leukemia145.5E−2
25Amyotrophic lateral sclerosis (ALS)135.9E−2
26Jak‐STAT signaling pathway306.0E−2
27Prostate cancer196.6E−2
28Cell‐adhesion molecules (CAMs)266.8E−2
29Biosynthesis of unsaturated fatty acids77.7E−2
30Valine,leucine, and isoleucine degradation117.9E−2
31Long‐term potentiation158.6E−2
The molecular pathway enrichment analysis of has‐miR‐323b

DISCUSSION AND CONCLUSION

In this study, first, the association of rs56103835 polymorphisms in the pre‐miR‐323b sequence with the risk of breast cancer was examined in a population of breast cancer in Isfahan, Iran. The findings showed that this region was a polymorphic one in the population and there was no significant correlation between the frequency of genotypes in the healthy and patient populations. It seemed that the effect of a miRNA‐related SNP depended on its intrinsic effect on its miRNA function as well as the role of miRNA in controlling the key genes involved in cancer. The desired polymorphism was a single‐nucleotide transformation T > C, such that the C allele was based on the dbSNP database as a risk allele and with a frequency of 30%. In this study, the frequency of this allele in both healthy and patient populations was 20% and 25%, respectively, the frequency of allele C in the total population was 22%, and there was no significant difference in the allele frequency between the control and patient populations. Also, there was no significant difference between the frequencies of genotypes in these two populations and each of the observed genotypes of this polymorphism, as compared to the TT genotype as the reference genotype in this population, showing no relation with a significant risk of breast cancer at the level of <0.05. The aim of this study was to investigate the relationship between different pathological parameters of the disease, including the presence or absence of estrogen receptor, progesterone, HER2 and stage disease, grade disease, metastasis, and mortality rate, with polymorphism rs56103835. There was no significant relationship between each of these parameters and the frequency of genotypes in the population of patients whose details of the parameters were available. Finally, the relationship between the age of the disease in the patients and the frequency of each of the genotypes was investigated, showing that the CT genotype of polymorphism rs56103835 with the age of the incidence of breast cancer was significantly correlated with the patient population (p = 0.028, OR = 0.0456). Considering the dominance of C allele, the frequency of the total CC and CT genotypes, in comparison to TT, in the patients was calculated based on the age of the patients’ incidence, and their association with the age of breast cancer was studied. The results showed that the TT genotype, in comparison to other genotypes, increased the age of the disease (p = 0.035, OR = 0.487). Then, the association of each allele with the age of the disease was also studied, showing that the presence of C alleles with p value = 0.08 could possibly provide a basis for reducing the incidence of disease. In this regard, Zhu and colleagues conducted research on the changes upon the expression of miR‐323b in the patients with breast cancer. They found that the expression of miR‐323b in serum and tumor tissue in breast cancer patients was reduced, showing that miRNA played a suppressive role in the tumor genes of breast cancer patients (Zhu et al., 2014). Based on the predictive databases for miRNA targets, including the Targetscan base, BRCA2 gene was identified as one of the miR‐182 targets. This gene could be considered as one of the early onset genes in breast cancer, with a significant expression in the early stages of breast cancer (Narod, 2011). Increasing the expression of this gene led to cancer progression (Montazeri, Sadighi, Farzadi, Maftoon, & Vahdaninia, 2008). By reducing the expression of miR‐323b, the targets of this miRNA could increase the expression in the target tissue, which can be referred to as BRCA2, thereby raising the expression of the gene, the age of the disease, and the progression of the disease. According to the results, the association of rs56103835 polymorphism with the incidence and progression of breast cancer for the first time was investigated; given that the desired polymorphism in the pre‐miR‐323b structure was predicted, the C allele probably inhibited BRCA2 expression by interfering with the processing of this pre‐miRNA, causing an increase in the expression of target genes such as BRCA2. Since one of the early onset genes in BRCA2 gene is breast cancer, the presence of any of the C and T alleles can have a significant effect on the incidence of disease. However, confirmation of this function of polymorphism requires more studies.

CONFLICT OF INTEREST

None declared.
  18 in total

1.  Early-onset breast cancer: what do we know about the risk factors?: A Countercurrents Series.

Authors:  S A Narod
Journal:  Curr Oncol       Date:  2011-10       Impact factor: 3.677

2.  MicroRNA regulates the expression of human cytochrome P450 1B1.

Authors:  Yuki Tsuchiya; Miki Nakajima; Shingo Takagi; Takao Taniya; Tsuyoshi Yokoi
Journal:  Cancer Res       Date:  2006-09-15       Impact factor: 12.701

3.  The Role of MicroRNAs in Breast Cancer.

Authors:  Tarek Bachour; Katie Bennett
Journal:  J Assoc Genet Technol       Date:  2011

4.  MicroRNA gene expression deregulation in human breast cancer.

Authors:  Marilena V Iorio; Manuela Ferracin; Chang-Gong Liu; Angelo Veronese; Riccardo Spizzo; Silvia Sabbioni; Eros Magri; Massimo Pedriali; Muller Fabbri; Manuela Campiglio; Sylvie Ménard; Juan P Palazzo; Anne Rosenberg; Piero Musiani; Stefano Volinia; Italo Nenci; George A Calin; Patrizia Querzoli; Massimo Negrini; Carlo M Croce
Journal:  Cancer Res       Date:  2005-08-15       Impact factor: 12.701

5.  Cancer occurrence in Ardabil: results of a population-based cancer registry from Iran.

Authors:  Alireza Sadjadi; Reza Malekzadeh; Mohammad H Derakhshan; Alireza Sepehr; Mehdi Nouraie; Masoud Sotoudeh; Abbas Yazdanbod; Behrooz Shokoohi; Afshin Mashayekhi; Shahnam Arshi; Ali Majidpour; Masoud Babaei; Alireza Mosavi; Mohammad Ali Mohagheghi; Masomeh Alimohammadian; Mohammad Ali Mohagheghi Mosavi
Journal:  Int J Cancer       Date:  2003-10-20       Impact factor: 7.396

6.  MicroRNA Polymorphisms in Cancer: A Literature Analysis.

Authors:  Veronika Pipan; Minja Zorc; Tanja Kunej
Journal:  Cancers (Basel)       Date:  2015-09-09       Impact factor: 6.639

Review 7.  Different miRNA expression profiles between human breast cancer tumors and serum.

Authors:  Jie Zhu; Zhibao Zheng; Jia Wang; Jinhua Sun; Pan Wang; Xianying Cheng; Lun Fu; Liming Zhang; Zuojun Wang; Zhaoyun Li
Journal:  Front Genet       Date:  2014-05-27       Impact factor: 4.599

8.  MicroRNA sequence polymorphisms and the risk of different types of cancer.

Authors:  Ye Hu; Chen-Yang Yu; Ji-Lin Wang; Jian Guan; Hao-Yan Chen; Jing-Yuan Fang
Journal:  Sci Rep       Date:  2014-01-13       Impact factor: 4.379

Review 9.  The role of MicroRNAs in human cancer.

Authors:  Yong Peng; Carlo M Croce
Journal:  Signal Transduct Target Ther       Date:  2016-01-28

10.  Weight, height, body mass index and risk of breast cancer in postmenopausal women: a case-control study.

Authors:  Ali Montazeri; Jila Sadighi; Faranak Farzadi; Farzaneh Maftoon; Mariam Vahdaninia; Mariam Ansari; Akram Sajadian; Mandana Ebrahimi; Shahpar Haghighat; Iraj Harirchi
Journal:  BMC Cancer       Date:  2008-09-30       Impact factor: 4.430

View more
  2 in total

1.  Evidences from a Systematic Review and Meta-Analysis Unveil the Role of MiRNA Polymorphisms in the Predisposition to Female Neoplasms.

Authors:  Milad Bastami; Jalal Choupani; Zahra Saadatian; Sepideh Zununi Vahed; Elaheh Ouladsahebmadarek; Yasser Mansoori; Abdolreza Daraei; Hossein Samadi Kafil; Bahman Yousefi; Mahdi Mahdipour; Andrea Masotti; Ziba Nariman-Saleh-Fam
Journal:  Int J Mol Sci       Date:  2019-10-14       Impact factor: 5.923

2.  Imbalance of Molecular Module of TINCR-miR-761 Promotes the Metastatic Potential of Early Triple Negative Breast Cancer and Partially Offsets the Anti-Tumor Activity of Luteolin.

Authors:  Man-Li Zhang; Wei-Wei Liu; Wei-Dong Li
Journal:  Cancer Manag Res       Date:  2021-02-23       Impact factor: 3.989

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.