Literature DB >> 30702490

Common NOD2 Risk Variants as Major Susceptibility Factors for Bacterial Infections in Compensated Cirrhosis.

Matthias Christian Reichert1, Cristina Ripoll2, Markus Casper1, Robin Greinert2, Edith Vandieken1, Frank Grünhage1, Beate Appenrodt1, Alexander Zipprich2, Frank Lammert1.   

Abstract

OBJECTIVES: Common nucleotide-binding oligomerization domain containing 2 (NOD2) gene variants have been associated with bacterial infections (BIs) in cirrhosis, in particular, spontaneous bacterial peritonitis, and mortality. Our aim was to evaluate the independent association of NOD2 variants with BI according to the decompensation stage.
METHODS: Consecutive patients with cirrhosis in 2 academic medical centers were included and genotyped for the NOD2 variants p.R702W, p.G908R, and c.3020insC. Electronic medical records were screened for BI (requiring antibiotic therapy) and past and present decompensation (as defined by variceal bleeding, encephalopathy, ascites, and/or jaundice). Clinically significant portal hypertension (CSPH) was assessed with liver stiffness and/or hepatic venous pressure gradient measurements.
RESULTS: Overall, 735 patients were recruited (men 65%; interquartile age range 53-68 years). Alcoholic cirrhosis was the predominant etiology (n = 406, 55%), and most patients were in the decompensated stage (n = 531, 72%). In total, 158 patients (21%) carried at least one NOD2 variant. BIs were detected in 263 patients (36%), and NOD2 variants were associated with BI (odds ratio = 1.58; 95% confidence interval 1.11-2.27; P = 0.02). In compensated patients, the combination of NOD2 variants and presence of CSPH was the best independent predictors of BI, whereas other factors, such as spleen size and hemoglobin, and decompensations including hepatic encephalopathy or jaundice, gained relevance in decompensated patients.
CONCLUSIONS: NOD2 risk variants are associated with BI in cirrhosis. The genetic effect on BI is strongest in compensated patients, whereas in decompensated patients their presence is less relevant. In this situation, CSPH becomes an independent factor associated with BI.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 30702490      PMCID: PMC6369875          DOI: 10.14309/ctg.0000000000000002

Source DB:  PubMed          Journal:  Clin Transl Gastroenterol        ISSN: 2155-384X            Impact factor:   4.488


INTRODUCTION

Cirrhosis, the common end stage of many chronic liver diseases, is the eighth cause of years of life lost because of premature mortality in the United States (1). In the past decade, further insight into the natural history of cirrhosis was achieved, and 2 distinct stages of the disease with prognostic relevance were identified, namely, compensated and decompensated cirrhosis (2–7). The median survival of compensated patients, those who have never had clinically evident complications of cirrhosis, is greater than a decade (2), whereas patients in the decompensated stage, as defined by the presence of actual or previous variceal bleeding (VB), ascites, hepatic encephalopathy (HE), and/or jaundice, are the ones at highest risk of dying from their liver disease. Bacterial infections (BIs) play a significant role in the natural history of cirrhosis, leading to a dramatic increase in mortality (8–10). BI and decompensation are closely intertwined, in the sense that BI precipitate decompensation, or vice versa, i.e., that decompensation (e.g., VB) favors the development of BI (11–14). Variants of the NOD2 (nucleotide-binding oligomerization domain containing 2) gene were initially associated with impaired mucosal barrier function in Crohn's disease (15,16). NOD2 is an intracellular pattern recognition receptor expressed in macrophages and is involved in the intestinal recognition of bacteria and bacterial products, shaping bacterial colonization (16). Insufficient activation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) in carriers of NOD2 risk variants may result in deficient antimicrobial activity, altered microbiome, and enhanced bacterial translocation (BT) from the intestine (17). Previous studies have associated NOD2 gene variants with spontaneous bacterial peritonitis (SBP) and mortality in decompensated cirrhosis (18–20). The association between NOD2 variants and non-SBP BI according to decompensation stage was evaluated in one study (18), in which no significance (P = 0.107) was observed, but the analysis was limited by the small study size (122 compensated and 121 decompensated patients). Furthermore, the definition of decompensation stage used in this study (18) was not the standard one (2–7); instead acute decompensation was defined by the acute development of large ascites, acute HE, VB, and/or the presence of BI at the time of enrollment. The effects of NOD2 variants on BI according to the decompensation stage in patients with cirrhosis and their interaction with other risk factors are therefore unknown. Therefore, the aim of the present study was to assess the association between common NOD2 risk variants (p.R702W, pG908R, and/or c.3020insC) and BI according to decompensation stage in a large cohort of patients with cirrhosis.

METHODS

Study population

Seven hundred and thirty-five patients with cirrhosis from 2 academic medical centers in Homburg and Halle, Germany, were prospectively included between February 2014 and February 2017. All consecutive Caucasian patients with cirrhosis, hospitalized on the wards or attending liver outpatient clinics, were considered for inclusion. Patients with severe comorbidities, such as end-stage heart failure, HIV infection, and nonresectable cancer except hepatocellular carcinoma (Barcelona Clinic Liver Cancer stages A–C), and patients in whom a BI could not be confirmed were excluded (Figure 1). Cirrhosis was defined by (i) biopsy, (ii) a combination of clinical, laboratory, ultrasound, and endoscopy findings, or (iii) transient elastography > 13.0 kPa. Median elastography (n = 422) was 35.3 kPa (interquartile range [IQR] 20.2–55.2 kPa). In patients with transient elastography <19.7 kPa (21), diagnosis of cirrhosis was additionally confirmed by (i) or (ii). The study was conducted according to the Declaration of Helsinki and Good Clinical Practice (European guidelines). Institutional review board approval was obtained (Homburg: 271/11, Halle 2017-85). All participants provided written informed consent. Electronic medical records were reviewed for clinical data, including past and present decompensation and BI. Further information regarding medication use (such as β-blockers, long-term antibiotic therapy, lactulose, and statins) and laboratory parameters at the time of inclusion were recorded.
Figure 1.

Flow chart outlining inclusion and exclusion of patients in the study

Flow chart outlining inclusion and exclusion of patients in the study

NOD2 genotyping

After isolation of genomic DNA from EDTA-anticoagulated blood using a membrane-based extraction kit (Qiagen, Hilden, Germany), the NOD2 variants rs2066844 (p.R702W), rs2066845 (p.G908R), and rs2066847 (c.3020insC) were genotyped using TaqMan polymerase chain reaction (PCR)-based allelic discrimination assays (Life Technologies, Carlsbad, CA). The assays utilized were p.R702W, C__11717468_20; p.G908R, C__11717466_20; c.3020insC, specifically designed primer, and probe sequences were MGB_F CCAGGTTGTCCAATAACTGCATC; MGB_R CCTTACCAGA-CTTCCAGGATGGT; VIC TGCAGGCCCCTTG; and FAM CTGCAGGCCCTTG. This determination was offered as part of the routine workup after informed consent and was used in the context of prescreening for the randomized controlled Impact of NOD2 genotype-guided antibiotic prevention on survival in patients with liver Cirrhosis and Ascites (INCA) trial (22). All technicians performing the genotyping were blinded to clinical data.

Bacterial infections

All episodes of previous or current BI, which took place after the diagnosis of cirrhosis, were recorded. BI was defined according to the criteria outlined by Bajaj et al. (23). Only infections that were treated with antibiotics were considered as such. Specifically, criteria were as follows: (i) SBP: ascitic fluid was defined as polymorphonuclear cell count >250/μL. (ii) Pulmonary BIs were defined as the presence of an infiltrate/consolidation/cavity plus at least 2 of the following criteria: fever ≥ 38 °C or hypothermia < 35 °C, dyspnoea, or clinical signs of pulmonary BI (cough and purulent sputum, pleuritic chest pain) on physical examination. (iii) Urinary tract infection was defined as > 10 white blood cell (WBC) per high-power field in urine microscopy and positive urine cultures, or significant WBC count in urine (>500/μL) with typical complaints (fever/pain/dysuria/pollakisuria). (iv) Spontaneous bacteremia was defined as growth of a noncommon skin contaminant in blood cultures, without evidence of infection located at another body site (24). When bacteremia was detected in a patient with SBP, pulmonary BI, urinary tract infection, sepsis, or other BI, it was interpreted as secondary to these infections and defined by the primary infection. (e) Clostridium difficile colitis was defined as diarrhea with a positive C. difficile toxin assay. Sepsis was diagnosed and evaluated separately by the presence of a BI, together with impaired host response and organ dysfunction as described in international consensus criteria (25).

Portal hypertension

In subgroups of patients, hepatic venous pressure gradient (HVPG) (n = 139, 19%), transient elastography (n = 413, 56%), and spleen diameter (n = 655, 89%) measurements were performed. In those patients who had available data, the liver stiffness to spleen/platelet (LSPS) score (n = 379) was calculated. LSPS score >1.72 has a high specificity and sensitivity for the presence of clinically significant portal hypertension (CSPH), as defined by HVPG ≥ 10 mm Hg (3,26). A composite parameter was imputed for the estimation of CSPH using HVPG or LSPS score according to their respective cut-offs, and this estimation was available in 481 (65.4%) patients. In the case that the patients had both measurements with inconsistent results, HVPG was used as the reference standard.

Clinical decompensation

Decompensation was defined by present or past VB, HE, ascites, and/or jaundice, as endorsed by both the American Association for the Study of the Liver Diseases (6) and the European Association for the Study of the Liver (7). This definition has previously been shown to have prognostic relevance (2,4,5). Specifically, VB was considered according to the Baveno definition (3). HE was assessed following the West Haven criteria (27). Ascites was defined by the presence of signs of ascites on physical examination and/or confirmed by abdominal ultrasound examination. Patients without clinical ascites but who were dependent on diuretics to treat ascites were considered as decompensated because of the presence of ascites. Jaundice was defined arbitrarily by a total bilirubin ≥3 mg/dL. According to this definition, patients who had shown past decompensation (e.g., VB) were considered to have reached the decompensated stage of the disease even though at the time of inclusion they had no clinically evident decompensation. Therefore, most patients who were compensated were Child–Pugh A and most patients who were decompensated were Child–Pugh B or C. Nevertheless, it is mathematically possible that Child–Pugh A patients are decompensated (e.g., a patient with a good liver function with only ascites or previous VB) and Child–Pugh B patients are compensated (e.g., patients who have had no decompensation despite an altered liver function with low albumin and high international normalized ratio).

Statistical analyses

All variables are described as proportions, means with s.d., or medians with IQR. Univariate analysis was performed with chi-squared test, t test or Mann-Whitney U test, according to the distribution of the test variable. The analysis was stratified for the presence of decompensation and CSPH to evaluate interaction and confounding. A second analysis with stratification according to Child–Pugh A vs B and C was also performed. Variables with P values <0.1 in the univariate analysis were included in stepwise backward logistic regression multivariate models. Multiplicative interaction was tested in the models by introducing the product of the dependent variables. Different models were constructed to avoid collinearity and overfitting. Collinearity was tested using the variance inflation factor. Even if collinearity was not detected, models were constructed to eliminate redundant information (e.g., model of end-stage liver disease [MELD] and creatinine). Overfitting was avoided by including a maximum of 5 - 10 variables per event. Akaike information criterion (AIC) and Bayesian information criterion were used to evaluate the performance of the models. Given the presence of missing values specifically for CSPH, the corrected AIC was used, in which a correction factor is applied according to the numbers of observations and variables. These criteria take into account not only the fit of the model but also the number of included variables; hence, the most parsimonious model is preferred. The lower the AIC, corrected AIC, or Bayesian information criterion, the better the fit of the model, because it explains more variability of the dependent variable (in our case BI). The statistical analyses were performed with SPSS 22.0 (SPSS, Munich, Germany). Two-sided P values <0.05 were regarded as significant. German Clinical Trials Register DRKS00005616 (registered January 22, 2014).

RESULTS

Table 1 summarizes the baseline patient characteristics. The predominant etiology of cirrhosis was alcoholic liver disease (n = 406, 55.2%). Most patients presented with Child–Pugh class A (A: 55.1%, B: 39.6%, and C: 5.3%) at the time of inclusion, and almost 3 quarters of our patient population were in the decompensated stage of the disease (n = 531, 72.2%). The median MELD score was 10.8 (IQR 8.3–14.8). Approximately one fifth of the population (n = 158, 21.5%) were carriers of at least one NOD2 risk variant. Only 2 patients were homozygous carriers, and 5 patients carried 2 heterozygous variants. Because of the low frequency of these patients, they were combined with the patients who were heterozygous carriers, and further analysis is performed only according to the presence or absence of risk NOD2 variants. The prevalence of NOD2 variants was similar in patients with compensated (n = 42, 20.6%) and decompensated cirrhosis (n = 116, 21.8%).
Table 1.

Baseline characteristics

Baseline characteristics Overall, 263 (35.8%) patients had a previous history of or current BI. BI occurred relatively shortly before inclusion (median 3 [IQR 25/75 0.0–37.0] months). Among those, 85 patients (36.2%) with BI were present at inclusion. Supplementary Table 1 (Supplemental Digital Content 1, http://links.lww.com/CTG/A2) summarizes the different BIs. Expectedly, patients with decompensated cirrhosis had a higher prevalence of BI (n = 230, 43.3%) than patients with compensated cirrhosis (n = 33, 16.2%). The presence of a NOD2 gene variant was associated with BI (unadjusted odds ratio [OR] = 1.58; 95% confidence interval [CI] 1.10–2.27). The magnitude of the effect was higher in compensated (unadjusted OR = 2.69; 95% CI 1.19–6.05) than in decompensated patients (unadjusted OR = 1.41; 95% CI 0.94–2.14), indicating the presence of interaction between the stage of the disease and the presence of NOD2 variants. Similar results, albeit less marked, were observed when the patients were stratified according to Child–Pugh class (A vs B/C) (OR = 1.97; 95% CI 1.16–3.32 vs OR = 1.20; 95% CI 0.72–2.02, respectively). Of our patients, 55 (7.5%) had a previous transjugular intrahepatic portosystemic shunt. Among these patients, no association of NOD2 variants with BIs could be detected (OR = 0.87; 95% CI 0.24–3.23; P = 1.0).

Predictors of BI in compensated patients

Table 2 presents the results of the univariate analysis of BI predictors among compensated patients. Among the different multivariate models (Table 3), including the variables associated with BI in the univariate analysis, the combination of the presence of a NOD2 risk variant (OR = 4.79; 95% CI 1.51–15.18) and the presence of CSPH (OR = 4.35; 95% CI 1.29–14.66) were the best independent predictors of BI in compensated patients. Among the patients in whom CSPH was estimated, the effect of NOD2 on BI was smaller among patients with CSPH (n = 69: unadjusted OR = 4.54; 95% CI 1.14–18.1) than in patients without CSPH (n = 64: unadjusted OR = 5.67; 95% CI 0.71–45.5).
Table 2.

Univariate analysis of the predictors of BI among compensated patients

Table 3.

Models to identify the variables independently associated with BI in compensated cirrhosis

Univariate analysis of the predictors of BI among compensated patients Models to identify the variables independently associated with BI in compensated cirrhosis Given the fact that the liver disease was slightly more severe in the compensated patients with an estimation of CSPH (as defined by HVPG or LSPS score) as compared to compensated patients without an estimation of CSPH (see Table 2, Supplemental Digital Content 1, http://links.lww.com/CTG/A2), the analysis was repeated in the subgroup of patients who had an estimation of CSPH. Consistently, in this subgroup (n = 133), the models that combined NOD2 and CSPH were among the best for identifying the patients with BI in our population of compensated cirrhosis, as indicated by the lowest (corrected) AIC (see Table 3, Supplemental Digital Content 1, http://links.lww.com/CTG/A2).

Predictors of BI in decompensated patients

Table 4 summarizes the univariate analysis of predictors of BI in decompensated patients. The presence of NOD2 variants was not associated to BI in the univariate analysis of this subgroup of patients. Other risk indicators were identified, including the variables that are used to calculate the MELD score (bilirubin, creatinine, and international normalized ratio), markers of inflammation (C-reactive protein and WBC), specific decompensations of cirrhosis, such as HE and jaundice, and administration of long-term antibiotic therapy. Given the lack of association on univariate analysis with the variable of interest (i.e., presence of NOD2 variants) in decompensated patients, no further models were calculated.
Table 4.

Univariate analysis of the predictors of BI among decompensated patients

Univariate analysis of the predictors of BI among decompensated patients

DISCUSSION

Bacterial infections cause high morbidity and mortality in patients with cirrhosis (28,29). In this large multicenter study, we demonstrate an association between carriage of a NOD2 risk allele and BI in patients with cirrhosis. Of note, in patients with compensated disease, the presence of a NOD2 risk allele has a greater impact on the occurrence of BI than in patients with decompensated cirrhosis. In compensated cirrhosis, the presence of CSPH as assessed by HPVG and LSPS score was another independent variable associated to BI. In contrast, in decompensated cirrhosis, the presence of a NOD2 variant loses its relevance and other risk indicators gained a more prominent role. Compensated and decompensated cirrhosis are 2 distinct clinical situations, which are characterized by markedly different prognosis (2). Furthermore, the pathophysiological mechanisms that affect the natural history of the disease also differ between these two disease stages (30–32). As genetic factors only represent one of many drivers in patients with decompensated cirrhosis, genetic risk factors are accordingly more likely to be relevant in compensated cirrhosis. Correspondingly, we confirmed in our cohort the presence of a NOD2 risk variant as major risk factors for BI in compensated cirrhosis, in addition to proton pump inhibitor use, partial thromboplastin time, hemoglobin levels, platelet count, and the presence of CSPH. In models incorporating multiple significant contributors, the model consisting of the presence of at least one NOD2 risk variant and CSPH was most accurate. In decompensated cirrhosis, as previously demonstrated (10,29) and also confirmed in our cohort, additional factors reflecting the degree of liver injury (MELD score, liver stiffness, albumin, partial thromboplastin time, and platelet count), the presence of complications (including ascites, HE, and jaundice) and markers of portal hypertension (i.e., spleen size) are additionally relevant (8). The functional mechanisms that link the presence of a NOD2 risk variant to BI susceptibility in cirrhosis have yet to be fully defined. One might hypothesize that the development of a leaky gut in patients with cirrhosis (33) is favored by NOD2 risk variants, as the presence of a NOD2 risk allele has been associated to BT (33). In decompensated cirrhosis, other factors additionally impair the intestinal mucosal barrier, and these could override in magnitude the predisposition caused by the presence of NOD2 risk variants. Incorporating the recent systemic inflammation hypothesis (34), increased inflammation due to an increase of pathogen-associated molecular patterns and damage-associated molecular patterns might be paramount for patients with compensated cirrhosis, with presence of NOD2 risk variants and few other risk factors. In this sense, a recently published longitudinal study identified C-reactive protein as an independent predictor of decompensation in patients with compensated cirrhosis (35). Notwithstanding the limitations of the small subgroup size, the impact of NOD2 risk variants on BI was even more pronounced among those patients with compensated disease who did not present with CSPH, providing further support for this hypothesis. This is the first study that evaluates the association between the carriage of a NOD2 risk variant and the spectrum of BI in cirrhosis according to decompensation stage. A previous smaller study, including 243 cases with cirrhosis, failed to confirm an association of non-SBP BI with NOD2 risk variants (18), although a trend was observed in Kaplan–Meier analysis. Even though in this study both compensated and decompensated patients were included, the definition of decompensation used in this study, and the other currently available studies, is not the one that has been shown to have prognostic relevance (2). Previous studies have focused on the role of NOD2 in decompensated stage of cirrhosis and development of SBP with controversial results. On one hand, an association between NOD2 variants and all cases of SBP (19,20) or culture-positive SBP (20) was found; on the other hand, another study failed to replicate this association (33), albeit increased BT was found in carriers of the p.G908R variant in this cohort. In our cohort, although we could not confirm the association between carriage of a NOD2 risk allele and SBP, we did observe an increased frequency of spontaneous bacteremia (see Table 1, Supplemental Digital Content 1, http://links.lww.com/CTG/A2), which shares a common pathophysiology with SBP (24). Our study has limitations mainly inherent to its cross-sectional nature: First, the BIs were identified retrospectively. To minimize bias, we applied the strict definitions of BI that have been previously described and included only patients with verified BI, which took place after the diagnosis of cirrhosis. Furthermore, clinical records were systematically screened, including all microbiology reports and corresponding medical records. Second, not all patients had an estimation of CSPH, which was based either on HVPG measurements in a large number of patients, the gold standard for determining the presence of CSPH, or the LSPS score developed by Berzigotti et al. (26). The latter approach has shown to have high accuracy for the detection of CSPH. Therefore, we combined both parameters to estimate the presence of CSPH. Of note, within the group of compensated patients with an available estimation of CSPH, liver disease was slightly more advanced than in patients without these measurements. To address this issue, a sensitivity analysis was performed, and the results could be replicated in the subgroup of patients with an available estimation of CSPH, confirming the same predictors for BI as in the whole group. Finally, due to the design of the study, cause-effect associations cannot be strictly assumed. Indeed, the required temporal association between the independent variables and the effect (BI) can only be definitely assured for the presence of the inherited NOD2 variants. In conclusion, our results highlight that the common NOD2 risk variants are a major susceptibility factor for BI in the compensated stage of cirrhosis. The combination of NOD2 variants and CSPH is the best model indicating risk of BI in this stage of the disease, whereas in decompensated cirrhosis traditional markers of liver failure are stronger risk indicators. Further studies are warranted to evaluate how early intervention strategies could improve the outcome of patients at highest risk.

CONFLICTS OF INTEREST

Guarantor of the article: Frank Lammert, MD, PhD. Specific author contributions: M.C.R. and C.R. are co-first authorship. A.Z. and F.L. have co-senior authorship. M.C.R., C.R., and F.L. designed the study; M.C., R.G., E.V., F.G., and B.A. participated in the acquisition of clinical data, drafted the manuscript, and together with M.C.R., C.R., A.Z., and F.L. analyzed the data and finalized the manuscript, which was then revised by all authors. The final draft of the manuscript has been approved by all authors. The contents of this manuscript are our original work and have not been published, in whole or in part, prior to or simultaneous with our submission of the manuscript. Financial support: The INCA trial is funded by the independent clinical trials funding program of the German Federal Ministry of Education and Research (grant number 01KG1201 to F.L.). This study was supported by additional grants from the Federal Ministry of Education and Research of Germany (BMBF LiSyM 031L0051 to F.L.), a grant from the Schwiete Foundation (grant 01/2017 to C.R.), and grants from the Faculty of Medicine of Saarland University (HOMFOR T201000747) to M.C.R. Potential competing interests: The authors who have taken part in this study declared that they do not have anything to disclose regarding conflicts of interest with respect to this manuscript.

Study Highlights

WHAT IS KNOWN ✓ The common NOD2 gene variants p.R702W, p.G908R, and c.3020insC are susceptibility factors for SBP in decompensated cirrhosis. ✓ Assessment of the impact of NOD2 variants according to the decompensation stage of cirrhosis and the influence of markers of portal hypertension is lacking. WHAT IS NEW HERE ✓ The presence of common NOD2 gene variants is a risk factor for BIs in cirrhosis in general. ✓ The genetic effect is strongest in compensated cirrhosis and also dependent on the presence of CSPH, whereas in decompensated cirrhosis, traditional factors associated with liver failure dominate. TRANSLATIONAL IMPACT ✓ The analysis of increased bacterial translocation and/or altered gut microbiota are of great interest for further studies and might reveal further causal pathways. ✓ Further studies are warranted to evaluate early (molecular) intervention strategies to improve the outcome of patients at highest risk.
  35 in total

1.  The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3).

Authors:  Mervyn Singer; Clifford S Deutschman; Christopher Warren Seymour; Manu Shankar-Hari; Djillali Annane; Michael Bauer; Rinaldo Bellomo; Gordon R Bernard; Jean-Daniel Chiche; Craig M Coopersmith; Richard S Hotchkiss; Mitchell M Levy; John C Marshall; Greg S Martin; Steven M Opal; Gordon D Rubenfeld; Tom van der Poll; Jean-Louis Vincent; Derek C Angus
Journal:  JAMA       Date:  2016-02-23       Impact factor: 56.272

Review 2.  From sensing to shaping microbiota: insights into the role of NOD2 in intestinal homeostasis and progression of Crohn's disease.

Authors:  Iyshwarya Balasubramanian; Nan Gao
Journal:  Am J Physiol Gastrointest Liver Physiol       Date:  2017-04-27       Impact factor: 4.052

3.  Second infections independently increase mortality in hospitalized patients with cirrhosis: the North American consortium for the study of end-stage liver disease (NACSELD) experience.

Authors:  Jasmohan S Bajaj; Jacqueline G O'Leary; K Rajender Reddy; Florence Wong; Jody C Olson; Ram M Subramanian; Geri Brown; Nicole A Noble; Leroy R Thacker; Patrick S Kamath
Journal:  Hepatology       Date:  2012-12       Impact factor: 17.425

4.  Hepatic encephalopathy in chronic liver disease: 2014 Practice Guideline by the American Association for the Study of Liver Diseases and the European Association for the Study of the Liver.

Authors:  Hendrik Vilstrup; Piero Amodio; Jasmohan Bajaj; Juan Cordoba; Peter Ferenci; Kevin D Mullen; Karin Weissenborn; Philip Wong
Journal:  Hepatology       Date:  2014-07-08       Impact factor: 17.425

5.  Bacterial and fungal infections in acute-on-chronic liver failure: prevalence, characteristics and impact on prognosis.

Authors:  Javier Fernández; Juan Acevedo; Reiner Wiest; Thierry Gustot; Alex Amoros; Carme Deulofeu; Enric Reverter; Javier Martínez; Faouzi Saliba; Rajiv Jalan; Tania Welzel; Marco Pavesi; María Hernández-Tejero; Pere Ginès; Vicente Arroyo
Journal:  Gut       Date:  2017-08-28       Impact factor: 23.059

6.  Functional polymorphisms of innate immunity receptors are not risk factors for the non-SBP type bacterial infections in cirrhosis.

Authors:  Tamas Dinya; Tamas Tornai; Zsuzsanna Vitalis; Istvan Tornai; Boglárka Balogh; David Tornai; Peter Antal-Szalmas; Andrea Sumegi; Hajnalka Andrikovics; Andras Bors; Attila Tordai; Maria Papp
Journal:  Liver Int       Date:  2018-01-17       Impact factor: 5.828

7.  Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease.

Authors:  J P Hugot; M Chamaillard; H Zouali; S Lesage; J P Cézard; J Belaiche; S Almer; C Tysk; C A O'Morain; M Gassull; V Binder; Y Finkel; A Cortot; R Modigliani; P Laurent-Puig; C Gower-Rousseau; J Macry; J F Colombel; M Sahbatou; G Thomas
Journal:  Nature       Date:  2001-05-31       Impact factor: 49.962

8.  Prognostic indicators of survival in patients with compensated and decompensated cirrhosis.

Authors:  Alexander Zipprich; Guadalupe Garcia-Tsao; Sebastian Rogowski; Wolfgang E Fleig; Thomas Seufferlein; Matthias M Dollinger
Journal:  Liver Int       Date:  2012-06-11       Impact factor: 5.828

9.  Cardiopulmonary hemodynamics and C-reactive protein as prognostic indicators in compensated and decompensated cirrhosis.

Authors:  Laura Turco; Guadalupe Garcia-Tsao; Ilenia Magnani; Marcello Bianchini; Martina Costetti; Cristian Caporali; Stefano Colopi; Emilio Simonini; Nicola De Maria; Federico Banchelli; Rosario Rossi; Erica Villa; Filippo Schepis
Journal:  J Hepatol       Date:  2018-01-10       Impact factor: 25.083

10.  Bacterial infections in cirrhosis: a position statement based on the EASL Special Conference 2013.

Authors:  Rajiv Jalan; Javier Fernandez; Reiner Wiest; Bernd Schnabl; Richard Moreau; Paolo Angeli; Vanessa Stadlbauer; Thierry Gustot; Mauro Bernardi; Rafael Canton; Agustin Albillos; Frank Lammert; Alexander Wilmer; Rajeshwar Mookerjee; Jordi Vila; Rita Garcia-Martinez; Julia Wendon; José Such; Juan Cordoba; Arun Sanyal; Guadalupe Garcia-Tsao; Vicente Arroyo; Andrew Burroughs; Pere Ginès
Journal:  J Hepatol       Date:  2014-02-12       Impact factor: 25.083

View more
  2 in total

1.  Genetic variants of innate immunity receptors are associated with mortality in cirrhotic patients with bacterial infection.

Authors:  Jelte J Schaapman; Àlex Amoros; Johan J van der Reijden; Wim Laleman; Stefan Zeuzem; Rafael Bañares; Rajiv Jalan; Vicente Arroyo; Joan Clària; Hein W Verspaget; Minneke J Coenraad
Journal:  Liver Int       Date:  2020-02-16       Impact factor: 5.828

Review 2.  Gut-liver axis signaling in portal hypertension.

Authors:  Benedikt Simbrunner; Mattias Mandorfer; Michael Trauner; Thomas Reiberger
Journal:  World J Gastroenterol       Date:  2019-10-21       Impact factor: 5.742

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.